ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart16f11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_511841.1| PREDICTED: Pan troglodytes similar to recoverin... 42 1.7
2ref|NM_002903.2| Homo sapiens recoverin (RCV1), mRNA 42 1.7
3gb|BC001720.1| Homo sapiens recoverin, mRNA (cDNA clone MGC:1649... 42 1.7
4gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, compl... 42 1.7
5gb|BT009838.1| Homo sapiens recoverin mRNA, complete cds 42 1.7
6gb|S62028.1| recoverin [human, retina, mRNA, 1108 nt] 42 1.7
7gb|S45545.1| cancer-associated retinopathy antigen [human, mRNA,... 42 1.7
8gb|S43855.1| recoverin=photoreceptor protein [human, retina, mRN... 42 1.7
9gb|AC026591.15| Homo sapiens chromosome 17, clone RP11-655D3, co... 42 1.7
10gb|AY889431.1| Synthetic construct Homo sapiens clone FLH109935.... 42 1.7
11gb|AC167667.4| Culex pipiens quinquefasciatus, clone Culex pipie... 42 1.7
12gb|AC005747.1|AC005747 Homo sapiens chromosome 17, clone hRPK.15... 42 1.7
13dbj|AB001838.1| Homo sapiens mRNA for recoverin, complete cds 42 1.7
14gb|AY555117.1| Sipanea veris internal transcribed spacer 1, part... 40 6.6
15gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome 40 6.6
16gb|AY043330.1| Streptomyces lividans multidrug resistance efflux... 40 6.6
17gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 40 6.6
18emb|AL939114.1|SCO939114 Streptomyces coelicolor A3(2) complete ... 40 6.6
19ref|NM_143178.1| Drosophila melanogaster CG5886-RA (CG5886), mRNA 40 6.6
20gb|AC106878.3| Homo sapiens BAC clone RP11-648O9 from 4, complet... 40 6.6
21gb|AY047502.1| Drosophila melanogaster GH01188 full length cDNA 40 6.6
22gb|AC159295.2| Mus musculus BAC clone RP23-273L18 from chromosom... 40 6.6
23gb|AC154441.3| Mus musculus BAC clone RP24-176O5 from chromosome... 40 6.6
24gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 40 6.6
25gb|AC008209.5|AC008209 Drosophila melanogaster, chromosome 3R, r... 40 6.6
26gb|AC093721.3| Homo sapiens BAC clone CTD-2010B10 from 4, comple... 40 6.6
27gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 6.6
28dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome 40 6.6
29gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c... 40 6.6
30gb|AE003753.3| Drosophila melanogaster chromosome 3R, section 91... 40 6.6
31gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 40 6.6

>ref|XM_511841.1| PREDICTED: Pan troglodytes similar to recoverin (LOC455078), mRNA
          Length = 1087

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 214 aaaacacgccggaaaggcgagccga 238
           ||||||||||||||| |||||||||
Sbjct: 686 aaaacacgccggaaaagcgagccga 710



to top

>ref|NM_002903.2| Homo sapiens recoverin (RCV1), mRNA
          Length = 1217

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 214 aaaacacgccggaaaggcgagccga 238
           ||||||||||||||| |||||||||
Sbjct: 621 aaaacacgccggaaaagcgagccga 645



to top

>gb|BC001720.1| Homo sapiens recoverin, mRNA (cDNA clone MGC:1649 IMAGE:3354566),
           complete cds
          Length = 1101

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 214 aaaacacgccggaaaggcgagccga 238
           ||||||||||||||| |||||||||
Sbjct: 505 aaaacacgccggaaaagcgagccga 529



to top

>gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, complete sequence
          Length = 3363523

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 253     ggcgggcattgccgacgcgcc 273
               |||||||||||||||||||||
Sbjct: 1145400 ggcgggcattgccgacgcgcc 1145420



to top

>gb|BT009838.1| Homo sapiens recoverin mRNA, complete cds
          Length = 603

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 214 aaaacacgccggaaaggcgagccga 238
           ||||||||||||||| |||||||||
Sbjct: 434 aaaacacgccggaaaagcgagccga 458



to top

>gb|S62028.1| recoverin [human, retina, mRNA, 1108 nt]
          Length = 1108

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 214 aaaacacgccggaaaggcgagccga 238
           ||||||||||||||| |||||||||
Sbjct: 518 aaaacacgccggaaaagcgagccga 542



to top

>gb|S45545.1| cancer-associated retinopathy antigen [human, mRNA, 1101 nt]
          Length = 1101

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 214 aaaacacgccggaaaggcgagccga 238
           ||||||||||||||| |||||||||
Sbjct: 521 aaaacacgccggaaaagcgagccga 545



to top

>gb|S43855.1| recoverin=photoreceptor protein [human, retina, mRNA, 1190 nt]
          Length = 1190

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 214 aaaacacgccggaaaggcgagccga 238
           ||||||||||||||| |||||||||
Sbjct: 621 aaaacacgccggaaaagcgagccga 645



to top

>gb|AC026591.15| Homo sapiens chromosome 17, clone RP11-655D3, complete sequence
          Length = 153472

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 214   aaaacacgccggaaaggcgagccga 238
             ||||||||||||||| |||||||||
Sbjct: 68932 aaaacacgccggaaaagcgagccga 68956



to top

>gb|AY889431.1| Synthetic construct Homo sapiens clone FLH109935.01X recoverin
           (RCV1) mRNA, complete cds
          Length = 603

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 214 aaaacacgccggaaaggcgagccga 238
           ||||||||||||||| |||||||||
Sbjct: 434 aaaacacgccggaaaagcgagccga 458



to top

>gb|AC167667.4| Culex pipiens quinquefasciatus, clone Culex pipiens
             quinquefasciatus-3940123D9, complete sequence
          Length = 121336

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 457   gtcgcgcccggcggggtcatgctcc 481
             ||||||||||||||||||| |||||
Sbjct: 54752 gtcgcgcccggcggggtcacgctcc 54776



to top

>gb|AC005747.1|AC005747 Homo sapiens chromosome 17, clone hRPK.150_K_15, complete sequence
          Length = 166701

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 214   aaaacacgccggaaaggcgagccga 238
             ||||||||||||||| |||||||||
Sbjct: 16342 aaaacacgccggaaaagcgagccga 16318



to top

>dbj|AB001838.1| Homo sapiens mRNA for recoverin, complete cds
          Length = 603

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 214 aaaacacgccggaaaggcgagccga 238
           ||||||||||||||| |||||||||
Sbjct: 434 aaaacacgccggaaaagcgagccga 458



to top

>gb|AY555117.1| Sipanea veris internal transcribed spacer 1, partial sequence; 5.8S
           ribosomal RNA gene, complete sequence; and internal
           transcribed spacer 2, partial sequence
          Length = 644

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 417 cgcgccgccgccgaaggggc 436
           ||||||||||||||||||||
Sbjct: 215 cgcgccgccgccgaaggggc 196



to top

>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome
          Length = 3345170

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 362    cgcggcgaccgacgacggccgcgc 385
              ||||||||||||||||| ||||||
Sbjct: 369049 cgcggcgaccgacgacgcccgcgc 369026



to top

>gb|AY043330.1| Streptomyces lividans multidrug resistance efflux protein (ebrB)
           gene, complete cds
          Length = 2120

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 cggcatcccggtgctggtcg 460
           ||||||||||||||||||||
Sbjct: 827 cggcatcccggtgctggtcg 846



to top

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 257     ggcattgccgacgcgcctttccgc 280
               |||||| |||||||||||||||||
Sbjct: 2900091 ggcattaccgacgcgcctttccgc 2900114



to top

>emb|AL939114.1|SCO939114 Streptomyces coelicolor A3(2) complete genome; segment 11/29
          Length = 313800

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 441    cggcatcccggtgctggtcg 460
              ||||||||||||||||||||
Sbjct: 155722 cggcatcccggtgctggtcg 155703



to top

>ref|NM_143178.1| Drosophila melanogaster CG5886-RA (CG5886), mRNA
          Length = 1888

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 310 aagtggaggaggagcggcgc 329
           ||||||||||||||||||||
Sbjct: 420 aagtggaggaggagcggcgc 439



to top

>gb|AC106878.3| Homo sapiens BAC clone RP11-648O9 from 4, complete sequence
          Length = 135342

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 132   atacaacaatgtcagtttaacagtacca 159
             |||||||| ||||||| |||||||||||
Sbjct: 27041 atacaacattgtcagtataacagtacca 27068



to top

>gb|AY047502.1| Drosophila melanogaster GH01188 full length cDNA
          Length = 1841

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 310 aagtggaggaggagcggcgc 329
           ||||||||||||||||||||
Sbjct: 371 aagtggaggaggagcggcgc 390



to top

>gb|AC159295.2| Mus musculus BAC clone RP23-273L18 from chromosome 13, complete
             sequence
          Length = 165475

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 425   cgccgaaggggcttcccggc 444
             ||||||||||||||||||||
Sbjct: 19610 cgccgaaggggcttcccggc 19629



to top

>gb|AC154441.3| Mus musculus BAC clone RP24-176O5 from chromosome 13, complete sequence
          Length = 169507

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 425    cgccgaaggggcttcccggc 444
              ||||||||||||||||||||
Sbjct: 166751 cgccgaaggggcttcccggc 166770



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 441     cggcatcccggtgctggtcg 460
               ||||||||||||||||||||
Sbjct: 1133891 cggcatcccggtgctggtcg 1133872



to top

>gb|AC008209.5|AC008209 Drosophila melanogaster, chromosome 3R, region 96F-96F, BAC clone
              BACR06K17, complete sequence
          Length = 169902

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 310    aagtggaggaggagcggcgc 329
              ||||||||||||||||||||
Sbjct: 125111 aagtggaggaggagcggcgc 125130



to top

>gb|AC093721.3| Homo sapiens BAC clone CTD-2010B10 from 4, complete sequence
          Length = 128148

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 9     aacacatgattatatgtctc 28
             ||||||||||||||||||||
Sbjct: 56960 aacacatgattatatgtctc 56979



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 449     cggtgctggtcgcgcccggc 468
               ||||||||||||||||||||
Sbjct: 1578945 cggtgctggtcgcgcccggc 1578926



to top

>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome
          Length = 4659019

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 416     acgcgccgccgccgaagggg 435
               ||||||||||||||||||||
Sbjct: 4567248 acgcgccgccgccgaagggg 4567229



to top

>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 356     tggccacgcggcgaccgacg 375
               ||||||||||||||||||||
Sbjct: 2058876 tggccacgcggcgaccgacg 2058895



to top

>gb|AE003753.3| Drosophila melanogaster chromosome 3R, section 91 of 118 of the complete
              sequence
          Length = 226793

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 310    aagtggaggaggagcggcgc 329
              ||||||||||||||||||||
Sbjct: 190896 aagtggaggaggagcggcgc 190915



to top

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 439     cccggcatcccggtgctggt 458
               ||||||||||||||||||||
Sbjct: 2173237 cccggcatcccggtgctggt 2173256


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,960,825
Number of Sequences: 3902068
Number of extensions: 3960825
Number of successful extensions: 112607
Number of sequences better than 10.0: 31
Number of HSP's better than 10.0 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 111462
Number of HSP's gapped (non-prelim): 1145
length of query: 490
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 468
effective length of database: 17,147,199,772
effective search space: 8024889493296
effective search space used: 8024889493296
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top