ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart16e11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC145802.2| Xenopus tropicalis clone CH216-80C17, complete se... 42 0.34
2gb|BC077749.1| Xenopus laevis spermatogenesis associated, serine... 40 1.3
3ref|XM_739811.1| Plasmodium chabaudi chabaudi hypothetical prote... 40 1.3
4gb|AC069421.9| Homo sapiens 3 BAC RP11-528A4 (Roswell Park Cance... 40 1.3
5dbj|AB194122.1| Zelkova serrata DNA, satellite marker: bczs418c 40 1.3
6gb|AC098645.3| Papio anubis clone RP41-470J23, complete sequence 40 1.3
7ref|XM_642033.1| Dictyostelium discoideum hypothetical protein (... 38 5.3
8ref|XM_641557.1| Dictyostelium discoideum bromodomain-containing... 38 5.3
9ref|XM_640896.1| Dictyostelium discoideum hypothetical protein (... 38 5.3
10ref|XM_630010.1| Dictyostelium discoideum hypothetical protein (... 38 5.3
11gb|AC160545.8| Mus musculus chromosome 1, clone RP23-217K18, com... 38 5.3
12gb|AC117783.9| Mus musculus chromosome 16, clone RP24-544H3, com... 38 5.3
13gb|AC147342.3| Pan troglodytes BAC clone CH251-13D13 from Y, com... 38 5.3
14gb|AC147684.4| Pan troglodytes BAC clone CH251-497P9 from Y, com... 38 5.3
15gb|AC147665.3| Pan troglodytes BAC clone CH251-134K23 from Y, co... 38 5.3
16gb|AC147686.2| Pan troglodytes BAC clone CH251-285E7 from Y, com... 38 5.3
17gb|AC147657.2| Pan troglodytes BAC clone CH251-433L14 from Y, co... 38 5.3
18gb|AC147654.3| Pan troglodytes BAC clone CH251-511H17 from Y, co... 38 5.3
19gb|AC147682.3| Pan troglodytes BAC clone CH251-563H18 from Y, co... 38 5.3
20gb|AC107846.4| Mus musculus chromosome 1, clone RP23-309I23, com... 38 5.3
21gb|AC160398.8| Mus musculus 6 BAC RP23-162K3 (Roswell Park Cance... 38 5.3
22gb|AC101902.9| Mus musculus chromosome 1, clone RP24-147M23, com... 38 5.3
23gb|AC117686.10| Mus musculus chromosome 16, clone RP23-440B15, c... 38 5.3
24ref|XM_817736.1| Trypanosoma brucei TREU927 hypothetical protein... 38 5.3
25ref|XM_718648.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 38 5.3
26ref|XM_732843.1| Plasmodium chabaudi chabaudi hypothetical prote... 38 5.3
27gb|AC144378.2| Pan troglodytes BAC clone RP43-20D17 from Y, comp... 38 5.3
28gb|AC142313.1| Pan troglodytes BAC clone RP43-48C7 from Y, compl... 38 5.3
29emb|BX629346.17| Zebrafish DNA sequence from clone DKEY-16N21 in... 38 5.3
30gb|AC159017.2| Pan troglodytes BAC clone CH251-571G18 from chrom... 38 5.3
31emb|AL606754.6| Human DNA sequence from clone RP11-479E16 on chr... 38 5.3
32emb|AL590432.9| Human DNA sequence from clone RP11-141A19 on chr... 38 5.3
33emb|AL445605.7| Human DNA sequence from clone RP11-335D7 on chro... 38 5.3
34emb|AL160036.12| Human DNA sequence from clone RP11-555C15 on ch... 38 5.3
35gb|AC007671.7| Homo sapiens Human 12 BAC RP11-49G2 (Roswell Park... 38 5.3
36gb|AC087560.26| Mus musculus strain C57BL/6J clone rp23-448g13 m... 38 5.3
37dbj|BS000673.1| Pan troglodytes chromosome Y clone:PTB-403A06, c... 38 5.3
38dbj|BS000602.1| Pan troglodytes chromosome Y clone:PTB-547B05, c... 38 5.3
39gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 38 5.3
40gb|AC093430.3| Homo sapiens chromosome 1 clone RP11-171B15, comp... 38 5.3
41gb|AC097535.3| Homo sapiens BAC clone RP11-802H3 from 4, complet... 38 5.3
42emb|AL929509.15| Zebrafish DNA sequence from clone CH211-165I22 ... 38 5.3
43gb|AC147670.4| Pan troglodytes BAC clone CH251-94F1 from chromos... 38 5.3
44gb|AC151848.4| Pan troglodytes BAC clone CH251-346F2 from chromo... 38 5.3
45gb|AC150006.3| Pan troglodytes BAC clone CH251-416C12 from chrom... 38 5.3
46gb|AC048338.29| Homo sapiens 12 BAC RP11-512M8 (Roswell Park Can... 38 5.3
47gb|AC147571.5| Pan troglodytes BAC clone CH251-422I9 from chromo... 38 5.3
48gb|AC146011.4| Pan troglodytes BAC clone RP43-42M15 from chromos... 38 5.3
49gb|AC027663.14|AC027663 Homo sapiens chromosome 1 clone RP11-285... 38 5.3
50gb|AC005191.1|AC005191 Homo sapiens PAC clone RP1-269O5 from Xq2... 38 5.3
51gb|U47655.1|LLU47655 Leuconostoc lactis plasmid pNZ63 lactose tr... 38 5.3
52emb|AL671920.9| Mouse DNA sequence from clone RP23-445A22 on chr... 38 5.3 
>gb|AC145802.2| Xenopus tropicalis clone CH216-80C17, complete sequence
          Length = 163910

 Score = 42.1 bits (21), Expect = 0.34
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 3     aagcacatattatatgtgcta 23
             |||||||||||||||||||||
Sbjct: 98064 aagcacatattatatgtgcta 98084
to top
>gb|BC077749.1| Xenopus laevis spermatogenesis associated, serine-rich 2, mRNA (cDNA
            clone MGC:79004 IMAGE:4406991), complete cds
          Length = 2142

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 38   acaaaactattacaacaaca 57
            ||||||||||||||||||||
Sbjct: 1576 acaaaactattacaacaaca 1595
to top
>ref|XM_739811.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000210.02.0)
           partial mRNA
          Length = 888

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 6   cacatattatatgtgctaat 25
           ||||||||||||||||||||
Sbjct: 274 cacatattatatgtgctaat 255
to top
>gb|AC069421.9| Homo sapiens 3 BAC RP11-528A4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 157289

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 37    cacaaaactattacaacaacaata 60
             ||||||||| ||||||||||||||
Sbjct: 28992 cacaaaactgttacaacaacaata 28969
to top
>dbj|AB194122.1| Zelkova serrata DNA, satellite marker: bczs418c
          Length = 451

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 37  cacaaaactattacaacaacaata 60
           ||||||||||| ||||||||||||
Sbjct: 327 cacaaaactataacaacaacaata 350
to top
>gb|AC098645.3| Papio anubis clone RP41-470J23, complete sequence
          Length = 193317

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 69     ataattaaatcaaacaaaca 88
              ||||||||||||||||||||
Sbjct: 124975 ataattaaatcaaacaaaca 124994
to top
>ref|XM_642033.1| Dictyostelium discoideum hypothetical protein (DDB0189368), partial
            mRNA
          Length = 3480

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 12   ttatatgtgctaataatga 30
            |||||||||||||||||||
Sbjct: 1753 ttatatgtgctaataatga 1735
to top
>ref|XM_641557.1| Dictyostelium discoideum bromodomain-containing protein (DDB0220695),
            partial mRNA
          Length = 9744

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 40   aaaactattacaacaacaa 58
            |||||||||||||||||||
Sbjct: 2694 aaaactattacaacaacaa 2712
to top
>ref|XM_640896.1| Dictyostelium discoideum hypothetical protein (DDB0190281), partial
            mRNA
          Length = 6666

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 40   aaaactattacaacaacaa 58
            |||||||||||||||||||
Sbjct: 4560 aaaactattacaacaacaa 4578
to top
>ref|XM_630010.1| Dictyostelium discoideum hypothetical protein (DDB0183780), partial
           mRNA
          Length = 4752

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 12  ttatatgtgctaataatgactct 34
           ||||||||| |||||||||||||
Sbjct: 728 ttatatgtgataataatgactct 750
to top
>gb|AC160545.8| Mus musculus chromosome 1, clone RP23-217K18, complete sequence
          Length = 240081

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 2      aaagcacatattatatgtg 20
              |||||||||||||||||||
Sbjct: 227440 aaagcacatattatatgtg 227458
to top
>gb|AC117783.9| Mus musculus chromosome 16, clone RP24-544H3, complete sequence
          Length = 164296

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 38    acaaaactattacaacaacaata 60
             |||||||||| ||||||||||||
Sbjct: 37539 acaaaactataacaacaacaata 37561
to top
>gb|AC147342.3| Pan troglodytes BAC clone CH251-13D13 from Y, complete sequence
          Length = 146106

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 21     ctaataatgactcttgcac 39
              |||||||||||||||||||
Sbjct: 144878 ctaataatgactcttgcac 144860
to top
>gb|AC147684.4| Pan troglodytes BAC clone CH251-497P9 from Y, complete sequence
          Length = 230902

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 21    ctaataatgactcttgcac 39
             |||||||||||||||||||
Sbjct: 96203 ctaataatgactcttgcac 96185
to top
>gb|AC147665.3| Pan troglodytes BAC clone CH251-134K23 from Y, complete sequence
          Length = 190790

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 21    ctaataatgactcttgcac 39
             |||||||||||||||||||
Sbjct: 49338 ctaataatgactcttgcac 49320
to top
>gb|AC147686.2| Pan troglodytes BAC clone CH251-285E7 from Y, complete sequence
          Length = 176158

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 21     ctaataatgactcttgcac 39
              |||||||||||||||||||
Sbjct: 143436 ctaataatgactcttgcac 143418
to top
>gb|AC147657.2| Pan troglodytes BAC clone CH251-433L14 from Y, complete sequence
          Length = 173252

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 21    ctaataatgactcttgcac 39
             |||||||||||||||||||
Sbjct: 65835 ctaataatgactcttgcac 65817
to top
>gb|AC147654.3| Pan troglodytes BAC clone CH251-511H17 from Y, complete sequence
          Length = 241654

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 21     ctaataatgactcttgcac 39
              |||||||||||||||||||
Sbjct: 106279 ctaataatgactcttgcac 106261
to top
>gb|AC147682.3| Pan troglodytes BAC clone CH251-563H18 from Y, complete sequence
          Length = 196240

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 21     ctaataatgactcttgcac 39
              |||||||||||||||||||
Sbjct: 157407 ctaataatgactcttgcac 157389
to top
>gb|AC107846.4| Mus musculus chromosome 1, clone RP23-309I23, complete sequence
          Length = 178870

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 2     aaagcacatattatatgtg 20
             |||||||||||||||||||
Sbjct: 89120 aaagcacatattatatgtg 89102
to top
>gb|AC160398.8| Mus musculus 6 BAC RP23-162K3 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 215426

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 25     taatgactcttgcacaaaa 43
              |||||||||||||||||||
Sbjct: 111425 taatgactcttgcacaaaa 111407
to top
>gb|AC101902.9| Mus musculus chromosome 1, clone RP24-147M23, complete sequence
          Length = 223784

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 38    acaaaactattacaacaacaata 60
             |||||||||| ||||||||||||
Sbjct: 69508 acaaaactataacaacaacaata 69530
to top
>gb|AC117686.10| Mus musculus chromosome 16, clone RP23-440B15, complete sequence
          Length = 210851

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 38     acaaaactattacaacaacaata 60
              |||||||||| ||||||||||||
Sbjct: 157386 acaaaactataacaacaacaata 157408
to top
>ref|XM_817736.1| Trypanosoma brucei TREU927 hypothetical protein (Tb10.70.1090)
            partial mRNA
          Length = 14232

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 78   tcaaacaaacagattgagc 96
            |||||||||||||||||||
Sbjct: 5467 tcaaacaaacagattgagc 5449
to top
>ref|XM_718648.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY00365)
            partial mRNA
          Length = 3108

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 9    atattatatgtgctaataa 27
            |||||||||||||||||||
Sbjct: 3001 atattatatgtgctaataa 2983
to top
>ref|XM_732843.1| Plasmodium chabaudi chabaudi hypothetical protein (PC300026.00.0)
          partial mRNA
          Length = 192

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 9  atattatatgtgctaataa 27
          |||||||||||||||||||
Sbjct: 85 atattatatgtgctaataa 67
to top
>gb|AC144378.2| Pan troglodytes BAC clone RP43-20D17 from Y, complete sequence
          Length = 194240

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 21     ctaataatgactcttgcac 39
              |||||||||||||||||||
Sbjct: 138690 ctaataatgactcttgcac 138708
to top
>gb|AC142313.1| Pan troglodytes BAC clone RP43-48C7 from Y, complete sequence
          Length = 191133

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 21    ctaataatgactcttgcac 39
             |||||||||||||||||||
Sbjct: 56311 ctaataatgactcttgcac 56293
to top
>emb|BX629346.17| Zebrafish DNA sequence from clone DKEY-16N21 in linkage group 6,
             complete sequence
          Length = 214213

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 40    aaaactattacaacaacaa 58
             |||||||||||||||||||
Sbjct: 28194 aaaactattacaacaacaa 28212
to top
>gb|AC159017.2| Pan troglodytes BAC clone CH251-571G18 from chromosome y, complete
              sequence
          Length = 196802

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 21     ctaataatgactcttgcac 39
              |||||||||||||||||||
Sbjct: 188583 ctaataatgactcttgcac 188565
to top
>emb|AL606754.6| Human DNA sequence from clone RP11-479E16 on chromosome X Contains the
             3' end of the gene for a novel protein (FLJ31204),
             complete sequence
          Length = 106636

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 1     taaagcacatattatatgt 19
             |||||||||||||||||||
Sbjct: 54289 taaagcacatattatatgt 54307
to top
>emb|AL590432.9| Human DNA sequence from clone RP11-141A19 on chromosome 1 Contains the
             3' end of a novel gene and a novel gene, complete sequence
          Length = 95760

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 6     cacatattatatgtgctaa 24
             |||||||||||||||||||
Sbjct: 16069 cacatattatatgtgctaa 16087
to top
>emb|AL445605.7| Human DNA sequence from clone RP11-335D7 on chromosome 13, complete
            sequence
          Length = 45291

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 70   taattaaatcaaacaaacagatt 92
            |||||||||||| ||||||||||
Sbjct: 9312 taattaaatcaatcaaacagatt 9334
to top
>emb|AL160036.12| Human DNA sequence from clone RP11-555C15 on chromosome 13 Contains
             part of the GPC6 gene for glypican 6, complete sequence
          Length = 173526

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 30    actcttgcacaaaactattacaa 52
             |||||| ||||||||||||||||
Sbjct: 51697 actcttacacaaaactattacaa 51675
to top
>gb|AC007671.7| Homo sapiens Human 12 BAC RP11-49G2 (Roswell Park Cancer Institute
             Human BAC Library) complete sequence
          Length = 156314

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 39    caaaactattacaacaaca 57
             |||||||||||||||||||
Sbjct: 91668 caaaactattacaacaaca 91650
to top
>gb|AC087560.26| Mus musculus strain C57BL/6J clone rp23-448g13 map X, complete sequence
          Length = 203953

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 73    ttaaatcaaacaaacagat 91
             |||||||||||||||||||
Sbjct: 59185 ttaaatcaaacaaacagat 59167
to top
>dbj|BS000673.1| Pan troglodytes chromosome Y clone:PTB-403A06, complete sequence
          Length = 132888

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 21    ctaataatgactcttgcac 39
             |||||||||||||||||||
Sbjct: 62929 ctaataatgactcttgcac 62947
to top
>dbj|BS000602.1| Pan troglodytes chromosome Y clone:PTB-547B05, complete sequences
          Length = 211728

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 21     ctaataatgactcttgcac 39
              |||||||||||||||||||
Sbjct: 137813 ctaataatgactcttgcac 137831
to top
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 21       ctaataatgactcttgcac 39
                |||||||||||||||||||
Sbjct: 14270968 ctaataatgactcttgcac 14270986



 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 21       ctaataatgactcttgcac 39
                |||||||||||||||||||
Sbjct: 13446709 ctaataatgactcttgcac 13446727



 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 21      ctaataatgactcttgcac 39
               |||||||||||||||||||
Sbjct: 9749127 ctaataatgactcttgcac 9749109



 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 21      ctaataatgactcttgcac 39
               |||||||||||||||||||
Sbjct: 9046635 ctaataatgactcttgcac 9046653



 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 21      ctaataatgactcttgcac 39
               |||||||||||||||||||
Sbjct: 8280580 ctaataatgactcttgcac 8280562



 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 21      ctaataatgactcttgcac 39
               |||||||||||||||||||
Sbjct: 4485477 ctaataatgactcttgcac 4485495



 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 21     ctaataatgactcttgcac 39
              |||||||||||||||||||
Sbjct: 829721 ctaataatgactcttgcac 829739
to top
>gb|AC093430.3| Homo sapiens chromosome 1 clone RP11-171B15, complete sequence
          Length = 153414

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 70    taattaaatcaaacaaaca 88
             |||||||||||||||||||
Sbjct: 96591 taattaaatcaaacaaaca 96573
to top
>gb|AC097535.3| Homo sapiens BAC clone RP11-802H3 from 4, complete sequence
          Length = 72759

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 71    aattaaatcaaacaaacag 89
             |||||||||||||||||||
Sbjct: 66018 aattaaatcaaacaaacag 66036
to top
>emb|AL929509.15| Zebrafish DNA sequence from clone CH211-165I22 in linkage group 1,
              complete sequence
          Length = 139628

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 74     taaatcaaacaaacagatt 92
              |||||||||||||||||||
Sbjct: 108273 taaatcaaacaaacagatt 108255
to top
>gb|AC147670.4| Pan troglodytes BAC clone CH251-94F1 from chromosome y, complete sequence
          Length = 172123

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 21     ctaataatgactcttgcac 39
              |||||||||||||||||||
Sbjct: 106412 ctaataatgactcttgcac 106430
to top
>gb|AC151848.4| Pan troglodytes BAC clone CH251-346F2 from chromosome y, complete
             sequence
          Length = 147582

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 21    ctaataatgactcttgcac 39
             |||||||||||||||||||
Sbjct: 38848 ctaataatgactcttgcac 38866
to top
>gb|AC150006.3| Pan troglodytes BAC clone CH251-416C12 from chromosome y, complete
             sequence
          Length = 178982

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 21    ctaataatgactcttgcac 39
             |||||||||||||||||||
Sbjct: 98163 ctaataatgactcttgcac 98181
to top
>gb|AC048338.29| Homo sapiens 12 BAC RP11-512M8 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 186945

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 26   aatgactcttgcacaaaac 44
            |||||||||||||||||||
Sbjct: 4320 aatgactcttgcacaaaac 4302
to top
>gb|AC147571.5| Pan troglodytes BAC clone CH251-422I9 from chromosome y, complete
              sequence
          Length = 169828

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 21     ctaataatgactcttgcac 39
              |||||||||||||||||||
Sbjct: 106188 ctaataatgactcttgcac 106170
to top
>gb|AC146011.4| Pan troglodytes BAC clone RP43-42M15 from chromosome y, complete sequence
          Length = 204487

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 21     ctaataatgactcttgcac 39
              |||||||||||||||||||
Sbjct: 197529 ctaataatgactcttgcac 197547
to top
>gb|AC027663.14|AC027663 Homo sapiens chromosome 1 clone RP11-285I23, complete sequence
          Length = 170969

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 6      cacatattatatgtgctaa 24
              |||||||||||||||||||
Sbjct: 114632 cacatattatatgtgctaa 114650
to top
>gb|AC005191.1|AC005191 Homo sapiens PAC clone RP1-269O5 from Xq23, complete sequence
          Length = 185893

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 73    ttaaatcaaacaaacagat 91
             |||||||||||||||||||
Sbjct: 63846 ttaaatcaaacaaacagat 63864
to top
>gb|U47655.1|LLU47655 Leuconostoc lactis plasmid pNZ63 lactose transport protein (lacS)
            gene, partial cds
          Length = 4290

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 92   tgagctcccaaaccaaacg 110
            |||||||||||||||||||
Sbjct: 3749 tgagctcccaaaccaaacg 3767
to top
>emb|AL671920.9| Mouse DNA sequence from clone RP23-445A22 on chromosome X, complete
             sequence
          Length = 166399

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 73    ttaaatcaaacaaacagat 91
             |||||||||||||||||||
Sbjct: 10460 ttaaatcaaacaaacagat 10442


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,453,207
Number of Sequences: 3902068
Number of extensions: 1453207
Number of successful extensions: 108386
Number of sequences better than 10.0: 52
Number of HSP's better than 10.0 without gapping: 54
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 108205
Number of HSP's gapped (non-prelim): 181
length of query: 116
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 95
effective length of database: 17,151,101,840
effective search space: 1629354674800
effective search space used: 1629354674800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top