>gb|AY957499.1| Bos taurus glutamate-cysteine ligase catalytic subunit (GCLC), MHC
class II antigen (DSB), MHC class II antigen (DYA), MHC
class II antigen (DYB), MHC class II antigen (DOB),
transporter 2 ATP-binding cassette sub-family B (TAP2),
proteasome subunit beta type 8 (PSMB8), transporter 1
ATP-binding cassette sub-family B (TAP1), proteosome
subunit beta type 9 (PSMB9), histone H2B-like (H2B), MHC
class II antigen (DMB), MHC class II antigen (DMA),
bromodomain containing 2 (BRD2), MHC class II antigen
(DOA), collagen type XI alpha 2 (COL11A2), retinoid X
receptor beta (RXRB), solute carrier family 39 zinc
transporter member 7 (HKE4), and hydroxysteroid (17-beta)
dehydrogenase 8 (HKE6) genes, complete cds; and ring
finger protein 1 (RING1) gene, partial cds
Length = 447010
Score = 40.1 bits (20), Expect = 1.8
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 97 ataacataaataaacctcaa 116
||||||||||||||||||||
Sbjct: 12170 ataacataaataaacctcaa 12189
>emb|AL161450.14| Human DNA sequence from clone RP11-39K24 on chromosome 9 Contains the 3'
end of the JAK2 gene for Janus kinase 2 (a protein tyrosine
kinase), a casein kinase pseudogene, a
trans-prenyltransferase (TPT) pseudogene, a NADH
dehydrogenase 6 (MTND6) pseuodgene, a NADH dehydrogenase 1
(MTND1) pseudogene, a cytochrome c oxidase I (MTCO1)
pseudogene, a cytochrome c oxidase II (MTCO2) pseudogene,
an ATP synthase 6 (MTATP6) pseudogene, a cytochrome c
oxidase III (MTCO3) pseudogene, a NADH dehydrogenase 4
(MTND4)pseudogene, a pseudogene similar to part of NADH
dehydrogenase 5 (MTND5), a transcription factor 3 (E2A
immunoglobulin enhancer binding factors E12/E47) (TCF3)
pseudogene, an immunoglobulin heavy constant epsilon
pseudogene 2 (IGHEP2), a novel gene, the INSL6 gene for
insulin-like 6 (RIF1) and 4 CpG islands, complete sequence
Length = 171146
Score = 38.2 bits (19), Expect = 7.0
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 12 taacattccttcattttga 30
|||||||||||||||||||
Sbjct: 150103 taacattccttcattttga 150085
>dbj|AP005436.1| Homo sapiens genomic DNA, chromosome 11 clone:RP11-164N3, complete
sequence
Length = 147520
Score = 38.2 bits (19), Expect = 7.0
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 17 ttccttcattttgagatca 35
|||||||||||||||||||
Sbjct: 141287 ttccttcattttgagatca 141269
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,540,797
Number of Sequences: 3902068
Number of extensions: 1540797
Number of successful extensions: 108192
Number of sequences better than 10.0: 37
Number of HSP's better than 10.0 without gapping: 37
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 108045
Number of HSP's gapped (non-prelim): 147
length of query: 147
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 126
effective length of database: 17,151,101,840
effective search space: 2161038831840
effective search space used: 2161038831840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)