>gb|AC154377.4| Mus musculus BAC clone RP23-63F23 from chromosome 14, complete sequence
          Length = 193561

 Score = 38.2 bits (19), Expect = 2.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 5     ataactgggttcattgacc 23
             |||||||||||||||||||
Sbjct: 41993 ataactgggttcattgacc 42011

>gb|AC116505.13| Mus musculus chromosome 5, clone RP24-302O2, complete sequence
          Length = 178695

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 1      gaaaataactgggttcat 18
              ||||||||||||||||||
Sbjct: 112874 gaaaataactgggttcat 112891

>gb|AY484589.1| Musa acuminata clone MuH9, genomic sequence
          Length = 82723

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 29    aagggattacagccaact 46
             ||||||||||||||||||
Sbjct: 59453 aagggattacagccaact 59470

>emb|Z70312.1|CEZC168 Caenorhabditis elegans Cosmid ZC168, complete sequence
          Length = 26307

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 2     aaaataactgggttcatt 19
             ||||||||||||||||||
Sbjct: 25212 aaaataactgggttcatt 25195

>emb|AL451049.11| Human DNA sequence from clone RP11-63A2 on chromosome 10 Contains a novel
              gene and a CpG island, complete sequence
          Length = 166973

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 2      aaaataactgggttcatt 19
              ||||||||||||||||||
Sbjct: 139104 aaaataactgggttcatt 139087

>emb|AL353621.19| Human DNA sequence from clone RP11-490D19 on chromosome 9 Contains a
              novel pseudogene, the MRPL50 gene for mitochondrial
              ribosomal protein L50, the ZNF189 gene for zinc finger
              protein 189, the ALDOB gene for aldolase B,
              fructose-bisphosphate, a NADH dehydrogenase (ubiquinone) 1
              alpha subcomplex (NDUFA4) pseudogene, three novel genes,
              the 5' end of the RNF20 gene for ring finger protein 20 and
              three CpG islands, complete sequence
          Length = 164115

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 32     ggattacagccaactgaa 49
              ||||||||||||||||||
Sbjct: 125391 ggattacagccaactgaa 125374

>gb|AC163292.2| Mus musculus BAC clone RP23-241P22 from chromosome 13, complete sequence
          Length = 208105

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 4      aataactgggttcattga 21
              ||||||||||||||||||
Sbjct: 104861 aataactgggttcattga 104844

>gb|AC022398.7| Homo sapiens chromosome 10 clone RP11-491H19, complete sequence
          Length = 169184

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 2      aaaataactgggttcatt 19
              ||||||||||||||||||
Sbjct: 129031 aaaataactgggttcatt 129048

>gb|AC160980.5| Mus musculus BAC clone RP23-386F19 from chromosome 13, complete
             sequence
          Length = 184857

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 4     aataactgggttcattga 21
             ||||||||||||||||||
Sbjct: 31667 aataactgggttcattga 31684

>gb|AC152070.4| Pan troglodytes BAC clone RP43-135N21 from chromosome 7, complete
             sequence
          Length = 162075

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 2     aaaataactgggttcatt 19
             ||||||||||||||||||
Sbjct: 34522 aaaataactgggttcatt 34505

>gb|AC145619.4| Homo sapiens BAC clone RP11-722J20 from chromosome 2, complete sequence
          Length = 152973

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 26     aacaagggattacagcca 43
              ||||||||||||||||||
Sbjct: 145244 aacaagggattacagcca 145227

>gb|AC090983.13| Homo sapiens chromosome 15, clone RP11-385H1, complete sequence
          Length = 203244

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 15     tcattgaccccaacaagg 32
              ||||||||||||||||||
Sbjct: 136285 tcattgaccccaacaagg 136268

>gb|AY954970.1| Staphylococcus phage Twort, complete genome
          Length = 130706

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                       
Query: 2     aaaataactgggttcattgaccccaa 27
             |||||||  |||||||||||||||||
Sbjct: 21581 aaaataaaagggttcattgaccccaa 21606

>gb|AC007448.14| Homo sapiens chromosome 17, clone RP11-401F2, complete sequence
          Length = 195558

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 34     attacagccaactgaaca 51
              ||||||||||||||||||
Sbjct: 160023 attacagccaactgaaca 160006

>gb|AC142232.2| Homo sapiens fosmid clone XXFOS-83793A7 from 2, complete sequence
          Length = 38599

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 26    aacaagggattacagcca 43
             ||||||||||||||||||
Sbjct: 32470 aacaagggattacagcca 32453

>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome
          Length = 6413771

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 28      caagggattacagccaac 45
               ||||||||||||||||||
Sbjct: 3805545 caagggattacagccaac 3805528


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 403,059
Number of Sequences: 3902068
Number of extensions: 403059
Number of successful extensions: 30847
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 30812
Number of HSP's gapped (non-prelim): 35
length of query: 60
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 39
effective length of database: 17,151,101,840
effective search space: 668892971760
effective search space used: 668892971760
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)