ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart15f06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC175059.2| Pan troglodytes BAC clone CH251-777D16 from chrom... 48 0.006
2gb|AC115119.5| Mus musculus BAC clone RP23-87M19 from 18, comple... 44 0.087
3emb|AL360272.23| Human DNA sequence from clone RP11-169I2 on chr... 44 0.087
4emb|AL133420.28| Human DNA sequence from clone RP5-904D7 on chro... 44 0.087
5gb|AC068991.28| Homo sapiens 12 BAC RP11-300D9 (Roswell Park Can... 44 0.087
6gb|AC091639.5| Homo sapiens chromosome 8, clone RP11-61K18, comp... 44 0.087
7gb|AC025828.3|AC025828 Homo sapiens, clone RP11-13I24, complete ... 44 0.087
8gb|AC007065.5|AC007065 Homo sapiens, clone hRPK.58_A_1, complete... 44 0.087
9dbj|AP005361.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 44 0.087
10gb|AC101748.7| Mus musculus chromosome 5, clone RP24-133H21, com... 42 0.34
11gb|AC021105.13| Homo sapiens BAC clone RP11-163O17 from 4, compl... 42 0.34
12gb|AC158399.2| Mus musculus BAC clone RP23-246A2 from chromosome... 42 0.34
13emb|AJ277858.1|MTR277858 Medicago truncatula nod25 gene for nodu... 42 0.34
14gb|AC126020.4| Mus musculus BAC clone RP24-364O7 from 8, complet... 42 0.34
15gb|AC123689.8| Mus musculus chromosome 15, clone RP23-321P10, co... 42 0.34
16gb|AC157602.8| Mus musculus chromosome 15 clone RP23-104H10, com... 42 0.34
17emb|AL845290.7| Mouse DNA sequence from clone RP23-201A19 on chr... 42 0.34
18emb|AL840623.10| Mouse DNA sequence from clone RP23-289L17 on ch... 42 0.34
19gb|AC099621.12| Mus musculus chromosome 15, clone RP23-468J2, co... 40 1.4
20emb|CT009713.8| Mouse DNA sequence from clone RP23-151C6 on chro... 40 1.4
21gb|AC116656.5| Mus musculus BAC clone RP23-10A7 from chromosome ... 40 1.4
22gb|AC121974.3| Mus musculus BAC clone RP24-285E14 from chromosom... 40 1.4
23gb|AC117598.7| Mus musculus chromosome 1, clone RP23-398H16, com... 40 1.4
24gb|AC146308.2| Medicago truncatula clone mth2-10a12, complete se... 40 1.4
25gb|AC137554.15| Medicago truncatula clone mth2-17j18, complete s... 40 1.4
26emb|AL606759.8| Human DNA sequence from clone CTD-2319N17 on chr... 40 1.4
27emb|AL356739.11| Human DNA sequence from clone RP11-324P13 on ch... 40 1.4
28gb|AC111653.8| Rattus norvegicus 2 BAC CH230-108E11 (Children's ... 40 1.4
29emb|AL022148.1|HS435A7 Human DNA sequence from clone RP3-435A7 o... 40 1.4
30emb|AL929355.1|PFA929355 Plasmodium falciparum strain 3D7, chrom... 40 1.4
31gb|AC163900.3| Mus musculus BAC clone RP23-151K15 from chromosom... 40 1.4
32gb|AC107383.3| Homo sapiens BAC clone RP11-125C20 from 4, comple... 40 1.4
33gb|AC172372.2| Pan troglodytes BAC clone CH251-1067L6 from chrom... 40 1.4
34gb|AC092609.2| Homo sapiens BAC clone RP11-160A16 from 4, comple... 40 1.4
35gb|AC154582.2| Mus musculus BAC clone RP23-381N7 from chromosome... 40 1.4
36gb|AC172373.3| Pan troglodytes BAC clone CH251-1081D19 from chro... 40 1.4
37gb|AY957562.1| Bombina orientalis mitochondrion, complete genome 40 1.4
38gb|AC125041.2| Mus musculus BAC clone RP23-337J19 from chromosom... 40 1.4
39gb|AC122918.4| Mus musculus chromosome 6 clone RP23-29F15, compl... 40 1.4
40gb|AC004672.1|AC004672 Homo sapiens 12p13.3-0-2.7 BAC RP5-951N9 ... 40 1.4
41emb|BX664611.6| Mouse DNA sequence from clone RP24-201C13 on chr... 40 1.4
42gb|AC115020.11| Mus musculus chromosome 1, clone RP24-231D14, co... 40 1.4
43gb|AC101703.11| Mus musculus chromosome 1, clone RP23-248B15, co... 40 1.4
44gb|AC174597.2| Mus musculus BAC clone RP24-418F6 from chromosome... 40 1.4
45gb|AY823304.1| Norovirus swine/GII/OH-QW101/03/US RNA-dependent ... 40 1.4
46gb|AC102303.10| Mus musculus chromosome 1, clone RP24-403I11, co... 38 5.4
47gb|AC159998.6| Mus musculus BAC clone RP24-576J22 from chromosom... 38 5.4
48gb|AC102749.10| Mus musculus chromosome 5, clone RP24-478I4, com... 38 5.4
49gb|AC160389.4| Mus musculus chromosome 7, clone RP23-257G13, com... 38 5.4
50gb|AC168117.2| Mus musculus BAC clone RP23-461G13 from chromosom... 38 5.4
51gb|AC166932.6| Mus musculus chromosome 7, clone RP23-349I13, com... 38 5.4
52gb|AC113065.16| Mus musculus chromosome 7, clone RP23-263E7, com... 38 5.4
53gb|AC116370.17| Mus musculus chromosome 3, clone RP24-113D8, com... 38 5.4
54gb|AC167171.2| Mus musculus BAC clone RP23-409H8 from chromosome... 38 5.4
55gb|AC151601.5| Mus musculus BAC clone RP23-241H10 from chromosom... 38 5.4
56gb|AC006815.2| Caenorhabditis elegans cosmid Y6D11A, complete se... 38 5.4
57gb|AC146440.5| Pan troglodytes BAC clone RP43-11P11 from 7, comp... 38 5.4
58gb|AC148991.2| Mus musculus BAC clone RP23-52N2 from chromosome ... 38 5.4
59gb|AC149486.1| Populus trichocarpa clone Pop1-8L22, complete seq... 38 5.4
60gb|AC149575.1| Populus trichocarpa clone Pop1-41G18, complete se... 38 5.4
61gb|AC126443.3| Mus musculus BAC clone RP23-464J8 from chromosome... 38 5.4
62gb|AC139328.4| Mus musculus BAC clone RP24-299C21 from chromosom... 38 5.4
63gb|AC125395.3| Mus musculus BAC clone RP23-213J1 from chromosome... 38 5.4
64gb|AC123075.5| Mus musculus BAC clone RP23-181C16 from chromosom... 38 5.4
65gb|DQ491003.1| Chlorella virus AR158 ctg_1047243734156 genomic s... 38 5.4
66gb|DQ491002.1| Paramecium bursaria Chlorella virus NY2A Chlorell... 38 5.4
67gb|AC138667.8| Mus musculus chromosome 14, clone RP24-122H16, co... 38 5.4
68gb|AC114593.12| Mus musculus chromosome 14, clone RP23-44B17, co... 38 5.4
69gb|AC102008.9| Mus musculus chromosome 7, clone RP24-502L8, comp... 38 5.4
70gb|AC123719.10| Mus musculus chromosome 13, clone RP23-412A14, c... 38 5.4
71gb|AC102734.11| Mus musculus chromosome 6, clone RP24-222N4, com... 38 5.4
72gb|AC113098.12| Mus musculus chromosome 8, clone RP23-314K9, com... 38 5.4
73gb|AC134439.4| Mus musculus BAC clone RP24-494I18 from chromosom... 38 5.4
74gb|AC116460.10| Mus musculus chromosome 10, clone RP23-244G12, c... 38 5.4
75gb|AC146615.2| Mus musculus BAC clone RP23-19K2 from chromosome ... 38 5.4
76emb|CR376775.7| Zebrafish DNA sequence from clone CH211-197C5 in... 38 5.4
77emb|CR936261.8| Zebrafish DNA sequence from clone DKEY-207A6 in ... 38 5.4
78gb|AC117702.10| Mus musculus chromosome 10, clone RP23-464I2, co... 38 5.4
79gb|AC131700.3| Mus musculus BAC clone RP24-67N3 from chromosome ... 38 5.4
80gb|AC125373.4| Mus musculus BAC clone RP23-379A13 from chromosom... 38 5.4
81gb|AC115805.12| Mus musculus chromosome 10, clone RP23-412P24, c... 38 5.4
82gb|AC122480.3| Mus musculus BAC clone RP24-355B22 from chromosom... 38 5.4
83gb|AC124489.2| Mus musculus BAC clone RP23-453H5 from chromosome... 38 5.4
84gb|AC121611.3| Mus musculus BAC clone RP23-330I2 from chromosome... 38 5.4
85gb|AC122925.3| Mus musculus BAC clone RP23-9O19 from 1, complete... 38 5.4
86gb|AC122830.4| Mus musculus BAC clone RP23-224I23 from 8, comple... 38 5.4
87gb|AC122320.4| Mus musculus BAC clone RP23-315F17 from 14, compl... 38 5.4
88gb|AC115825.11| Mus musculus chromosome 9, clone RP23-444E13, co... 38 5.4
89gb|AC117185.2| Mus musculus BAC clone RP23-37M7 from 8, complete... 38 5.4
90gb|AC122884.2| Mus musculus BAC clone RP23-88O13 from 5, complet... 38 5.4
91gb|AC111007.4| Mus musculus BAC clone RP23-226I10 from 3, comple... 38 5.4
92gb|AC073133.9| Homo sapiens BAC clone RP11-691F21 from 7, comple... 38 5.4
93ref|XM_730932.1| Plasmodium chabaudi chabaudi hypothetical prote... 38 5.4
94ref|XM_671076.1| Plasmodium berghei strain ANKA hypothetical pro... 38 5.4
95gb|AC113204.7| Mus musculus chromosome 12, clone RP23-312J1, com... 38 5.4
96gb|AC103939.8| Mus musculus chromosome 18, clone RP23-300E7, com... 38 5.4
97gb|AC109253.9| Mus musculus, clone RP23-351D8, complete sequence 38 5.4
98gb|BT025041.1| Drosophila melanogaster LD15160 full insert cDNA 38 5.4
99emb|AL627107.32| Human DNA sequence from clone XXyac-R12DG2 on c... 38 5.4
100gb|BC112569.1| Bos taurus hypothetical protein LOC523894, mRNA (... 38 5.4
101emb|AL592044.4| Human DNA sequence from clone RP13-407F1 on chro... 38 5.4
102emb|AL590009.10| Human DNA sequence from clone RP11-181P4 on chr... 38 5.4
103emb|AL450311.11| Human DNA sequence from clone RP11-343J3 on chr... 38 5.4
104emb|AL391001.12| Human DNA sequence from clone RP11-477H21 on ch... 38 5.4
105gb|AE014818.1| Plasmodium falciparum 3D7 chromosome 14 section 3... 38 5.4
106emb|AL356579.24| Human DNA sequence from clone RP11-593A16 on ch... 38 5.4
107gb|AC098690.3| Homo sapiens chromosome 1 clone RP11-507I14, comp... 38 5.4
108emb|AL353143.14| Human DNA sequence from clone RP11-383F12 on ch... 38 5.4
109emb|AL158826.23| Human DNA sequence from clone RP11-244N20 on ch... 38 5.4
110emb|AL158167.15| Human DNA sequence from clone RP11-534G20 on ch... 38 5.4
111emb|AL139294.15| Human DNA sequence from clone RP5-1044H5 on chr... 38 5.4
112emb|AL138813.8| Human DNA sequence from clone RP1-305K11 on chro... 38 5.4
113emb|AL135929.5| Human DNA sequence from clone RP4-801G22 on chro... 38 5.4
114gb|AC124784.4| Homo sapiens 12 BAC RP11-461F16 (Roswell Park Can... 38 5.4
115emb|AL049591.12|HSJ878I13 Human DNA sequence from clone RP5-878I... 38 5.4
116emb|AL096803.8|HSBG304P7 Human DNA sequence from clone GS1-304P7... 38 5.4
117gb|AC157917.4| Mus musculus chromosome 3, clone RP23-120L6, comp... 38 5.4
118gb|AC158149.3| Mus musculus chromosome 5, clone RP24-296L6, comp... 38 5.4
119emb|AL021398.1|HS964D12 Human DNA sequence from clone RP5-964D12... 38 5.4
120gb|AC133796.2| Homo sapiens 3 BAC RP11-10I2 (Roswell Park Cancer... 38 5.4
121gb|AC130388.6| Drosophila melanogaster X BAC CH221-14P20 (Childr... 38 5.4
122gb|AC023714.5| Drosophila melanogaster X BAC RP98-19D19 (Roswell... 38 5.4
123gb|AC074336.14| Mus musculus Strain C57BL6/J chromosome 1 BAC, R... 38 5.4
124emb|AL031745.8|PFMAL1P2 Plasmodium falciparum DNA from MAL1P2 38 5.4
125gb|AC156575.3| Mus musculus BAC clone RP23-4P20 from chromosome ... 38 5.4
126gb|AC160756.7| Mus musculus chromosome 15, clone RP23-158H4, com... 38 5.4
127emb|AL669833.7| Mouse DNA sequence from clone RP23-51C16 on chro... 38 5.4
128emb|AL929002.4| Mouse DNA sequence from clone RP23-369A3 on chro... 38 5.4
129emb|AL672260.25| Mouse DNA sequence from clone DN-127L1 on chrom... 38 5.4
130gb|AC087301.8| Homo sapiens chromosome 17, clone RP11-661C3, com... 38 5.4
131gb|AC160536.4| Mus musculus chromosome 8, clone RP24-92K22, comp... 38 5.4
132gb|AC116529.16| Mus musculus chromosome 8, clone RP24-380O18, co... 38 5.4
133emb|AL683883.26| Mouse DNA sequence from clone RP23-361B8 on chr... 38 5.4
134gb|AC156991.9| Mus musculus chromosome 8, clone RP23-297F23, com... 38 5.4
135dbj|AK022093.1| Homo sapiens cDNA FLJ12031 fis, clone HEMBB1001874 38 5.4
136emb|AL929036.8| Mouse DNA sequence from clone RP24-548P4 on chro... 38 5.4
137ref|NM_206620.3| Drosophila melanogaster Tousled-like kinase CG3... 38 5.4
138gb|AF434765.1| Mus musculus fatty acid translocase (Cd36) gene, ... 38 5.4
139gb|AC090179.4| Homo sapiens chromosome 15, clone RP11-236J21, co... 38 5.4
140dbj|AK138435.1| Mus musculus adult male hypothalamus cDNA, RIKEN... 38 5.4
141gb|AC157786.7| Mus musculus chromosome 1, clone RP23-280O23, com... 38 5.4
142gb|AC093808.2| Homo sapiens BAC clone RP11-342A1 from 4, complet... 38 5.4
143gb|AC090751.9| Homo sapiens chromosome 15, clone RP11-331H13, co... 38 5.4
144gb|AC093154.2| Homo sapiens chromosome 1 clone RP3-445O10, compl... 38 5.4
145gb|AC034154.6| Homo sapiens BAC clone RP11-242D9 from 4, complet... 38 5.4
146gb|AC166644.7| Mus musculus chromosome 1, clone RP23-375C6, comp... 38 5.4
147gb|AC099015.1| Drosophila melanogaster, chromosome 2R, region 48... 38 5.4
148ref|NM_001031761.2| Bos taurus hypothetical protein LOC523894 (L... 38 5.4
149gb|AC161601.4| Mus musculus BAC clone RP23-333L19 from chromosom... 38 5.4
150gb|AC154028.7| Mus musculus 10 BAC RP23-246J13 (Roswell Park Can... 38 5.4
151emb|BX296537.10| Zebrafish DNA sequence from clone CH211-249G3 i... 38 5.4
152gb|AC130669.17| Mus musculus chromosome 15, clone RP24-84O5, com... 38 5.4
153gb|AC026691.5| Homo sapiens chromosome 5 clone CTC-203F4, comple... 38 5.4
154gb|AC153650.4| Mus musculus BAC clone RP24-93I18 from chromosome... 38 5.4
155gb|AC157557.5| Mus musculus chromosome 7, clone RP24-369M22, com... 38 5.4
156gb|AC023118.4|AC023118 Homo sapiens BAC clone RP11-277L22 from 1... 38 5.4
157gb|AC153527.9| Mus musculus 10 BAC RP23-320A6 (Roswell Park Canc... 38 5.4
158emb|BX247877.13| Zebrafish DNA sequence from clone DKEY-16J24, c... 38 5.4
159dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 38 5.4
160gb|AC097465.2| Homo sapiens BAC clone RP11-24I21 from 4, complet... 38 5.4
161gb|AC096735.3| Homo sapiens BAC clone RP11-135M12 from 4, comple... 38 5.4
162gb|AC154124.5| Mus musculus chromosome 5, clone RP24-63G13, comp... 38 5.4
163gb|AC010738.5| Homo sapiens BAC clone RP11-443I9 from 2, complet... 38 5.4
164dbj|AP003237.2| Oryza sativa (japonica cultivar-group) genomic D... 38 5.4
165gb|AC068718.6| Homo sapiens BAC clone RP11-123G24 from 2, comple... 38 5.4
166gb|AC138185.2| Homo sapiens chromosome 8, clone RP11-640O8, comp... 38 5.4
167gb|AC012066.10| Homo sapiens BAC clone RP11-173H9 from 2, comple... 38 5.4
168gb|AC069418.15| Homo sapiens 3 BAC RP11-464F3 (Roswell Park Canc... 38 5.4
169gb|AC117539.6| Papio hamadryas, clone RP41-208E11, complete sequ... 38 5.4
170gb|AC006343.3| Homo sapiens PAC clone RP4-548K24 from 7q34-q36, ... 38 5.4
171gb|AC061965.16| Homo sapiens chromosome 15, clone RP11-37J13, co... 38 5.4
172gb|AC125035.3| Mus musculus chromosome UL clone RP23-328F24, com... 38 5.4
173gb|AC009358.6|AC009358 Human Chromosome 7 clone RP11-191E5, comp... 38 5.4
174gb|AC124804.10| Homo sapiens chromosome 17, clone RP11-449L23, c... 38 5.4
175gb|AC009178.4|AC009178 Homo sapiens clone RP11-169C22 from 7q31,... 38 5.4
176gb|AC152169.2| Mus musculus BAC clone RP23-79L13 from chromosome... 38 5.4
177gb|AF172082.1|AF172082 Homo sapiens HPC1 locus clone 173P17 geno... 38 5.4
178emb|AL928988.14| Mouse DNA sequence from clone RP23-402M7 on chr... 38 5.4
179emb|AL713898.9| Mouse DNA sequence from clone RP23-253D13 on chr... 38 5.4
180emb|AL672186.7| Mouse DNA sequence from clone RP23-42G2 on chrom... 38 5.4
181gb|AF001548.1|HUAF001548 Human Chromosome 16 BAC clone CIT987SK-... 38 5.4
182gb|AC154635.2| Mus musculus BAC clone RP23-299N21 from 13, compl... 38 5.4
183gb|AC154743.2| Mus musculus BAC clone RP24-392N10 from 13, compl... 38 5.4
184gb|AC155244.2| Mus musculus BAC clone RP24-318B2 from 13, comple... 38 5.4
185emb|AL583809.3|CNS07EFY Human chromosome 14 DNA sequence BAC R-7... 38 5.4
186gb|AC154777.2| Mus musculus BAC clone RP24-459H24 from 14, compl... 38 5.4
187gb|AC107666.13| Mus musculus chromosome 5, clone RP23-111M3, com... 38 5.4
188emb|BX936328.7| Zebrafish DNA sequence from clone CH211-11F20 in... 38 5.4
189gb|AC116469.13| Mus musculus chromosome 5, clone RP23-171F16, co... 38 5.4
190gb|AC104892.10| Mus musculus chromosome 18, clone RP23-262H4, co... 38 5.4
191emb|CT025920.8| Zebrafish DNA sequence from clone CH73-64P10 in ... 38 5.4
192gb|BT020677.1| Bos taurus hypothetical protein FLJ38968 (FLJ3896... 38 5.4
193gb|AC113288.7| Mus musculus chromosome 5, clone RP23-414I12, com... 38 5.4
194gb|AE003824.3| Drosophila melanogaster chromosome 2R, section 26... 38 5.4
195emb|AL132709.5|CNS01DTB Human chromosome 14 DNA sequence BAC R-9... 38 5.4
196gb|AE003429.4| Drosophila melanogaster chromosome X, section 13 ... 38 5.4
197gb|AC138245.11| Mus musculus chromosome 17, clone RP23-75D10, co... 38 5.4
198gb|AC111039.13| Mus musculus chromosome 5, clone RP24-463M5, com... 38 5.4
199gb|AC163756.5| Pan troglodytes BAC clone CH251-261N12 from chrom... 38 5.4
200gb|AC101547.9| Mus musculus chromosome 5, clone RP23-193C5, comp... 38 5.4
201gb|AC103404.13| Mus musculus chromosome 5, clone RP23-21O1, comp... 38 5.4
202gb|AC118680.7| Mus musculus chromosome 8, clone RP24-381G7, comp... 38 5.4
203gb|AC114589.30| Mus musculus chromosome 8, clone RP23-365O13, co... 38 5.4
204dbj|AP002797.3| Homo sapiens genomic DNA, chromosome 11q, clone:... 38 5.4
205dbj|AP001885.4| Homo sapiens genomic DNA, chromosome 11 clone:RP... 38 5.4
206gb|AC005465.1|AC005465 Drosophila melanogaster, chromosome 2R, r... 38 5.4
207dbj|AP005856.2| Homo sapiens genomic DNA, chromosome 8q24, clone... 38 5.4
208emb|CT030656.7| Mouse DNA sequence from clone RP23-271O7 on chro... 38 5.4
209gb|AF045643.2| Caenorhabditis elegans cosmid F58H7, complete seq... 38 5.4
210gb|AC159269.3| Mus musculus BAC clone RP23-426N14 from chromosom... 38 5.4
211emb|AL357752.19| Human DNA sequence from clone RP13-26D14 on chr... 38 5.4
212gb|AC147108.3| Mus musculus BAC clone RP24-70D19 from 13, comple... 38 5.4
213gb|AC122444.4| Mus musculus BAC clone RP24-232I9 from 9, complet... 38 5.4
214gb|AC144762.3| Mus musculus BAC clone RP24-95D6 from 3, complete... 38 5.4
215gb|AC132571.2| Mus musculus BAC clone RP24-539E18 from 1, comple... 38 5.4
216emb|CT030664.5| Mouse DNA sequence from clone RP23-357K7 on chro... 38 5.4
217gb|AC132453.3| Mus musculus BAC clone RP23-200J18 from 6, comple... 38 5.4
218gb|AC132137.3| Mus musculus BAC clone RP23-153E2 from 3, complet... 38 5.4
219gb|AC135511.4| Mus musculus BAC clone RP23-255B19 from 3, comple... 38 5.4
220gb|AC134900.5| Mus musculus BAC clone RP23-249B22 from 10, compl... 38 5.4
221emb|CT025552.9| Mouse DNA sequence from clone RP24-270A4 on chro... 38 5.4
222emb|AL844522.7| Zebrafish DNA sequence from clone DKEY-113M9, co... 38 5.4
223emb|AL772324.5| Mouse DNA sequence from clone RP23-440O7 on chro... 38 5.4
224gb|AC148321.7| Mus musculus BAC clone RP24-512H17 from 19, compl... 38 5.4
225gb|AC002106.1|AC002106 Genomic sequence from Human 9q34, complet... 38 5.4
226gb|AC163743.6| Mus musculus BAC clone RP23-415J4 from chromosome... 38 5.4
227gb|AC099643.5| Mus musculus chromosome 7, clone RP24-350G1, comp... 38 5.4
228gb|AC164586.7| Mus musculus chromosome 8, clone RP24-258B3, comp... 38 5.4
229gb|AC163039.6| Mus musculus BAC clone RP23-188J1 from chromosome... 38 5.4
230gb|U35323.1|MMU35323 Mus musculus H2-M alpha chain (H2-Ma) gene,... 38 5.4
231gb|AC171502.2| Mus musculus BAC clone RP23-242G4 from chromosome... 38 5.4
232gb|AC171325.5| Mus musculus chromosome 3, clone RP23-124B15, com... 38 5.4
233gb|AC115008.7| Mus musculus chromosome 3, clone RP24-189F12, com... 38 5.4
234gb|AC162921.3| Mus musculus BAC clone RP23-342H1 from chromosome... 38 5.4
235emb|AL773580.11| Mouse DNA sequence from clone RP23-26G3 on chro... 38 5.4
236emb|AL672271.9| Mouse DNA sequence from clone RP23-450H23 on chr... 38 5.4
237emb|AL645930.15| Mouse DNA sequence from clone RP23-434L7 on chr... 38 5.4
238emb|AL807763.7| Mouse DNA sequence from clone RP23-28B24 on chro... 38 5.4
239emb|AL929066.7| Mouse DNA sequence from clone RP23-68E1 on chrom... 38 5.4
240gb|AC101299.16| Mus musculus chromosome 1, clone RP23-103M17, co... 38 5.4
241emb|AL627432.26| Mouse DNA sequence from clone RP23-45I5 on chro... 38 5.4

>gb|AC175059.2| Pan troglodytes BAC clone CH251-777D16 from chromosome y, complete
            sequence
          Length = 166448

 Score = 48.1 bits (24), Expect = 0.006
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 43   gaggagaaaatcagaaaggaaatt 66
            ||||||||||||||||||||||||
Sbjct: 8919 gaggagaaaatcagaaaggaaatt 8896



to top

>gb|AC115119.5| Mus musculus BAC clone RP23-87M19 from 18, complete sequence
          Length = 174491

 Score = 44.1 bits (22), Expect = 0.087
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 61    gaaattacacatatatgtatat 82
             ||||||||||||||||||||||
Sbjct: 96886 gaaattacacatatatgtatat 96907



to top

>emb|AL360272.23| Human DNA sequence from clone RP11-169I2 on chromosome 6 Contains the
             3' end of the SUPT3H gene for suppressor of Ty 3 homolog
             (S. cerevisiae), complete sequence
          Length = 110382

 Score = 44.1 bits (22), Expect = 0.087
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 46    gagaaaatcagaaaggaaatta 67
             ||||||||||||||||||||||
Sbjct: 14363 gagaaaatcagaaaggaaatta 14384



to top

>emb|AL133420.28| Human DNA sequence from clone RP5-904D7 on chromosome 20 Contains ESTs,
             STSs and GSSs, complete sequence
          Length = 84722

 Score = 44.1 bits (22), Expect = 0.087
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 66    tacacatatatgtatatgctat 87
             ||||||||||||||||||||||
Sbjct: 15368 tacacatatatgtatatgctat 15347



to top

>gb|AC068991.28| Homo sapiens 12 BAC RP11-300D9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 173639

 Score = 44.1 bits (22), Expect = 0.087
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 46    gagaaaatcagaaaggaaatta 67
             ||||||||||||||||||||||
Sbjct: 19697 gagaaaatcagaaaggaaatta 19718



to top

>gb|AC091639.5| Homo sapiens chromosome 8, clone RP11-61K18, complete sequence
          Length = 147480

 Score = 44.1 bits (22), Expect = 0.087
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 63    aattacacatatatgtatatgc 84
             ||||||||||||||||||||||
Sbjct: 47094 aattacacatatatgtatatgc 47115



to top

>gb|AC025828.3|AC025828 Homo sapiens, clone RP11-13I24, complete sequence
          Length = 152843

 Score = 44.1 bits (22), Expect = 0.087
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 63     aattacacatatatgtatatgc 84
              ||||||||||||||||||||||
Sbjct: 149559 aattacacatatatgtatatgc 149538



to top

>gb|AC007065.5|AC007065 Homo sapiens, clone hRPK.58_A_1, complete sequence
          Length = 169325

 Score = 44.1 bits (22), Expect = 0.087
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 46    gagaaaatcagaaaggaaatta 67
             ||||||||||||||||||||||
Sbjct: 15429 gagaaaatcagaaaggaaatta 15450



to top

>dbj|AP005361.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1538E2, complete
             sequence
          Length = 65355

 Score = 44.1 bits (22), Expect = 0.087
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 63    aattacacatatatgtatatgc 84
             ||||||||||||||||||||||
Sbjct: 27123 aattacacatatatgtatatgc 27102



to top

>gb|AC101748.7| Mus musculus chromosome 5, clone RP24-133H21, complete sequence
          Length = 168366

 Score = 42.1 bits (21), Expect = 0.34
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                           
Query: 53     tcagaaaggaaattacacatatatgtata 81
              ||||||||||||| |||||||||||||||
Sbjct: 108582 tcagaaaggaaat-acacatatatgtata 108609



to top

>gb|AC021105.13| Homo sapiens BAC clone RP11-163O17 from 4, complete sequence
          Length = 187360

 Score = 42.1 bits (21), Expect = 0.34
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    aaaggaaattacacatatatg 77
             |||||||||||||||||||||
Sbjct: 26981 aaaggaaattacacatatatg 27001



to top

>gb|AC158399.2| Mus musculus BAC clone RP23-246A2 from chromosome 14, complete sequence
          Length = 198948

 Score = 42.1 bits (21), Expect = 0.34
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 66    tacacatatatgtatatgcta 86
             |||||||||||||||||||||
Sbjct: 52520 tacacatatatgtatatgcta 52500



to top

>emb|AJ277858.1|MTR277858 Medicago truncatula nod25 gene for nodulin 25, exons 1-13
          Length = 10581

 Score = 42.1 bits (21), Expect = 0.34
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 62   aaattacacatatatgtatat 82
            |||||||||||||||||||||
Sbjct: 3963 aaattacacatatatgtatat 3983



to top

>gb|AC126020.4| Mus musculus BAC clone RP24-364O7 from 8, complete sequence
          Length = 179287

 Score = 42.1 bits (21), Expect = 0.34
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 52    atcagaaaggaaattacacatatat 76
             |||||||||||||||| ||||||||
Sbjct: 81322 atcagaaaggaaattaaacatatat 81298



to top

>gb|AC123689.8| Mus musculus chromosome 15, clone RP23-321P10, complete sequence
          Length = 218071

 Score = 42.1 bits (21), Expect = 0.34
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 67     acacatatatgtatatgctat 87
              |||||||||||||||||||||
Sbjct: 166156 acacatatatgtatatgctat 166176



to top

>gb|AC157602.8| Mus musculus chromosome 15 clone RP23-104H10, complete sequence
          Length = 211648

 Score = 42.1 bits (21), Expect = 0.34
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 67     acacatatatgtatatgctat 87
              |||||||||||||||||||||
Sbjct: 161076 acacatatatgtatatgctat 161056



to top

>emb|AL845290.7| Mouse DNA sequence from clone RP23-201A19 on chromosome 2, complete
            sequence
          Length = 146005

 Score = 42.1 bits (21), Expect = 0.34
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 12   aaatgaaaagggaaacaaaga 32
            |||||||||||||||||||||
Sbjct: 4750 aaatgaaaagggaaacaaaga 4770



to top

>emb|AL840623.10| Mouse DNA sequence from clone RP23-289L17 on chromosome 4, complete
             sequence
          Length = 112610

 Score = 42.1 bits (21), Expect = 0.34
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 62    aaattacacatatatgtatat 82
             |||||||||||||||||||||
Sbjct: 18204 aaattacacatatatgtatat 18224



to top

>gb|AC099621.12| Mus musculus chromosome 15, clone RP23-468J2, complete sequence
          Length = 178810

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 10     aaaaatgaaaagggaaacaa 29
              ||||||||||||||||||||
Sbjct: 142411 aaaaatgaaaagggaaacaa 142430



to top

>emb|CT009713.8| Mouse DNA sequence from clone RP23-151C6 on chromosome 13, complete
             sequence
          Length = 217752

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 64    attacacatatatgtatatg 83
             ||||||||||||||||||||
Sbjct: 75763 attacacatatatgtatatg 75782



to top

>gb|AC116656.5| Mus musculus BAC clone RP23-10A7 from chromosome 15, complete sequence
          Length = 198019

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 10     aaaaatgaaaagggaaacaa 29
              ||||||||||||||||||||
Sbjct: 108989 aaaaatgaaaagggaaacaa 108970



to top

>gb|AC121974.3| Mus musculus BAC clone RP24-285E14 from chromosome 16, complete
             sequence
          Length = 159535

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 12    aaatgaaaagggaaacaaag 31
             ||||||||||||||||||||
Sbjct: 56953 aaatgaaaagggaaacaaag 56934



to top

>gb|AC117598.7| Mus musculus chromosome 1, clone RP23-398H16, complete sequence
          Length = 196300

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    aaaatcagaaaggaaattac 68
             ||||||||||||||||||||
Sbjct: 51377 aaaatcagaaaggaaattac 51358



to top

>gb|AC146308.2| Medicago truncatula clone mth2-10a12, complete sequence
          Length = 112733

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 11    aaaatgaaaagggaaacaaa 30
             ||||||||||||||||||||
Sbjct: 73784 aaaatgaaaagggaaacaaa 73803



to top

>gb|AC137554.15| Medicago truncatula clone mth2-17j18, complete sequence
          Length = 121248

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    aaaatgaaaagggaaacaaa 30
             ||||||||||||||||||||
Sbjct: 96296 aaaatgaaaagggaaacaaa 96277



to top

>emb|AL606759.8| Human DNA sequence from clone CTD-2319N17 on chromosome X, complete
           sequence
          Length = 30082

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 64  attacacatatatgtatatg 83
           ||||||||||||||||||||
Sbjct: 652 attacacatatatgtatatg 633



to top

>emb|AL356739.11| Human DNA sequence from clone RP11-324P13 on chromosome 6, complete
             sequence
          Length = 98548

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 57    aaaggaaattacacatatat 76
             ||||||||||||||||||||
Sbjct: 72636 aaaggaaattacacatatat 72617



to top

>gb|AC111653.8| Rattus norvegicus 2 BAC CH230-108E11 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 247105

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 69     acatatatgtatatgctatc 88
              ||||||||||||||||||||
Sbjct: 112984 acatatatgtatatgctatc 113003



to top

>emb|AL022148.1|HS435A7 Human DNA sequence from clone RP3-435A7 on chromosome Xq22.1-22.3,
             complete sequence
          Length = 98067

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 64    attacacatatatgtatatg 83
             ||||||||||||||||||||
Sbjct: 96719 attacacatatatgtatatg 96700



to top

>emb|AL929355.1|PFA929355 Plasmodium falciparum strain 3D7, chromosome 9; segment 1/5
          Length = 330050

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 62     aaattacacatatatgtatatgct 85
              |||||||| |||||||||||||||
Sbjct: 121170 aaattacatatatatgtatatgct 121147



to top

>gb|AC163900.3| Mus musculus BAC clone RP23-151K15 from chromosome 12, complete sequence
          Length = 200606

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 48     gaaaatcagaaaggaaatta 67
              ||||||||||||||||||||
Sbjct: 177163 gaaaatcagaaaggaaatta 177144



to top

>gb|AC107383.3| Homo sapiens BAC clone RP11-125C20 from 4, complete sequence
          Length = 173808

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 64    attacacatatatgtatatgctat 87
             |||||| |||||||||||||||||
Sbjct: 56808 attacatatatatgtatatgctat 56785



to top

>gb|AC172372.2| Pan troglodytes BAC clone CH251-1067L6 from chromosome y, complete
             sequence
          Length = 192570

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    agaaaatcagaaaggaaatt 66
             ||||||||||||||||||||
Sbjct: 61916 agaaaatcagaaaggaaatt 61897



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    agaaaatcagaaaggaaatt 66
             ||||||||||||||||||||
Sbjct: 48088 agaaaatcagaaaggaaatt 48107



to top

>gb|AC092609.2| Homo sapiens BAC clone RP11-160A16 from 4, complete sequence
          Length = 150751

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 64    attacacatatatgtatatg 83
             ||||||||||||||||||||
Sbjct: 77678 attacacatatatgtatatg 77659



to top

>gb|AC154582.2| Mus musculus BAC clone RP23-381N7 from chromosome 12, complete sequence
          Length = 194302

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 64     attacacatatatgtatatg 83
              ||||||||||||||||||||
Sbjct: 121904 attacacatatatgtatatg 121885



to top

>gb|AC172373.3| Pan troglodytes BAC clone CH251-1081D19 from chromosome y, complete
            sequence
          Length = 194913

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 47   agaaaatcagaaaggaaatt 66
            ||||||||||||||||||||
Sbjct: 5879 agaaaatcagaaaggaaatt 5860



to top

>gb|AY957562.1| Bombina orientalis mitochondrion, complete genome
          Length = 17173

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 62    aaattacacatatatgtata 81
             ||||||||||||||||||||
Sbjct: 17088 aaattacacatatatgtata 17069



to top

>gb|AC125041.2| Mus musculus BAC clone RP23-337J19 from chromosome 12, complete
             sequence
          Length = 202288

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 48    gaaaatcagaaaggaaatta 67
             ||||||||||||||||||||
Sbjct: 54314 gaaaatcagaaaggaaatta 54295



to top

>gb|AC122918.4| Mus musculus chromosome 6 clone RP23-29F15, complete sequence
          Length = 210315

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 9      taaaaatgaaaagggaaaca 28
              ||||||||||||||||||||
Sbjct: 207560 taaaaatgaaaagggaaaca 207579



to top

>gb|AC004672.1|AC004672 Homo sapiens 12p13.3-0-2.7 BAC RP5-951N9 (Roswell Park Cancer Institute
             Human BAC Library) complete sequence
          Length = 85420

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 62    aaattacacatatatgtata 81
             ||||||||||||||||||||
Sbjct: 39786 aaattacacatatatgtata 39805



to top

>emb|BX664611.6| Mouse DNA sequence from clone RP24-201C13 on chromosome X, complete
             sequence
          Length = 59966

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 9     taaaaatgaaaagggaaaca 28
             ||||||||||||||||||||
Sbjct: 22330 taaaaatgaaaagggaaaca 22311



to top

>gb|AC115020.11| Mus musculus chromosome 1, clone RP24-231D14, complete sequence
          Length = 188569

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    aaaatcagaaaggaaattac 68
             ||||||||||||||||||||
Sbjct: 15850 aaaatcagaaaggaaattac 15869



to top

>gb|AC101703.11| Mus musculus chromosome 1, clone RP23-248B15, complete sequence
          Length = 208984

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 10    aaaaatgaaaagggaaacaa 29
             ||||||||||||||||||||
Sbjct: 32207 aaaaatgaaaagggaaacaa 32188



to top

>gb|AC174597.2| Mus musculus BAC clone RP24-418F6 from chromosome 6, complete sequence
          Length = 188358

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 9     taaaaatgaaaagggaaaca 28
             ||||||||||||||||||||
Sbjct: 92718 taaaaatgaaaagggaaaca 92737



to top

>gb|AY823304.1| Norovirus swine/GII/OH-QW101/03/US RNA-dependent RNA polymerase gene,
            partial cds; and capsid protein and VP2 small basic
            protein genes, complete cds
          Length = 3316

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 11   aaaatgaaaagggaaacaaagata 34
            |||| |||||||||||||||||||
Sbjct: 3300 aaaaggaaaagggaaacaaagata 3277



to top

>gb|AC102303.10| Mus musculus chromosome 1, clone RP24-403I11, complete sequence
          Length = 162813

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 10     aaaaatgaaaagggaaaca 28
              |||||||||||||||||||
Sbjct: 102873 aaaaatgaaaagggaaaca 102855



to top

>gb|AC159998.6| Mus musculus BAC clone RP24-576J22 from chromosome 10, complete
             sequence
          Length = 166313

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 3     acatactaaaaatgaaaagggaa 25
             ||||||||||||| |||||||||
Sbjct: 38134 acatactaaaaataaaaagggaa 38112



to top

>gb|AC102749.10| Mus musculus chromosome 5, clone RP24-478I4, complete sequence
          Length = 173437

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    aaaaatgaaaagggaaaca 28
             |||||||||||||||||||
Sbjct: 15945 aaaaatgaaaagggaaaca 15963



to top

>gb|AC160389.4| Mus musculus chromosome 7, clone RP23-257G13, complete sequence
          Length = 237741

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 66     tacacatatatgtatatgc 84
              |||||||||||||||||||
Sbjct: 134662 tacacatatatgtatatgc 134644



to top

>gb|AC168117.2| Mus musculus BAC clone RP23-461G13 from chromosome 17, complete sequence
          Length = 169205

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 12     aaatgaaaagggaaacaaa 30
              |||||||||||||||||||
Sbjct: 144597 aaatgaaaagggaaacaaa 144615



to top

>gb|AC166932.6| Mus musculus chromosome 7, clone RP23-349I13, complete sequence
          Length = 226889

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 12     aaatgaaaagggaaacaaa 30
              |||||||||||||||||||
Sbjct: 164161 aaatgaaaagggaaacaaa 164143



to top

>gb|AC113065.16| Mus musculus chromosome 7, clone RP23-263E7, complete sequence
          Length = 202134

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 12     aaatgaaaagggaaacaaa 30
              |||||||||||||||||||
Sbjct: 188812 aaatgaaaagggaaacaaa 188830



to top

>gb|AC116370.17| Mus musculus chromosome 3, clone RP24-113D8, complete sequence
          Length = 155613

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 12    aaatgaaaagggaaacaaa 30
             |||||||||||||||||||
Sbjct: 52492 aaatgaaaagggaaacaaa 52474



to top

>gb|AC167171.2| Mus musculus BAC clone RP23-409H8 from chromosome 13, complete sequence
          Length = 203840

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 12     aaatgaaaagggaaacaaa 30
              |||||||||||||||||||
Sbjct: 197767 aaatgaaaagggaaacaaa 197785



to top

>gb|AC151601.5| Mus musculus BAC clone RP23-241H10 from chromosome 7, complete sequence
          Length = 187463

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 12    aaatgaaaagggaaacaaa 30
             |||||||||||||||||||
Sbjct: 53459 aaatgaaaagggaaacaaa 53477



to top

>gb|AC006815.2| Caenorhabditis elegans cosmid Y6D11A, complete sequence
          Length = 8452

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 11   aaaatgaaaagggaaacaa 29
            |||||||||||||||||||
Sbjct: 3752 aaaatgaaaagggaaacaa 3734



to top

>gb|AC146440.5| Pan troglodytes BAC clone RP43-11P11 from 7, complete sequence
          Length = 181369

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 8     ctaaaaatgaaaagggaaa 26
             |||||||||||||||||||
Sbjct: 29108 ctaaaaatgaaaagggaaa 29126



to top

>gb|AC148991.2| Mus musculus BAC clone RP23-52N2 from chromosome 19, complete
            sequence
          Length = 221043

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 42   tgaggagaaaatcagaaag 60
            |||||||||||||||||||
Sbjct: 4365 tgaggagaaaatcagaaag 4347



to top

>gb|AC149486.1| Populus trichocarpa clone Pop1-8L22, complete sequence
          Length = 66066

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 14    atgaaaagggaaacaaaga 32
             |||||||||||||||||||
Sbjct: 11405 atgaaaagggaaacaaaga 11387



to top

>gb|AC149575.1| Populus trichocarpa clone Pop1-41G18, complete sequence
          Length = 111678

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 14    atgaaaagggaaacaaaga 32
             |||||||||||||||||||
Sbjct: 74018 atgaaaagggaaacaaaga 74000



to top

>gb|AC126443.3| Mus musculus BAC clone RP23-464J8 from chromosome 7, complete sequence
          Length = 192927

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 12     aaatgaaaagggaaacaaa 30
              |||||||||||||||||||
Sbjct: 173776 aaatgaaaagggaaacaaa 173794



to top

>gb|AC139328.4| Mus musculus BAC clone RP24-299C21 from chromosome Y, complete sequence
          Length = 156740

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    aaaaatgaaaagggaaaca 28
             |||||||||||||||||||
Sbjct: 58325 aaaaatgaaaagggaaaca 58343



to top

>gb|AC125395.3| Mus musculus BAC clone RP23-213J1 from chromosome 14, complete
            sequence
          Length = 208938

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 10   aaaaatgaaaagggaaaca 28
            |||||||||||||||||||
Sbjct: 9621 aaaaatgaaaagggaaaca 9639



to top

>gb|AC123075.5| Mus musculus BAC clone RP23-181C16 from chromosome 3, complete sequence
          Length = 198063

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 62    aaattacacatatatgtat 80
             |||||||||||||||||||
Sbjct: 83320 aaattacacatatatgtat 83338



to top

>gb|DQ491003.1| Chlorella virus AR158 ctg_1047243734156 genomic sequence
          Length = 344691

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 12   aaatgaaaagggaaacaaagata 34
            ||||||||| |||||||||||||
Sbjct: 7851 aaatgaaaacggaaacaaagata 7873



to top

>gb|DQ491002.1| Paramecium bursaria Chlorella virus NY2A Chlorella virus NY2A ctg_13
              genomic sequence
          Length = 368683

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 12     aaatgaaaagggaaacaaagata 34
              ||||||||| |||||||||||||
Sbjct: 360740 aaatgaaaacggaaacaaagata 360718



to top

>gb|AC138667.8| Mus musculus chromosome 14, clone RP24-122H16, complete sequence
          Length = 177623

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    aaaaatgaaaagggaaaca 28
             |||||||||||||||||||
Sbjct: 45431 aaaaatgaaaagggaaaca 45413



to top

>gb|AC114593.12| Mus musculus chromosome 14, clone RP23-44B17, complete sequence
          Length = 210843

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    aaaaatgaaaagggaaaca 28
             |||||||||||||||||||
Sbjct: 11526 aaaaatgaaaagggaaaca 11544



to top

>gb|AC102008.9| Mus musculus chromosome 7, clone RP24-502L8, complete sequence
          Length = 194538

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 66   tacacatatatgtatatgc 84
            |||||||||||||||||||
Sbjct: 7198 tacacatatatgtatatgc 7180



to top

>gb|AC123719.10| Mus musculus chromosome 13, clone RP23-412A14, complete sequence
          Length = 202533

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    aaaaatgaaaagggaaaca 28
             |||||||||||||||||||
Sbjct: 22245 aaaaatgaaaagggaaaca 22227



to top

>gb|AC102734.11| Mus musculus chromosome 6, clone RP24-222N4, complete sequence
          Length = 238453

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 8      ctaaaaatgaaaagggaaacaaa 30
              ||||||| |||||||||||||||
Sbjct: 173120 ctaaaaaagaaaagggaaacaaa 173142



to top

>gb|AC113098.12| Mus musculus chromosome 8, clone RP23-314K9, complete sequence
          Length = 190888

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 10     aaaaatgaaaagggaaaca 28
              |||||||||||||||||||
Sbjct: 155734 aaaaatgaaaagggaaaca 155716



to top

>gb|AC134439.4| Mus musculus BAC clone RP24-494I18 from chromosome 13, complete sequence
          Length = 133093

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 40     agtgaggagaaaatcagaa 58
              |||||||||||||||||||
Sbjct: 115523 agtgaggagaaaatcagaa 115541



to top

>gb|AC116460.10| Mus musculus chromosome 10, clone RP23-244G12, complete sequence
          Length = 203330

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 12     aaatgaaaagggaaacaaa 30
              |||||||||||||||||||
Sbjct: 198581 aaatgaaaagggaaacaaa 198563



to top

>gb|AC146615.2| Mus musculus BAC clone RP23-19K2 from chromosome 14, complete
            sequence
          Length = 192561

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 67   acacatatatgtatatgct 85
            |||||||||||||||||||
Sbjct: 1952 acacatatatgtatatgct 1970



to top

>emb|CR376775.7| Zebrafish DNA sequence from clone CH211-197C5 in linkage group 23,
              complete sequence
          Length = 196846

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 63     aattacacatatatgtata 81
              |||||||||||||||||||
Sbjct: 147679 aattacacatatatgtata 147697



to top

>emb|CR936261.8| Zebrafish DNA sequence from clone DKEY-207A6 in linkage group 5,
             complete sequence
          Length = 106678

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 63    aattacacatatatgtata 81
             |||||||||||||||||||
Sbjct: 18957 aattacacatatatgtata 18975



to top

>gb|AC117702.10| Mus musculus chromosome 10, clone RP23-464I2, complete sequence
          Length = 147559

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 12     aaatgaaaagggaaacaaa 30
              |||||||||||||||||||
Sbjct: 133568 aaatgaaaagggaaacaaa 133586



to top

>gb|AC131700.3| Mus musculus BAC clone RP24-67N3 from chromosome 6, complete sequence
          Length = 197050

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 8      ctaaaaatgaaaagggaaacaaa 30
              ||||||| |||||||||||||||
Sbjct: 184854 ctaaaaaagaaaagggaaacaaa 184832



to top

>gb|AC125373.4| Mus musculus BAC clone RP23-379A13 from chromosome 3, complete sequence
          Length = 190760

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 46    gagaaaatcagaaaggaaa 64
             |||||||||||||||||||
Sbjct: 55912 gagaaaatcagaaaggaaa 55930



to top

>gb|AC115805.12| Mus musculus chromosome 10, clone RP23-412P24, complete sequence
          Length = 193434

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 12    aaatgaaaagggaaacaaa 30
             |||||||||||||||||||
Sbjct: 28518 aaatgaaaagggaaacaaa 28536



to top

>gb|AC122480.3| Mus musculus BAC clone RP24-355B22 from chromosome 14, complete sequence
          Length = 164525

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 67     acacatatatgtatatgct 85
              |||||||||||||||||||
Sbjct: 135129 acacatatatgtatatgct 135111



to top

>gb|AC124489.2| Mus musculus BAC clone RP23-453H5 from chromosome 14, complete sequence
          Length = 167067

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 42283 tacacatatatgtatatgc 42265



to top

>gb|AC121611.3| Mus musculus BAC clone RP23-330I2 from chromosome 6, complete sequence
          Length = 197889

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 17    aaaagggaaacaaagatag 35
             |||||||||||||||||||
Sbjct: 16725 aaaagggaaacaaagatag 16743



to top

>gb|AC122925.3| Mus musculus BAC clone RP23-9O19 from 1, complete sequence
          Length = 256751

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 66     tacacatatatgtatatgc 84
              |||||||||||||||||||
Sbjct: 212204 tacacatatatgtatatgc 212222



to top

>gb|AC122830.4| Mus musculus BAC clone RP23-224I23 from 8, complete sequence
          Length = 257003

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    aaaaatgaaaagggaaaca 28
             |||||||||||||||||||
Sbjct: 90558 aaaaatgaaaagggaaaca 90540



to top

>gb|AC122320.4| Mus musculus BAC clone RP23-315F17 from 14, complete sequence
          Length = 197655

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 12     aaatgaaaagggaaacaaa 30
              |||||||||||||||||||
Sbjct: 116003 aaatgaaaagggaaacaaa 116021



to top

>gb|AC115825.11| Mus musculus chromosome 9, clone RP23-444E13, complete sequence
          Length = 192100

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 10     aaaaatgaaaagggaaaca 28
              |||||||||||||||||||
Sbjct: 131486 aaaaatgaaaagggaaaca 131504



to top

>gb|AC117185.2| Mus musculus BAC clone RP23-37M7 from 8, complete sequence
          Length = 188791

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 10     aaaaatgaaaagggaaaca 28
              |||||||||||||||||||
Sbjct: 130958 aaaaatgaaaagggaaaca 130940



to top

>gb|AC122884.2| Mus musculus BAC clone RP23-88O13 from 5, complete sequence
          Length = 160295

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 66   tacacatatatgtatatgc 84
            |||||||||||||||||||
Sbjct: 7993 tacacatatatgtatatgc 7975



to top

>gb|AC111007.4| Mus musculus BAC clone RP23-226I10 from 3, complete sequence
          Length = 176259

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 10     aaaaatgaaaagggaaaca 28
              |||||||||||||||||||
Sbjct: 130537 aaaaatgaaaagggaaaca 130555



to top

>gb|AC073133.9| Homo sapiens BAC clone RP11-691F21 from 7, complete sequence
          Length = 95280

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 65    ttacacatatatgtatatg 83
             |||||||||||||||||||
Sbjct: 28283 ttacacatatatgtatatg 28301



to top

>ref|XM_730932.1| Plasmodium chabaudi chabaudi hypothetical protein (PC107346.00.0)
           partial mRNA
          Length = 261

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 49  aaaatcagaaaggaaatta 67
           |||||||||||||||||||
Sbjct: 117 aaaatcagaaaggaaatta 99



to top

>ref|XM_671076.1| Plasmodium berghei strain ANKA hypothetical protein (PB000059.02.0)
            partial mRNA
          Length = 3381

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 8    ctaaaaatgaaaagggaaa 26
            |||||||||||||||||||
Sbjct: 3128 ctaaaaatgaaaagggaaa 3146



to top

>gb|AC113204.7| Mus musculus chromosome 12, clone RP23-312J1, complete sequence
          Length = 207293

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 64    attacacatatatgtatat 82
             |||||||||||||||||||
Sbjct: 96854 attacacatatatgtatat 96836



to top

>gb|AC103939.8| Mus musculus chromosome 18, clone RP23-300E7, complete sequence
          Length = 240406

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 12     aaatgaaaagggaaacaaa 30
              |||||||||||||||||||
Sbjct: 198699 aaatgaaaagggaaacaaa 198681



to top

>gb|AC109253.9| Mus musculus, clone RP23-351D8, complete sequence
          Length = 254578

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 14    atgaaaagggaaacaaaga 32
             |||||||||||||||||||
Sbjct: 40800 atgaaaagggaaacaaaga 40782



to top

>gb|BT025041.1| Drosophila melanogaster LD15160 full insert cDNA
          Length = 5558

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 62   aaattacacatatatgtat 80
            |||||||||||||||||||
Sbjct: 5373 aaattacacatatatgtat 5391



to top

>emb|AL627107.32| Human DNA sequence from clone XXyac-R12DG2 on chromosome 13 Contains 2
             novel genes, a calumenin (CALU) pseudogene, a novel gene
             (possible ortholog of RIKEN cDNA 4933433D23 gene) and a
             CpG island, complete sequence
          Length = 79018

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 44    aggagaaaatcagaaagga 62
             |||||||||||||||||||
Sbjct: 11639 aggagaaaatcagaaagga 11621



to top

>gb|BC112569.1| Bos taurus hypothetical protein LOC523894, mRNA (cDNA clone
           MGC:137118 IMAGE:8028093), complete cds
          Length = 1437

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 48  gaaaatcagaaaggaaatt 66
           |||||||||||||||||||
Sbjct: 185 gaaaatcagaaaggaaatt 203



to top

>emb|AL592044.4| Human DNA sequence from clone RP13-407F1 on chromosome 13, complete
             sequence
          Length = 236130

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 70290 tacacatatatgtatatgc 70308



to top

>emb|AL590009.10| Human DNA sequence from clone RP11-181P4 on chromosome 6 Contains the
              WASF1 gene for WAS protein family member 1 and part of the
              FLJ31482 gene, complete sequence
          Length = 153046

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 49     aaaatcagaaaggaaatta 67
              |||||||||||||||||||
Sbjct: 139288 aaaatcagaaaggaaatta 139306



to top

>emb|AL450311.11| Human DNA sequence from clone RP11-343J3 on chromosome 10 Contains the
             NEUROG3 gene for neurogenin 3 (ngn3, Atoh5, Math4B), a
             novel gene,  an ATP synthase 6 (MTATP6)(ATP6) pseudogene,
             a cytochrome c oxidase II (MTCO2)(COII) pseudogene, a
             cytochrome c oxidase I (MTCO1)(COI) pseudogene, a NADH
             dehydrogenase 2 (MTND2) pseudogene, a NADH dehydrogenase 1
             (MTND1) pseudogene, the gene for a novel protein
             (LOC219738), the 5' end of a novel gene and four CpG
             islands, complete sequence
          Length = 165110

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 66    tacacatatatgtatatgctatc 88
             ||||||||||||||||| |||||
Sbjct: 59677 tacacatatatgtatattctatc 59655



to top

>emb|AL391001.12| Human DNA sequence from clone RP11-477H21 on chromosome 1 Contains part
             of the PBX1 gene for pre-B-cell leukemia transcription
             factor 1, complete sequence
          Length = 196730

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 14    atgaaaagggaaacaaaga 32
             |||||||||||||||||||
Sbjct: 32665 atgaaaagggaaacaaaga 32647



to top

>gb|AE014818.1| Plasmodium falciparum 3D7 chromosome 14 section 3 of 13 of the complete
              sequence
          Length = 252632

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 64     attacacatatatgtatat 82
              |||||||||||||||||||
Sbjct: 158543 attacacatatatgtatat 158561



to top

>emb|AL356579.24| Human DNA sequence from clone RP11-593A16 on chromosome 6 Contains the
             5' end of the gene for KIAA1798 protein and a CpG island,
             complete sequence
          Length = 172816

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 64    attacacatatatgtatat 82
             |||||||||||||||||||
Sbjct: 86049 attacacatatatgtatat 86067



to top

>gb|AC098690.3| Homo sapiens chromosome 1 clone RP11-507I14, complete sequence
          Length = 128000

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 29718 tacacatatatgtatatgc 29736



to top

>emb|AL353143.14| Human DNA sequence from clone RP11-383F12 on chromosome 13 Contains part
              of a novel gene (including KIAA0865), possible ortholog of
              rat myosin heavy chain Myr 8 (Loc192253) and a novel gene,
              complete sequence
          Length = 170276

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 43     gaggagaaaatcagaaaggaaat 65
              |||||||||| ||||||||||||
Sbjct: 125699 gaggagaaaaccagaaaggaaat 125677



to top

>emb|AL158826.23| Human DNA sequence from clone RP11-244N20 on chromosome 9 Contains the
             5' end of the ABO gene for ABO blood group (transferase A
             alpha 1-3-N-acetylgalactosaminyltransferase; transferase B
             alpha 1-3-galactosyltransferase) pseudogene ABO-*O02
             allele, the gene for a novel protein similar to lipocalin
             1 (protein migrating faster than albumin tear prealbumin)
             (LCN1), a ribosomal protein L21 (RPL21) pseudogene, the
             RPL7A gene for ribosomal protein L7a, a novel gene
             (MGC43306), the XPMC2H gene for Xenopus prevents mitotic
             catastrophe 2 homolog, the 5' end of the ADAMTS13 gene for
             a disintegrin-like and metalloprotease (reprolysin type)
             with thrombospondin type 1 motif 13, the SURF1 gene for
             surfeit 1, the SURF2 gene for surfeit 2, the SURF4 gene
             for surfeit 4, the SURF5 gene for surfeit 5, the SURF6
             gene for surfeit 6 and eight CpG islands, complete
             sequence
          Length = 184513

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 12    aaatgaaaagggaaacaaa 30
             |||||||||||||||||||
Sbjct: 37903 aaatgaaaagggaaacaaa 37921



to top

>emb|AL158167.15| Human DNA sequence from clone RP11-534G20 on chromosome 10 Contains two
             novel genes and the 3' end of the SVIL gene for
             supervillin (archvillin) and a CpG island, complete
             sequence
          Length = 227744

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 47    agaaaatcagaaaggaaat 65
             |||||||||||||||||||
Sbjct: 11020 agaaaatcagaaaggaaat 11002



to top

>emb|AL139294.15| Human DNA sequence from clone RP5-1044H5 on chromosome 1p31.2-32.3
             Contains the 5' end of the DNAJC6 gene for DnaJ (Hsp40)
             homolog subfamily C member 6, a novel gene and a
             cytochrome c oxidase subunit VIc (COX6C) pseudogene,
             complete sequence
          Length = 93614

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 65    ttacacatatatgtatatg 83
             |||||||||||||||||||
Sbjct: 65961 ttacacatatatgtatatg 65979



to top

>emb|AL138813.8| Human DNA sequence from clone RP1-305K11 on chromosome 11p13-14.2
             Contains STSs and GSSs, complete sequence
          Length = 76738

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 64    attacacatatatgtatat 82
             |||||||||||||||||||
Sbjct: 62950 attacacatatatgtatat 62932



to top

>emb|AL135929.5| Human DNA sequence from clone RP4-801G22 on chromosome 1q21.2-22
             Contains the 5' end of the gene for immunoglobulin
             superfamily receptor translocation associated 2 (IRTA2),
             the gene for immunoglobulin superfamily receptor
             translocation associated 1 (IRTA1) and two pseudogenes
             similar to part of a Fc receptor-like protein, complete
             sequence
          Length = 97146

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 67926 tacacatatatgtatatgc 67944



to top

>gb|AC124784.4| Homo sapiens 12 BAC RP11-461F16 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 144000

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 14    atgaaaagggaaacaaaga 32
             |||||||||||||||||||
Sbjct: 83246 atgaaaagggaaacaaaga 83228



to top

>emb|AL049591.12|HSJ878I13 Human DNA sequence from clone RP5-878I13 on chromosome Xq23-25 Contains
             an alpha tubulin pseudogene, complete sequence
          Length = 122400

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 34286 tacacatatatgtatatgc 34304



 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 34250 tacacatatatgtatatgc 34268



to top

>emb|AL096803.8|HSBG304P7 Human DNA sequence from clone GS1-304P7 on chromosome 1q25.1-31.1
             Contains a zinc-finger protein pseudogene and a novel
             pseudogene, complete sequence
          Length = 129723

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 24516 tacacatatatgtatatgc 24498



to top

>gb|AC157917.4| Mus musculus chromosome 3, clone RP23-120L6, complete sequence
          Length = 206959

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    aaaaatgaaaagggaaaca 28
             |||||||||||||||||||
Sbjct: 87125 aaaaatgaaaagggaaaca 87143



to top

>gb|AC158149.3| Mus musculus chromosome 5, clone RP24-296L6, complete sequence
          Length = 155517

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 95780 tacacatatatgtatatgc 95762



to top

>emb|AL021398.1|HS964D12 Human DNA sequence from clone RP5-964D12 on chromosome 1q24-25
            Contains the 5' end of the ASTN gene for astrotactin and
            the 5' end of the gene for a novel protein (KIAA1747,
            LOC57795), complete sequence
          Length = 146963

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 1    acacatactaaaaatgaaa 19
            |||||||||||||||||||
Sbjct: 7020 acacatactaaaaatgaaa 7038



to top

>gb|AC133796.2| Homo sapiens 3 BAC RP11-10I2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 125170

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 34215 tacacatatatgtatatgc 34233



to top

>gb|AC130388.6| Drosophila melanogaster X BAC CH221-14P20 (Children's Hospital Oakland
             Research Institute Drosophila melanogaster sheared DNA BAC
             Library) complete sequence
          Length = 117795

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 62    aaattacacatatatgtat 80
             |||||||||||||||||||
Sbjct: 44545 aaattacacatatatgtat 44563



to top

>gb|AC023714.5| Drosophila melanogaster X BAC RP98-19D19 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 160100

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 62     aaattacacatatatgtat 80
              |||||||||||||||||||
Sbjct: 157404 aaattacacatatatgtat 157386



to top

>gb|AC074336.14| Mus musculus Strain C57BL6/J chromosome 1 BAC, RP23-366C17, Complete
            Sequence, complete sequence
          Length = 217768

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 65   ttacacatatatgtatatg 83
            |||||||||||||||||||
Sbjct: 4510 ttacacatatatgtatatg 4492



to top

>emb|AL031745.8|PFMAL1P2 Plasmodium falciparum DNA from MAL1P2
          Length = 384550

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 1      acacatactaaaaatgaaa 19
              |||||||||||||||||||
Sbjct: 142330 acacatactaaaaatgaaa 142348



to top

>gb|AC156575.3| Mus musculus BAC clone RP23-4P20 from chromosome 13, complete sequence
          Length = 196560

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    aaaaatgaaaagggaaaca 28
             |||||||||||||||||||
Sbjct: 23228 aaaaatgaaaagggaaaca 23246



to top

>gb|AC160756.7| Mus musculus chromosome 15, clone RP23-158H4, complete sequence
          Length = 194707

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    aaaaatgaaaagggaaaca 28
             |||||||||||||||||||
Sbjct: 71008 aaaaatgaaaagggaaaca 70990



to top

>emb|AL669833.7| Mouse DNA sequence from clone RP23-51C16 on chromosome 11, complete
            sequence
          Length = 48352

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 10   aaaaatgaaaagggaaaca 28
            |||||||||||||||||||
Sbjct: 7520 aaaaatgaaaagggaaaca 7502



to top

>emb|AL929002.4| Mouse DNA sequence from clone RP23-369A3 on chromosome 11, complete
             sequence
          Length = 50526

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    aaaaatgaaaagggaaaca 28
             |||||||||||||||||||
Sbjct: 11243 aaaaatgaaaagggaaaca 11261



to top

>emb|AL672260.25| Mouse DNA sequence from clone DN-127L1 on chromosome 3 Contains a
             Saccharomyces cerevisiae Nip7p homolog (pEachy) homolog
             pseudogene, a tumor protein translationally-controlled 1
             (Tpt1) pseudogene, a high mobility group box 2 (Hmgb2)
             pseudogene and the Cd2 gene for CD2 antigen, complete
             sequence
          Length = 169010

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 85183 tacacatatatgtatatgc 85165



to top

>gb|AC087301.8| Homo sapiens chromosome 17, clone RP11-661C3, complete sequence
          Length = 229153

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 37192 tacacatatatgtatatgc 37174



to top

>gb|AC160536.4| Mus musculus chromosome 8, clone RP24-92K22, complete sequence
          Length = 202719

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 10     aaaaatgaaaagggaaaca 28
              |||||||||||||||||||
Sbjct: 101013 aaaaatgaaaagggaaaca 100995



to top

>gb|AC116529.16| Mus musculus chromosome 8, clone RP24-380O18, complete sequence
          Length = 166863

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 49    aaaatcagaaaggaaattacaca 71
             |||||||||||| ||||||||||
Sbjct: 31440 aaaatcagaaagcaaattacaca 31418



to top

>emb|AL683883.26| Mouse DNA sequence from clone RP23-361B8 on chromosome X, complete
             sequence
          Length = 190863

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 12    aaatgaaaagggaaacaaa 30
             |||||||||||||||||||
Sbjct: 44747 aaatgaaaagggaaacaaa 44729



to top

>gb|AC156991.9| Mus musculus chromosome 8, clone RP23-297F23, complete sequence
          Length = 164343

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 10930 tacacatatatgtatatgc 10948



to top

>dbj|AK022093.1| Homo sapiens cDNA FLJ12031 fis, clone HEMBB1001874
          Length = 1759

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 14  atgaaaagggaaacaaaga 32
           |||||||||||||||||||
Sbjct: 147 atgaaaagggaaacaaaga 165



to top

>emb|AL929036.8| Mouse DNA sequence from clone RP24-548P4 on chromosome 2, complete
             sequence
          Length = 100285

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    aaaaatgaaaagggaaaca 28
             |||||||||||||||||||
Sbjct: 45356 aaaaatgaaaagggaaaca 45338



to top

>ref|NM_206620.3| Drosophila melanogaster Tousled-like kinase CG32782-RD, transcript
            variant D (tlk), mRNA
          Length = 6283

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 62   aaattacacatatatgtat 80
            |||||||||||||||||||
Sbjct: 5418 aaattacacatatatgtat 5436



to top

>gb|AF434765.1| Mus musculus fatty acid translocase (Cd36) gene, downstream promoter
            region and 5' UTR
          Length = 6396

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 64   attacacatatatgtatat 82
            |||||||||||||||||||
Sbjct: 2119 attacacatatatgtatat 2137



to top

>gb|AC090179.4| Homo sapiens chromosome 15, clone RP11-236J21, complete sequence
          Length = 161586

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 65     ttacacatatatgtatatg 83
              |||||||||||||||||||
Sbjct: 119105 ttacacatatatgtatatg 119123



to top

>dbj|AK138435.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length
           enriched library, clone:A230106L07
           product:unclassifiable, full insert sequence
          Length = 3558

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  tacacatatatgtatatgc 84
           |||||||||||||||||||
Sbjct: 347 tacacatatatgtatatgc 329



to top

>gb|AC157786.7| Mus musculus chromosome 1, clone RP23-280O23, complete sequence
          Length = 205264

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    aaaaatgaaaagggaaaca 28
             |||||||||||||||||||
Sbjct: 20252 aaaaatgaaaagggaaaca 20270



to top

>gb|AC093808.2| Homo sapiens BAC clone RP11-342A1 from 4, complete sequence
          Length = 210837

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 7      actaaaaatgaaaagggaaacaa 29
              |||||||||||||| ||||||||
Sbjct: 176473 actaaaaatgaaaatggaaacaa 176495



to top

>gb|AC090751.9| Homo sapiens chromosome 15, clone RP11-331H13, complete sequence
          Length = 207888

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 65    ttacacatatatgtatatg 83
             |||||||||||||||||||
Sbjct: 23914 ttacacatatatgtatatg 23932



to top

>gb|AC093154.2| Homo sapiens chromosome 1 clone RP3-445O10, complete sequence
          Length = 145658

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 64    attacacatatatgtatat 82
             |||||||||||||||||||
Sbjct: 20054 attacacatatatgtatat 20036



to top

>gb|AC034154.6| Homo sapiens BAC clone RP11-242D9 from 4, complete sequence
          Length = 210563

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 69    acatatatgtatatgctat 87
             |||||||||||||||||||
Sbjct: 17357 acatatatgtatatgctat 17339



to top

>gb|AC166644.7| Mus musculus chromosome 1, clone RP23-375C6, complete sequence
          Length = 175851

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 64    attacacatatatgtatat 82
             |||||||||||||||||||
Sbjct: 36050 attacacatatatgtatat 36032



to top

>gb|AC099015.1| Drosophila melanogaster, chromosome 2R, region 48C-49A, BAC clone
              BACR26P21, complete sequence
          Length = 157010

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 64     attacacatatatgtatat 82
              |||||||||||||||||||
Sbjct: 100464 attacacatatatgtatat 100446



to top

>ref|NM_001031761.2| Bos taurus hypothetical protein LOC523894 (LOC523894), mRNA
          Length = 1437

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 48  gaaaatcagaaaggaaatt 66
           |||||||||||||||||||
Sbjct: 185 gaaaatcagaaaggaaatt 203



to top

>gb|AC161601.4| Mus musculus BAC clone RP23-333L19 from chromosome 3, complete sequence
          Length = 200393

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 10     aaaaatgaaaagggaaaca 28
              |||||||||||||||||||
Sbjct: 157262 aaaaatgaaaagggaaaca 157244



to top

>gb|AC154028.7| Mus musculus 10 BAC RP23-246J13 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 206191

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 12     aaatgaaaagggaaacaaa 30
              |||||||||||||||||||
Sbjct: 148759 aaatgaaaagggaaacaaa 148777



to top

>emb|BX296537.10| Zebrafish DNA sequence from clone CH211-249G3 in linkage group 2,
             complete sequence
          Length = 153636

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 8     ctaaaaatgaaaagggaaa 26
             |||||||||||||||||||
Sbjct: 70922 ctaaaaatgaaaagggaaa 70904



to top

>gb|AC130669.17| Mus musculus chromosome 15, clone RP24-84O5, complete sequence
          Length = 205231

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    aaaaatgaaaagggaaaca 28
             |||||||||||||||||||
Sbjct: 39507 aaaaatgaaaagggaaaca 39525



to top

>gb|AC026691.5| Homo sapiens chromosome 5 clone CTC-203F4, complete sequence
          Length = 135062

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 98   atctttctgttttcattct 116
            |||||||||||||||||||
Sbjct: 4085 atctttctgttttcattct 4103



to top

>gb|AC153650.4| Mus musculus BAC clone RP24-93I18 from chromosome 1, complete sequence
          Length = 199753

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 66     tacacatatatgtatatgc 84
              |||||||||||||||||||
Sbjct: 113775 tacacatatatgtatatgc 113793



to top

>gb|AC157557.5| Mus musculus chromosome 7, clone RP24-369M22, complete sequence
          Length = 202543

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 86838 tacacatatatgtatatgc 86856



to top

>gb|AC023118.4|AC023118 Homo sapiens BAC clone RP11-277L22 from 11, complete sequence
          Length = 154330

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 69     acatatatgtatatgctat 87
              |||||||||||||||||||
Sbjct: 151403 acatatatgtatatgctat 151421



to top

>gb|AC153527.9| Mus musculus 10 BAC RP23-320A6 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 205006

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 10     aaaaatgaaaagggaaaca 28
              |||||||||||||||||||
Sbjct: 169582 aaaaatgaaaagggaaaca 169600



to top

>emb|BX247877.13| Zebrafish DNA sequence from clone DKEY-16J24, complete sequence
          Length = 189537

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 11     aaaatgaaaagggaaacaa 29
              |||||||||||||||||||
Sbjct: 121892 aaaatgaaaagggaaacaa 121910



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 62       aaattacacatatatgtat 80
                |||||||||||||||||||
Sbjct: 31419535 aaattacacatatatgtat 31419553



to top

>gb|AC097465.2| Homo sapiens BAC clone RP11-24I21 from 4, complete sequence
          Length = 172557

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 7     actaaaaatgaaaagggaaacaa 29
             |||||||||||||| ||||||||
Sbjct: 73210 actaaaaatgaaaatggaaacaa 73232



to top

>gb|AC096735.3| Homo sapiens BAC clone RP11-135M12 from 4, complete sequence
          Length = 193510

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 94400 tacacatatatgtatatgc 94382



to top

>gb|AC154124.5| Mus musculus chromosome 5, clone RP24-63G13, complete sequence
          Length = 199573

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 64     attacacatatatgtatat 82
              |||||||||||||||||||
Sbjct: 107010 attacacatatatgtatat 107028



to top

>gb|AC010738.5| Homo sapiens BAC clone RP11-443I9 from 2, complete sequence
          Length = 121448

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 46    gagaaaatcagaaaggaaa 64
             |||||||||||||||||||
Sbjct: 85197 gagaaaatcagaaaggaaa 85179



to top

>dbj|AP003237.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0046E05
          Length = 162776

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 62    aaattacacatatatgtat 80
             |||||||||||||||||||
Sbjct: 13599 aaattacacatatatgtat 13617



to top

>gb|AC068718.6| Homo sapiens BAC clone RP11-123G24 from 2, complete sequence
          Length = 161955

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 65    ttacacatatatgtatatg 83
             |||||||||||||||||||
Sbjct: 22945 ttacacatatatgtatatg 22927



to top

>gb|AC138185.2| Homo sapiens chromosome 8, clone RP11-640O8, complete sequence
          Length = 152309

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 2    cacatactaaaaatgaaaa 20
            |||||||||||||||||||
Sbjct: 8132 cacatactaaaaatgaaaa 8150



to top

>gb|AC012066.10| Homo sapiens BAC clone RP11-173H9 from 2, complete sequence
          Length = 188547

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 12    aaatgaaaagggaaacaaa 30
             |||||||||||||||||||
Sbjct: 97984 aaatgaaaagggaaacaaa 97966



to top

>gb|AC069418.15| Homo sapiens 3 BAC RP11-464F3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 147000

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 51528 tacacatatatgtatatgc 51546



to top

>gb|AC117539.6| Papio hamadryas, clone RP41-208E11, complete sequence
          Length = 208592

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 18891 tacacatatatgtatatgc 18909



to top

>gb|AC006343.3| Homo sapiens PAC clone RP4-548K24 from 7q34-q36, complete sequence
          Length = 124877

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 8     ctaaaaatgaaaagggaaa 26
             |||||||||||||||||||
Sbjct: 38025 ctaaaaatgaaaagggaaa 38007



to top

>gb|AC061965.16| Homo sapiens chromosome 15, clone RP11-37J13, complete sequence
          Length = 169399

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 63     aattacacatatatgtata 81
              |||||||||||||||||||
Sbjct: 124132 aattacacatatatgtata 124150



to top

>gb|AC125035.3| Mus musculus chromosome UL clone RP23-328F24, complete sequence
          Length = 198197

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 84572 tacacatatatgtatatgc 84554



to top

>gb|AC009358.6|AC009358 Human Chromosome 7 clone RP11-191E5, complete sequence
          Length = 185124

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 63     aattacacatatatgtata 81
              |||||||||||||||||||
Sbjct: 184650 aattacacatatatgtata 184632



to top

>gb|AC124804.10| Homo sapiens chromosome 17, clone RP11-449L23, complete sequence
          Length = 203066

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 66     tacacatatatgtatatgc 84
              |||||||||||||||||||
Sbjct: 188116 tacacatatatgtatatgc 188098



to top

>gb|AC009178.4|AC009178 Homo sapiens clone RP11-169C22 from 7q31, complete sequence
          Length = 178097

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 63    aattacacatatatgtata 81
             |||||||||||||||||||
Sbjct: 10879 aattacacatatatgtata 10861



to top

>gb|AC152169.2| Mus musculus BAC clone RP23-79L13 from chromosome 14, complete sequence
          Length = 236748

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 66     tacacatatatgtatatgc 84
              |||||||||||||||||||
Sbjct: 186638 tacacatatatgtatatgc 186620



to top

>gb|AF172082.1|AF172082 Homo sapiens HPC1 locus clone 173P17 genomic sequence
          Length = 41078

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 15165 tacacatatatgtatatgc 15147



to top

>emb|AL928988.14| Mouse DNA sequence from clone RP23-402M7 on chromosome 2, complete
             sequence
          Length = 121977

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 17151 tacacatatatgtatatgc 17169



to top

>emb|AL713898.9| Mouse DNA sequence from clone RP23-253D13 on chromosome X, complete
              sequence
          Length = 189001

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 66     tacacatatatgtatatgc 84
              |||||||||||||||||||
Sbjct: 148068 tacacatatatgtatatgc 148086



to top

>emb|AL672186.7| Mouse DNA sequence from clone RP23-42G2 on chromosome X, complete
            sequence
          Length = 205757

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 99   tctttctgttttcattcta 117
            |||||||||||||||||||
Sbjct: 8385 tctttctgttttcattcta 8367



to top

>gb|AF001548.1|HUAF001548 Human Chromosome 16 BAC clone CIT987SK-A-815A9, complete sequence
          Length = 145831

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 48    gaaaatcagaaaggaaatt 66
             |||||||||||||||||||
Sbjct: 94529 gaaaatcagaaaggaaatt 94547



to top

>gb|AC154635.2| Mus musculus BAC clone RP23-299N21 from 13, complete sequence
          Length = 157982

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 26/27 (96%), Gaps = 1/27 (3%)
 Strand = Plus / Minus

                                         
Query: 7      actaaaaat-gaaaagggaaacaaaga 32
              ||||||||| |||||||||||||||||
Sbjct: 116823 actaaaaatagaaaagggaaacaaaga 116797



to top

>gb|AC154743.2| Mus musculus BAC clone RP24-392N10 from 13, complete sequence
          Length = 141272

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    aaaaatgaaaagggaaaca 28
             |||||||||||||||||||
Sbjct: 48075 aaaaatgaaaagggaaaca 48057



to top

>gb|AC155244.2| Mus musculus BAC clone RP24-318B2 from 13, complete sequence
          Length = 198847

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 61     gaaattacacatatatgtatatg 83
              ||||||||| |||||||||||||
Sbjct: 132191 gaaattacatatatatgtatatg 132169



to top

>emb|AL583809.3|CNS07EFY Human chromosome 14 DNA sequence BAC R-736L22 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 171699

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 64     attacacatatatgtatat 82
              |||||||||||||||||||
Sbjct: 115142 attacacatatatgtatat 115160



to top

>gb|AC154777.2| Mus musculus BAC clone RP24-459H24 from 14, complete sequence
          Length = 155730

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 64    attacacatatatgtatat 82
             |||||||||||||||||||
Sbjct: 90862 attacacatatatgtatat 90844



to top

>gb|AC107666.13| Mus musculus chromosome 5, clone RP23-111M3, complete sequence
          Length = 230189

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 66     tacacatatatgtatatgc 84
              |||||||||||||||||||
Sbjct: 207935 tacacatatatgtatatgc 207917



to top

>emb|BX936328.7| Zebrafish DNA sequence from clone CH211-11F20 in linkage group 18,
             complete sequence
          Length = 113038

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 11    aaaatgaaaagggaaacaa 29
             |||||||||||||||||||
Sbjct: 67482 aaaatgaaaagggaaacaa 67500



to top

>gb|AC116469.13| Mus musculus chromosome 5, clone RP23-171F16, complete sequence
          Length = 207364

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 12     aaatgaaaagggaaacaaa 30
              |||||||||||||||||||
Sbjct: 126462 aaatgaaaagggaaacaaa 126480



to top

>gb|AC104892.10| Mus musculus chromosome 18, clone RP23-262H4, complete sequence
          Length = 190380

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 12    aaatgaaaagggaaacaaa 30
             |||||||||||||||||||
Sbjct: 13268 aaatgaaaagggaaacaaa 13250



to top

>emb|CT025920.8| Zebrafish DNA sequence from clone CH73-64P10 in linkage group 18,
            complete sequence
          Length = 90660

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 11   aaaatgaaaagggaaacaa 29
            |||||||||||||||||||
Sbjct: 2038 aaaatgaaaagggaaacaa 2056



to top

>gb|BT020677.1| Bos taurus hypothetical protein FLJ38968 (FLJ38968), mRNA, complete
           cds
          Length = 1241

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 48  gaaaatcagaaaggaaatt 66
           |||||||||||||||||||
Sbjct: 115 gaaaatcagaaaggaaatt 133



to top

>gb|AC113288.7| Mus musculus chromosome 5, clone RP23-414I12, complete sequence
          Length = 185599

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 19907 tacacatatatgtatatgc 19925



to top

>gb|AE003824.3| Drosophila melanogaster chromosome 2R, section 26 of 73 of the complete
              sequence
          Length = 268836

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 64     attacacatatatgtatat 82
              |||||||||||||||||||
Sbjct: 107460 attacacatatatgtatat 107442



to top

>emb|AL132709.5|CNS01DTB Human chromosome 14 DNA sequence BAC R-909M7 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 200540

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 37    gggagtgaggagaaaatcagaaa 59
             ||||||| |||||||||||||||
Sbjct: 98651 gggagtggggagaaaatcagaaa 98673



to top

>gb|AE003429.4| Drosophila melanogaster chromosome X, section 13 of 74 of the complete
             sequence
          Length = 326403

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 62    aaattacacatatatgtat 80
             |||||||||||||||||||
Sbjct: 20849 aaattacacatatatgtat 20867



to top

>gb|AC138245.11| Mus musculus chromosome 17, clone RP23-75D10, complete sequence
          Length = 216692

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    aaaaatgaaaagggaaaca 28
             |||||||||||||||||||
Sbjct: 49203 aaaaatgaaaagggaaaca 49221



to top

>gb|AC111039.13| Mus musculus chromosome 5, clone RP24-463M5, complete sequence
          Length = 141949

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 66     tacacatatatgtatatgc 84
              |||||||||||||||||||
Sbjct: 134699 tacacatatatgtatatgc 134681



to top

>gb|AC163756.5| Pan troglodytes BAC clone CH251-261N12 from chromosome unknown,
             complete sequence
          Length = 146881

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 14    atgaaaagggaaacaaaga 32
             |||||||||||||||||||
Sbjct: 13560 atgaaaagggaaacaaaga 13578



to top

>gb|AC101547.9| Mus musculus chromosome 5, clone RP23-193C5, complete sequence
          Length = 185061

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 62     aaattacacatatatgtat 80
              |||||||||||||||||||
Sbjct: 143504 aaattacacatatatgtat 143486



to top

>gb|AC103404.13| Mus musculus chromosome 5, clone RP23-21O1, complete sequence
          Length = 251988

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    aaaaatgaaaagggaaaca 28
             |||||||||||||||||||
Sbjct: 40599 aaaaatgaaaagggaaaca 40581



to top

>gb|AC118680.7| Mus musculus chromosome 8, clone RP24-381G7, complete sequence
          Length = 188031

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 69077 tacacatatatgtatatgc 69059



to top

>gb|AC114589.30| Mus musculus chromosome 8, clone RP23-365O13, complete sequence
          Length = 213866

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 49    aaaatcagaaaggaaattacaca 71
             |||||||||||| ||||||||||
Sbjct: 16244 aaaatcagaaagcaaattacaca 16266



to top

>dbj|AP002797.3| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-779P3, complete
             sequences
          Length = 185316

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 69    acatatatgtatatgctat 87
             |||||||||||||||||||
Sbjct: 21425 acatatatgtatatgctat 21443



to top

>dbj|AP001885.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-157K17, complete
             sequence
          Length = 173052

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 16    gaaaagggaaacaaagata 34
             |||||||||||||||||||
Sbjct: 19600 gaaaagggaaacaaagata 19582



to top

>gb|AC005465.1|AC005465 Drosophila melanogaster, chromosome 2R, region 48C1-48C2, P1 clone
             DS05372, complete sequence
          Length = 77862

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 64    attacacatatatgtatat 82
             |||||||||||||||||||
Sbjct: 22780 attacacatatatgtatat 22798



to top

>dbj|AP005856.2| Homo sapiens genomic DNA, chromosome 8q24, clone: KB1568E2, complete
            sequence
          Length = 160612

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 2    cacatactaaaaatgaaaa 20
            |||||||||||||||||||
Sbjct: 6901 cacatactaaaaatgaaaa 6919



to top

>emb|CT030656.7| Mouse DNA sequence from clone RP23-271O7 on chromosome 9, complete
              sequence
          Length = 215427

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 10     aaaaatgaaaagggaaaca 28
              |||||||||||||||||||
Sbjct: 196785 aaaaatgaaaagggaaaca 196767



to top

>gb|AF045643.2| Caenorhabditis elegans cosmid F58H7, complete sequence
          Length = 43834

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 50   aaatcagaaaggaaattacacat 72
            ||||||||||| |||||||||||
Sbjct: 5906 aaatcagaaagaaaattacacat 5884



to top

>gb|AC159269.3| Mus musculus BAC clone RP23-426N14 from chromosome 12, complete sequence
          Length = 184137

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 12     aaatgaaaagggaaacaaa 30
              |||||||||||||||||||
Sbjct: 111872 aaatgaaaagggaaacaaa 111854



to top

>emb|AL357752.19| Human DNA sequence from clone RP13-26D14 on chromosome Xq13.2-21.1
             Contains the 5' end of the KIF4A gene for kinesin family
             member 4A, gene FLJ21093, a novel gene, the ARR3 gene for
             arrestin 3, retinal (x-arrestin), the P2RY4 gene for
             pyrimidinergic receptor P2Y, G-protein coupled, 4, the
             gene for a novel protein similar to diacylglycerol
             O-acyltransferase 2 like 1 (DGAT2L1), a novel pseudogene,
             the 3' end of the gene for a novel protein similar to
             diacylglycerol O-acyltransferase homolog 2 (mouse) (DGAT2)
             and two CpG islands, complete sequence
          Length = 178868

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 63011 tacacatatatgtatatgc 63029



to top

>gb|AC147108.3| Mus musculus BAC clone RP24-70D19 from 13, complete sequence
          Length = 188893

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 40    agtgaggagaaaatcagaa 58
             |||||||||||||||||||
Sbjct: 46721 agtgaggagaaaatcagaa 46739



to top

>gb|AC122444.4| Mus musculus BAC clone RP24-232I9 from 9, complete sequence
          Length = 184253

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 1     acacatactaaaaatgaaa 19
             |||||||||||||||||||
Sbjct: 16751 acacatactaaaaatgaaa 16769



to top

>gb|AC144762.3| Mus musculus BAC clone RP24-95D6 from 3, complete sequence
          Length = 198005

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    aaaaatgaaaagggaaaca 28
             |||||||||||||||||||
Sbjct: 12592 aaaaatgaaaagggaaaca 12610



to top

>gb|AC132571.2| Mus musculus BAC clone RP24-539E18 from 1, complete sequence
          Length = 200750

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 65     ttacacatatatgtatatg 83
              |||||||||||||||||||
Sbjct: 104099 ttacacatatatgtatatg 104117



to top

>emb|CT030664.5| Mouse DNA sequence from clone RP23-357K7 on chromosome 13, complete
             sequence
          Length = 192064

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 12    aaatgaaaagggaaacaaa 30
             |||||||||||||||||||
Sbjct: 55694 aaatgaaaagggaaacaaa 55712



to top

>gb|AC132453.3| Mus musculus BAC clone RP23-200J18 from 6, complete sequence
          Length = 206248

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 87489 tacacatatatgtatatgc 87507



to top

>gb|AC132137.3| Mus musculus BAC clone RP23-153E2 from 3, complete sequence
          Length = 196413

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 28862 tacacatatatgtatatgc 28844



to top

>gb|AC135511.4| Mus musculus BAC clone RP23-255B19 from 3, complete sequence
          Length = 195384

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 12     aaatgaaaagggaaacaaa 30
              |||||||||||||||||||
Sbjct: 188239 aaatgaaaagggaaacaaa 188257



to top

>gb|AC134900.5| Mus musculus BAC clone RP23-249B22 from 10, complete sequence
          Length = 213095

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    aaaaatgaaaagggaaaca 28
             |||||||||||||||||||
Sbjct: 93833 aaaaatgaaaagggaaaca 93851



to top

>emb|CT025552.9| Mouse DNA sequence from clone RP24-270A4 on chromosome 13, complete
              sequence
          Length = 206266

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 10     aaaaatgaaaagggaaaca 28
              |||||||||||||||||||
Sbjct: 167098 aaaaatgaaaagggaaaca 167116



to top

>emb|AL844522.7| Zebrafish DNA sequence from clone DKEY-113M9, complete sequence
          Length = 193193

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 10     aaaaatgaaaagggaaacaaaga 32
              ||||||||||| |||||||||||
Sbjct: 157433 aaaaatgaaaaaggaaacaaaga 157455



to top

>emb|AL772324.5| Mouse DNA sequence from clone RP23-440O7 on chromosome 4, complete
             sequence
          Length = 135401

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    aaaaatgaaaagggaaaca 28
             |||||||||||||||||||
Sbjct: 71197 aaaaatgaaaagggaaaca 71179



to top

>gb|AC148321.7| Mus musculus BAC clone RP24-512H17 from 19, complete sequence
          Length = 210790

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 42     tgaggagaaaatcagaaag 60
              |||||||||||||||||||
Sbjct: 138089 tgaggagaaaatcagaaag 138071



to top

>gb|AC002106.1|AC002106 Genomic sequence from Human 9q34, complete sequence
          Length = 40814

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 12   aaatgaaaagggaaacaaa 30
            |||||||||||||||||||
Sbjct: 9204 aaatgaaaagggaaacaaa 9222



to top

>gb|AC163743.6| Mus musculus BAC clone RP23-415J4 from chromosome 13, complete sequence
          Length = 198305

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 61    gaaattacacatatatgtatatg 83
             ||||||||| |||||||||||||
Sbjct: 12271 gaaattacatatatatgtatatg 12249



to top

>gb|AC099643.5| Mus musculus chromosome 7, clone RP24-350G1, complete sequence
          Length = 139303

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 70010 tacacatatatgtatatgc 70028



to top

>gb|AC164586.7| Mus musculus chromosome 8, clone RP24-258B3, complete sequence
          Length = 105452

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 12    aaatgaaaagggaaacaaa 30
             |||||||||||||||||||
Sbjct: 46461 aaatgaaaagggaaacaaa 46443



to top

>gb|AC163039.6| Mus musculus BAC clone RP23-188J1 from chromosome 14, complete sequence
          Length = 198538

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 67     acacatatatgtatatgct 85
              |||||||||||||||||||
Sbjct: 151609 acacatatatgtatatgct 151627



to top

>gb|U35323.1|MMU35323 Mus musculus H2-M alpha chain (H2-Ma) gene, H2-M beta 2 chain (H2-Mb2)
             gene, H2-M beta 1 chain (H2-Mb1) gene, low molecular
             weight protein 2 Lmp2 (Lmp2) gene, complete cds
          Length = 53419

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    cagaaaggaaattacacat 72
             |||||||||||||||||||
Sbjct: 36901 cagaaaggaaattacacat 36919



to top

>gb|AC171502.2| Mus musculus BAC clone RP23-242G4 from chromosome 6, complete sequence
          Length = 209147

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    tacacatatatgtatatgc 84
             |||||||||||||||||||
Sbjct: 59236 tacacatatatgtatatgc 59254



to top

>gb|AC171325.5| Mus musculus chromosome 3, clone RP23-124B15, complete sequence
          Length = 191795

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 12    aaatgaaaagggaaacaaa 30
             |||||||||||||||||||
Sbjct: 24514 aaatgaaaagggaaacaaa 24532



to top

>gb|AC115008.7| Mus musculus chromosome 3, clone RP24-189F12, complete sequence
          Length = 154667

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 48    gaaaatcagaaaggaaattacac 70
             |||| ||||||||||||||||||
Sbjct: 54872 gaaattcagaaaggaaattacac 54850



to top

>gb|AC162921.3| Mus musculus BAC clone RP23-342H1 from chromosome 9, complete sequence
          Length = 254666

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 1      acacatactaaaaatgaaa 19
              |||||||||||||||||||
Sbjct: 212848 acacatactaaaaatgaaa 212866



 Score = 38.2 bits (19), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 47     agaaaatcagaaaggaaattaca 69
              ||||||||||||| |||||||||
Sbjct: 164057 agaaaatcagaaaagaaattaca 164035



to top

>emb|AL773580.11| Mouse DNA sequence from clone RP23-26G3 on chromosome X, complete
             sequence
          Length = 210533

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 12    aaatgaaaagggaaacaaa 30
             |||||||||||||||||||
Sbjct: 69646 aaatgaaaagggaaacaaa 69664



to top

>emb|AL672271.9| Mouse DNA sequence from clone RP23-450H23 on chromosome X, complete
             sequence
          Length = 196613

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    aaaaatgaaaagggaaaca 28
             |||||||||||||||||||
Sbjct: 83124 aaaaatgaaaagggaaaca 83142



to top

>emb|AL645930.15| Mouse DNA sequence from clone RP23-434L7 on chromosome 3, complete
              sequence
          Length = 227993

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 66     tacacatatatgtatatgc 84
              |||||||||||||||||||
Sbjct: 174818 tacacatatatgtatatgc 174800



to top

>emb|AL807763.7| Mouse DNA sequence from clone RP23-28B24 on chromosome 4, complete
              sequence
          Length = 219463

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 12     aaatgaaaagggaaacaaa 30
              |||||||||||||||||||
Sbjct: 184853 aaatgaaaagggaaacaaa 184835



to top

>emb|AL929066.7| Mouse DNA sequence from clone RP23-68E1 on chromosome 2, complete
             sequence
          Length = 210907

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    aaaaatgaaaagggaaaca 28
             |||||||||||||||||||
Sbjct: 14267 aaaaatgaaaagggaaaca 14249



to top

>gb|AC101299.16| Mus musculus chromosome 1, clone RP23-103M17, complete sequence
          Length = 164091

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 64     attacacatatatgtatat 82
              |||||||||||||||||||
Sbjct: 122589 attacacatatatgtatat 122571



to top

>emb|AL627432.26| Mouse DNA sequence from clone RP23-45I5 on chromosome X, complete
            sequence
          Length = 127007

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 12   aaatgaaaagggaaacaaa 30
            |||||||||||||||||||
Sbjct: 8653 aaatgaaaagggaaacaaa 8671


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,643,144
Number of Sequences: 3902068
Number of extensions: 2643144
Number of successful extensions: 292384
Number of sequences better than 10.0: 241
Number of HSP's better than 10.0 without gapping: 239
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 290681
Number of HSP's gapped (non-prelim): 1705
length of query: 117
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 96
effective length of database: 17,151,101,840
effective search space: 1646505776640
effective search space used: 1646505776640
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top