ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart15e06
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_197741.1| Oryza sativa (japonica cultivar-group) putative... 107 3e-20
2gb|AC079874.21| Oryza sativa chromosome 10 BAC OSJNBa0042H09 gen... 107 3e-20
3gb|AC079890.13| Oryza sativa chromosome 10 BAC OSJNBb0089A17 gen... 107 3e-20
4dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 107 3e-20
5gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 107 3e-20
6gb|AF448789.1| Zea mays DREB-like protein (dreb1) mRNA, complete... 92 2e-15
7gb|AF493799.1| Zea mays DRE binding factor 2 (dbf2) mRNA, comple... 84 4e-13
8gb|AY022718.1| Oryza sativa microsatellite MRG5043 containing (C... 66 9e-08
9ref|XM_473415.1| Oryza sativa (japonica cultivar-group), predic... 46 0.083
10gb|AC091611.5| Homo sapiens chromosome 1 clone RP11-369L17, comp... 46 0.083
11emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4,... 46 0.083
12dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.083
13ref|XM_560232.1| Anopheles gambiae str. PEST ENSANGP00000026270 ... 46 0.083
14dbj|AK108473.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.083
15gb|AY258282.1| Oryza sativa (japonica cultivar-group) CR251 tran... 46 0.083
16ref|XM_542298.2| PREDICTED: Canis familiaris similar to Leucine-... 44 0.33
17emb|AL390857.7| Human DNA sequence from clone RP11-51N22 on chro... 44 0.33
18gb|AY070912.1| Drosophila melanogaster RE02355 full insert cDNA 44 0.33
19gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome 44 0.33
20ref|NM_136573.2| Drosophila melanogaster MrgBP CG13746-RA (MrgBP... 44 0.33
21gb|AC007471.4|AC007471 Drosophila melanogaster, chromosome 2R, r... 44 0.33
22gb|AC093904.3| Homo sapiens BAC clone RP11-734K21 from 2, comple... 44 0.33
23gb|AY104522.1| Zea mays PCO077650 mRNA sequence 44 0.33
24gb|AE003835.4| Drosophila melanogaster chromosome 2R, section 15... 44 0.33
25gb|L28751.1|DRODGGA Drosophila melanogaster G protein gamma subu... 44 0.33
26gb|AC183546.3| Pan troglodytes BAC clone CH251-245P24 from chrom... 42 1.3
27gb|AC004097.1|HUAC004097 Human Chromosome 16 BAC clone CIT987SK-... 42 1.3
28emb|AL606623.3|OSJN00053 Oryza sativa genomic DNA, chromosome 4,... 42 1.3
29gb|AC093298.3| Homo sapiens chromosome 5 clone RP11-543L14, comp... 42 1.3
30gb|AC023983.11| Homo sapiens chromosome 18, clone RP11-621L6, co... 42 1.3
31gb|AC012410.10| Homo sapiens chromosome 8, clone RP11-354A3, com... 42 1.3
32gb|AC026720.6| Homo sapiens chromosome 5 clone CTD-2193G21, comp... 42 1.3
33gb|AC008693.9| Homo sapiens chromosome 5 clone CTB-69A13, comple... 42 1.3
34gb|AC016080.5|AC016080 Homo sapiens, clone RP11-23N14, complete ... 42 1.3
35dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.3
36gb|AC079298.8| Homo sapiens BAC clone RP11-9N12 from 4, complete... 42 1.3
37gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome 42 1.3
38dbj|AP005846.2| Oryza sativa (japonica cultivar-group) genomic D... 42 1.3
39gb|AC107293.4| Homo sapiens Xp BAC RP11-436D22 (Roswell Park Can... 42 1.3
40gb|AF182374.6| Bradyrhizobium sp. ORS278 photosynthetic gene clu... 40 5.1
41gb|AC146113.3| Pan troglodytes BAC clone RP43-5I6 from 7, comple... 40 5.1
42ref|XM_904787.2| PREDICTED: Mus musculus similar to Leucine-rich... 40 5.1
43gb|AC113114.9| Mus musculus chromosome 17, clone RP23-338H10, co... 40 5.1
44gb|AC006319.3| Homo sapiens PAC clone RP5-837C9 from 7, complete... 40 5.1
45gb|AC015983.7| Homo sapiens BAC clone RP11-560I19 from 7, comple... 40 5.1
46gb|AC145816.1| Pan troglodytes BAC clone RP43-6A13 from 7, compl... 40 5.1
47gb|AC146068.2| Pan troglodytes BAC clone RP43-60N22 from 7, comp... 40 5.1
48gb|AC109612.22| Mus musculus strain C57BL/6J clone rp23-37i3 map... 40 5.1
49gb|AC151481.4| Medicago truncatula clone mth2-3m11, complete seq... 40 5.1
50emb|AL356974.8| Human DNA sequence from clone RP11-14M11 on chro... 40 5.1
51emb|AL161722.9| Human DNA sequence from clone RP11-497J7 on chro... 40 5.1
52emb|AL157387.9| Human DNA sequence from clone RP11-20F24 on chro... 40 5.1
53gb|AC129980.6| Homo sapiens chromosome 15, clone CTD-2529M12, co... 40 5.1
54emb|BX640443.1| Bordetella bronchiseptica strain RB50, complete ... 40 5.1
55emb|BX640412.1| Bordetella pertussis strain Tohama I, complete g... 40 5.1
56emb|AL939106.1|SCO939106 Streptomyces coelicolor A3(2) complete ... 40 5.1
57gb|AC106789.2| Homo sapiens chromosome 5 clone RP11-371M22, comp... 40 5.1
58gb|AC104420.2| Homo sapiens chromosome 15, clone RP11-945A13, co... 40 5.1
59gb|AC113405.2| Homo sapiens chromosome 5 clone RP11-467C9, compl... 40 5.1
60gb|AC094088.3| Homo sapiens chromosome 5 clone CTD-2180L22, comp... 40 5.1
61gb|AC093156.2| Homo sapiens chromosome 1 clone RP11-87O11, compl... 40 5.1
62gb|AC022104.3|AC022104 Homo sapiens chromosome 5 clone CTC-257B1... 40 5.1
63gb|AC007560.4| Homo sapiens BAC clone RP11-386G20 from 2, comple... 40 5.1
64gb|AC023795.18| Homo sapiens 12 BAC RP11-242B24 (Roswell Park Ca... 40 5.1
65gb|AC005095.2|AC005095 Homo sapiens BAC clone CTA-332P12 from 7q... 40 5.1
66gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c... 40 5.1
67emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome 40 5.1
68gb|DQ278492.1| Lysobacter lactamgenus nonribosomal peptide synth... 40 5.1 
>ref|NM_197741.1| Oryza sativa (japonica cultivar-group) putative DNA binding protein
           (OSJNBa0042H09.12), mRNA
          Length = 870

 Score =  107 bits (54), Expect = 3e-20
 Identities = 119/140 (85%), Gaps = 3/140 (2%)
 Strand = Plus / Minus

                                                                       
Query: 213 tcccaaaggagtggctcctcgagccggaggtctgcattgacctcctcgacgtcggggagc 272
           |||||||| | ||||||||| |||||||| || ||||||||||| |||||||||| ||||
Sbjct: 848 tcccaaagcaatggctcctcaagccggagctccgcattgacctcgtcgacgtcggcgagc 789

                                                                       
Query: 273 ggagcccacatggtggagaacccgaa---cccgtcctcgatgtccatgagcaggtccggc 329
           || |||||||| |  | |||||||||   |||||||| |||||| |  |||| |||||||
Sbjct: 788 ggcgcccacatcgccgggaacccgaacggcccgtcctggatgtcgaacagcaagtccggc 729

                               
Query: 330 aggtcgaacagctgcagctc 349
           ||||||||||||||| ||||
Sbjct: 728 aggtcgaacagctgctgctc 709
to top
>gb|AC079874.21| Oryza sativa chromosome 10 BAC OSJNBa0042H09 genomic sequence, complete
             sequence
          Length = 144191

 Score =  107 bits (54), Expect = 3e-20
 Identities = 119/140 (85%), Gaps = 3/140 (2%)
 Strand = Plus / Minus

                                                                         
Query: 213   tcccaaaggagtggctcctcgagccggaggtctgcattgacctcctcgacgtcggggagc 272
             |||||||| | ||||||||| |||||||| || ||||||||||| |||||||||| ||||
Sbjct: 29978 tcccaaagcaatggctcctcaagccggagctccgcattgacctcgtcgacgtcggcgagc 29919

                                                                         
Query: 273   ggagcccacatggtggagaacccgaa---cccgtcctcgatgtccatgagcaggtccggc 329
             || |||||||| |  | |||||||||   |||||||| |||||| |  |||| |||||||
Sbjct: 29918 ggcgcccacatcgccgggaacccgaacggcccgtcctggatgtcgaacagcaagtccggc 29859

                                 
Query: 330   aggtcgaacagctgcagctc 349
             ||||||||||||||| ||||
Sbjct: 29858 aggtcgaacagctgctgctc 29839
to top
>gb|AC079890.13| Oryza sativa chromosome 10 BAC OSJNBb0089A17 genomic sequence, complete
             sequence
          Length = 132927

 Score =  107 bits (54), Expect = 3e-20
 Identities = 119/140 (85%), Gaps = 3/140 (2%)
 Strand = Plus / Plus

                                                                         
Query: 213   tcccaaaggagtggctcctcgagccggaggtctgcattgacctcctcgacgtcggggagc 272
             |||||||| | ||||||||| |||||||| || ||||||||||| |||||||||| ||||
Sbjct: 11984 tcccaaagcaatggctcctcaagccggagctccgcattgacctcgtcgacgtcggcgagc 12043

                                                                         
Query: 273   ggagcccacatggtggagaacccgaa---cccgtcctcgatgtccatgagcaggtccggc 329
             || |||||||| |  | |||||||||   |||||||| |||||| |  |||| |||||||
Sbjct: 12044 ggcgcccacatcgccgggaacccgaacggcccgtcctggatgtcgaacagcaagtccggc 12103

                                 
Query: 330   aggtcgaacagctgcagctc 349
             ||||||||||||||| ||||
Sbjct: 12104 aggtcgaacagctgctgctc 12123
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  107 bits (54), Expect = 3e-20
 Identities = 119/140 (85%), Gaps = 3/140 (2%)
 Strand = Plus / Plus

                                                                            
Query: 213      tcccaaaggagtggctcctcgagccggaggtctgcattgacctcctcgacgtcggggagc 272
                |||||||| | ||||||||| |||||||| || ||||||||||| |||||||||| ||||
Sbjct: 21580079 tcccaaagcaatggctcctcaagccggagctccgcattgacctcgtcgacgtcggcgagc 21580138

                                                                            
Query: 273      ggagcccacatggtggagaacccgaa---cccgtcctcgatgtccatgagcaggtccggc 329
                || |||||||| |  | |||||||||   |||||||| |||||| |  |||| |||||||
Sbjct: 21580139 ggcgcccacatcgccgggaacccgaacggcccgtcctggatgtcgaacagcaagtccggc 21580198

                                    
Query: 330      aggtcgaacagctgcagctc 349
                ||||||||||||||| ||||
Sbjct: 21580199 aggtcgaacagctgctgctc 21580218
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  107 bits (54), Expect = 3e-20
 Identities = 119/140 (85%), Gaps = 3/140 (2%)
 Strand = Plus / Plus

                                                                            
Query: 213      tcccaaaggagtggctcctcgagccggaggtctgcattgacctcctcgacgtcggggagc 272
                |||||||| | ||||||||| |||||||| || ||||||||||| |||||||||| ||||
Sbjct: 21591742 tcccaaagcaatggctcctcaagccggagctccgcattgacctcgtcgacgtcggcgagc 21591801

                                                                            
Query: 273      ggagcccacatggtggagaacccgaa---cccgtcctcgatgtccatgagcaggtccggc 329
                || |||||||| |  | |||||||||   |||||||| |||||| |  |||| |||||||
Sbjct: 21591802 ggcgcccacatcgccgggaacccgaacggcccgtcctggatgtcgaacagcaagtccggc 21591861

                                    
Query: 330      aggtcgaacagctgcagctc 349
                ||||||||||||||| ||||
Sbjct: 21591862 aggtcgaacagctgctgctc 21591881
to top
>gb|AF448789.1| Zea mays DREB-like protein (dreb1) mRNA, complete cds
          Length = 1388

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 128/154 (83%), Gaps = 6/154 (3%)
 Strand = Plus / Minus

                                                                       
Query: 208 gctactcccaaaggagtggctcctcgagccggaggtctgcattgacc---tcctcgacgt 264
           ||||||||||||| || ||||||||||| || || || |||||||||   ||||| ||||
Sbjct: 903 gctactcccaaagcagcggctcctcgaggcgcagctccgcattgaccacctcctccacgt 844

                                                                       
Query: 265 cggggagcggagcccacatggtggagaa---cccgaacccgtcctcgatgtccatgagca 321
           | | |||||| |||||||| |  | |||   |||||||||||||  |||||| | |||||
Sbjct: 843 cagtgagcggggcccacatcggcgggaagcgcccgaacccgtcccggatgtcgaggagca 784

                                             
Query: 322 ggtccggcaggtcgaacagctgcagctcttcctc 355
           ||||||||||||||||||||||| |||| |||||
Sbjct: 783 ggtccggcaggtcgaacagctgccgctcgtcctc 750
to top
>gb|AF493799.1| Zea mays DRE binding factor 2 (dbf2) mRNA, complete cds
          Length = 1026

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 127/154 (82%), Gaps = 6/154 (3%)
 Strand = Plus / Minus

                                                                       
Query: 208 gctactcccaaaggagtggctcctcgagccggaggtctgcattgacc---tcctcgacgt 264
           |||| |||||||| || ||||||||||| || || || |||||||||   ||||| ||||
Sbjct: 907 gctattcccaaagcagcggctcctcgaggcgcagctccgcattgaccacatcctccacgt 848

                                                                       
Query: 265 cggggagcggagcccacatggtggagaa---cccgaacccgtcctcgatgtccatgagca 321
           | | |||||| |||||||| |  | |||   |||||||||||||  |||||| | |||||
Sbjct: 847 cagtgagcggggcccacatcggcgggaagcgcccgaacccgtcccggatgtcgaggagca 788

                                             
Query: 322 ggtccggcaggtcgaacagctgcagctcttcctc 355
           ||||||||||||||||||||||| |||| |||||
Sbjct: 787 ggtccggcaggtcgaacagctgccgctcgtcctc 754
to top
>gb|AY022718.1| Oryza sativa microsatellite MRG5043 containing (CCG)X9, genomic
           sequence
          Length = 227

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 80/95 (84%), Gaps = 3/95 (3%)
 Strand = Plus / Plus

                                                                       
Query: 258 tcgacgtcggggagcggagcccacatggtggagaacccgaac---ccgtcctcgatgtcc 314
           |||||||||| |||||| |||||||| |  | ||||||||||   ||||||| |||||| 
Sbjct: 4   tcgacgtcggcgagcggcgcccacatcgccgggaacccgaacggcccgtcctggatgtcg 63

                                              
Query: 315 atgagcaggtccggcaggtcgaacagctgcagctc 349
           |  |||| |||||||||||||||||||||| ||||
Sbjct: 64  aacagcaagtccggcaggtcgaacagctgctgctc 98
to top
>ref|XM_473415.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 654

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 311 gtccatgagcaggtccggcaggtcgaacagc 341
           ||||| |||||||||||| ||||||||||||
Sbjct: 540 gtccaggagcaggtccgggaggtcgaacagc 510
to top
>gb|AC091611.5| Homo sapiens chromosome 1 clone RP11-369L17, complete sequence
          Length = 198486

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 268    ggagcggagcccacatggtggagaacc 294
              |||| ||||||||||||||||||||||
Sbjct: 151780 ggagtggagcccacatggtggagaacc 151806
to top
>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17,
             complete sequence
          Length = 127259

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 311   gtccatgagcaggtccggcaggtcgaacagc 341
             ||||| |||||||||||| ||||||||||||
Sbjct: 37716 gtccaggagcaggtccgggaggtcgaacagc 37686
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                               
Query: 311      gtccatgagcaggtccggcaggtcgaacagc 341
                ||||| |||||||||||| ||||||||||||
Sbjct: 27513740 gtccaggagcaggtccgggaggtcgaacagc 27513710



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 15       tttcttttgcatatggatata 35
                |||||||||||||||||||||
Sbjct: 24145122 tttcttttgcatatggatata 24145142
to top
>ref|XM_560232.1| Anopheles gambiae str. PEST ENSANGP00000026270
           (ENSANGG00000023006), partial mRNA
          Length = 1290

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 353 ctcgtcggcctgctcagcggcgccgcc 379
           |||| ||||||||||||||||||||||
Sbjct: 955 ctcgccggcctgctcagcggcgccgcc 981
to top
>dbj|AK108473.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-143-E08, full
           insert sequence
          Length = 988

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 311 gtccatgagcaggtccggcaggtcgaacagc 341
           ||||| |||||||||||| ||||||||||||
Sbjct: 585 gtccaggagcaggtccgggaggtcgaacagc 555
to top
>gb|AY258282.1| Oryza sativa (japonica cultivar-group) CR251 transcription factor
           gene, complete cds
          Length = 692

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 311 gtccatgagcaggtccggcaggtcgaacagc 341
           ||||| |||||||||||| ||||||||||||
Sbjct: 578 gtccaggagcaggtccgggaggtcgaacagc 548
to top
>ref|XM_542298.2| PREDICTED: Canis familiaris similar to Leucine-rich
           repeat-containing protein 32 precursor (GARP protein)
           (Garpin) (Glycoprotein A repetitions predominant)
           (LOC485180), mRNA
          Length = 2022

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 300 ccgtcctcgatgtccatgagca 321
           ||||||||||||||||||||||
Sbjct: 671 ccgtcctcgatgtccatgagca 650
to top
>emb|AL390857.7| Human DNA sequence from clone RP11-51N22 on chromosome 13 Contains a
              heterogeneous nuclear ribonucleoprotein A1 (HNRPA1)
              pseudogene and a novel pseudogene (KIAA1935 FLJ31359),
              complete sequence
          Length = 154273

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 14     ctttcttttgcatatggatata 35
              ||||||||||||||||||||||
Sbjct: 146639 ctttcttttgcatatggatata 146660
to top
>gb|AY070912.1| Drosophila melanogaster RE02355 full insert cDNA
          Length = 766

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 335 gaacagctgcagctcttcctcg 356
           ||||||||||||||||||||||
Sbjct: 162 gaacagctgcagctcttcctcg 141
to top
>gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome
          Length = 3665893

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 345     agctcttcctcgtcggcctgct 366
               ||||||||||||||||||||||
Sbjct: 1458252 agctcttcctcgtcggcctgct 1458231
to top
>ref|NM_136573.2| Drosophila melanogaster MrgBP CG13746-RA (MrgBP), mRNA
          Length = 758

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 335 gaacagctgcagctcttcctcg 356
           ||||||||||||||||||||||
Sbjct: 167 gaacagctgcagctcttcctcg 146
to top
>gb|AC007471.4|AC007471 Drosophila melanogaster, chromosome 2R, region 44F-45A, BAC clone
             BACR02C23, complete sequence
          Length = 168601

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 335   gaacagctgcagctcttcctcg 356
             ||||||||||||||||||||||
Sbjct: 94269 gaacagctgcagctcttcctcg 94290
to top
>gb|AC093904.3| Homo sapiens BAC clone RP11-734K21 from 2, complete sequence
          Length = 191827

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 16     ttcttttgcatatggatatatc 37
              ||||||||||||||||||||||
Sbjct: 141160 ttcttttgcatatggatatatc 141181
to top
>gb|AY104522.1| Zea mays PCO077650 mRNA sequence
          Length = 1833

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 352 cctcgtcggcctgctcagcggcgccg 377
           ||||||||||||||| ||||||||||
Sbjct: 697 cctcgtcggcctgctgagcggcgccg 722
to top
>gb|AE003835.4| Drosophila melanogaster chromosome 2R, section 15 of 73 of the complete
              sequence
          Length = 271696

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 335    gaacagctgcagctcttcctcg 356
              ||||||||||||||||||||||
Sbjct: 107389 gaacagctgcagctcttcctcg 107410
to top
>gb|L28751.1|DRODGGA Drosophila melanogaster G protein gamma subunit gene, exon 1
          Length = 1250

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 335 gaacagctgcagctcttcctcg 356
           ||||||||||||||||||||||
Sbjct: 125 gaacagctgcagctcttcctcg 146
to top
>gb|AC183546.3| Pan troglodytes BAC clone CH251-245P24 from chromosome 2, complete
             sequence
          Length = 202850

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 14    ctttcttttgcatatggatat 34
             |||||||||||||||||||||
Sbjct: 85995 ctttcttttgcatatggatat 86015
to top
>gb|AC004097.1|HUAC004097 Human Chromosome 16 BAC clone CIT987SK-A-161G4, complete sequence
          Length = 87077

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 14    ctttcttttgcatatggatat 34
             |||||||||||||||||||||
Sbjct: 28146 ctttcttttgcatatggatat 28126
to top
>emb|AL606623.3|OSJN00053 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0081L15,
             complete sequence
          Length = 150864

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 15    tttcttttgcatatggatata 35
             |||||||||||||||||||||
Sbjct: 34347 tttcttttgcatatggatata 34367
to top
>gb|AC093298.3| Homo sapiens chromosome 5 clone RP11-543L14, complete sequence
          Length = 198687

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 14    ctttcttttgcatatggatat 34
             |||||||||||||||||||||
Sbjct: 91520 ctttcttttgcatatggatat 91500
to top
>gb|AC023983.11| Homo sapiens chromosome 18, clone RP11-621L6, complete sequence
          Length = 190225

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 14    ctttcttttgcatatggatat 34
             |||||||||||||||||||||
Sbjct: 21932 ctttcttttgcatatggatat 21912
to top
>gb|AC012410.10| Homo sapiens chromosome 8, clone RP11-354A3, complete sequence
          Length = 220715

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 14    ctttcttttgcatatggatat 34
             |||||||||||||||||||||
Sbjct: 47049 ctttcttttgcatatggatat 47069
to top
>gb|AC026720.6| Homo sapiens chromosome 5 clone CTD-2193G21, complete sequence
          Length = 151090

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 14    ctttcttttgcatatggatat 34
             |||||||||||||||||||||
Sbjct: 36898 ctttcttttgcatatggatat 36878
to top
>gb|AC008693.9| Homo sapiens chromosome 5 clone CTB-69A13, complete sequence
          Length = 203568

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 14    ctttcttttgcatatggatat 34
             |||||||||||||||||||||
Sbjct: 10354 ctttcttttgcatatggatat 10334
to top
>gb|AC016080.5|AC016080 Homo sapiens, clone RP11-23N14, complete sequence
          Length = 176921

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 14     ctttcttttgcatatggatat 34
              |||||||||||||||||||||
Sbjct: 152758 ctttcttttgcatatggatat 152738
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 15      tttcttttgcatatggatata 35
               |||||||||||||||||||||
Sbjct: 6501708 tttcttttgcatatggatata 6501688
to top
>gb|AC079298.8| Homo sapiens BAC clone RP11-9N12 from 4, complete sequence
          Length = 200822

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 16    ttcttttgcatatggatatat 36
             |||||||||||||||||||||
Sbjct: 52059 ttcttttgcatatggatatat 52039
to top
>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome
          Length = 3052398

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 319    gcaggtccggcaggtcgaaca 339
              |||||||||||||||||||||
Sbjct: 511989 gcaggtccggcaggtcgaaca 511969
to top
>dbj|AP005846.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1307A11
          Length = 131538

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 15    tttcttttgcatatggatata 35
             |||||||||||||||||||||
Sbjct: 62321 tttcttttgcatatggatata 62301
to top
>gb|AC107293.4| Homo sapiens Xp BAC RP11-436D22 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 156250

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 14    ctttcttttgcatatggatat 34
             |||||||||||||||||||||
Sbjct: 59020 ctttcttttgcatatggatat 59000
to top
>gb|AF182374.6| Bradyrhizobium sp. ORS278 photosynthetic gene cluser, complete
            sequence; and bacteriophytochrome (bphP), PpsR protein
            (ppsR), cytochrome C2 (cycA), geranylgeranyl
            bacteriochlorophyll reductase (bchP), light harvesting
            pigment major facilitator family (bch2),
            geranylgeranyl-bacteriochlorophyll synthetase (bchG),
            PpsR1 (ppsR1), and transcriptional regulator, AerR (aerR)
            genes, complete cds; and 2-vinyl bacteriochlorophillide
            hydratase BchF subunit (bchF) gene, partial cds
          Length = 30040

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 324  tccggcaggtcgaacagctgcagc 347
            |||||||| |||||||||||||||
Sbjct: 7995 tccggcagatcgaacagctgcagc 7972
to top
>gb|AC146113.3| Pan troglodytes BAC clone RP43-5I6 from 7, complete sequence
          Length = 223155

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 16     ttcttttgcatatggatata 35
              ||||||||||||||||||||
Sbjct: 120010 ttcttttgcatatggatata 119991
to top
>ref|XM_904787.2| PREDICTED: Mus musculus similar to Leucine-rich repeat-containing
           protein 32 precursor (GARP protein) (Garpin)
           (Glycoprotein A repetitions predominant) (LOC631087),
           mRNA
          Length = 2328

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 300 ccgtcctcgatgtccatgag 319
           ||||||||||||||||||||
Sbjct: 911 ccgtcctcgatgtccatgag 892
to top
>gb|AC113114.9| Mus musculus chromosome 17, clone RP23-338H10, complete sequence
          Length = 183828

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 160    ttaagtactcctagtatatt 179
              ||||||||||||||||||||
Sbjct: 166606 ttaagtactcctagtatatt 166625
to top
>gb|AC006319.3| Homo sapiens PAC clone RP5-837C9 from 7, complete sequence
          Length = 85821

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 15    tttcttttgcatatggatat 34
             ||||||||||||||||||||
Sbjct: 78964 tttcttttgcatatggatat 78945
to top
>gb|AC015983.7| Homo sapiens BAC clone RP11-560I19 from 7, complete sequence
          Length = 177476

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 16    ttcttttgcatatggatata 35
             ||||||||||||||||||||
Sbjct: 17892 ttcttttgcatatggatata 17911
to top
>gb|AC145816.1| Pan troglodytes BAC clone RP43-6A13 from 7, complete sequence
          Length = 200683

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 15    tttcttttgcatatggatat 34
             ||||||||||||||||||||
Sbjct: 35986 tttcttttgcatatggatat 35967
to top
>gb|AC146068.2| Pan troglodytes BAC clone RP43-60N22 from 7, complete sequence
          Length = 143042

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 16     ttcttttgcatatggatata 35
              ||||||||||||||||||||
Sbjct: 120015 ttcttttgcatatggatata 119996
to top
>gb|AC109612.22| Mus musculus strain C57BL/6J clone rp23-37i3 map 17, complete sequence
          Length = 179382

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 160    ttaagtactcctagtatatt 179
              ||||||||||||||||||||
Sbjct: 163854 ttaagtactcctagtatatt 163835
to top
>gb|AC151481.4| Medicago truncatula clone mth2-3m11, complete sequence
          Length = 99012

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 17    tcttttgcatatggatatat 36
             ||||||||||||||||||||
Sbjct: 98267 tcttttgcatatggatatat 98248
to top
>emb|AL356974.8| Human DNA sequence from clone RP11-14M11 on chromosome 1, complete
             sequence
          Length = 72013

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 16    ttcttttgcatatggatata 35
             ||||||||||||||||||||
Sbjct: 54080 ttcttttgcatatggatata 54099
to top
>emb|AL161722.9| Human DNA sequence from clone RP11-497J7 on chromosome X Contains a
             melanoma antigen family B 4 pseudogene and a nuclear
             transcription factor Y, gamma (NFYC) pseudogene, complete
             sequence
          Length = 154594

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 15    tttcttttgcatatggatat 34
             ||||||||||||||||||||
Sbjct: 77927 tttcttttgcatatggatat 77908
to top
>emb|AL157387.9| Human DNA sequence from clone RP11-20F24 on chromosome 10p11.21-12.1
             Contains the 3' end of the NY-BR-1 gene for breast cancer
             antigen NY-BR-1, two novel genes, a pseudogene similar to
             part of ATP8A2 (ATPase, aminophospholipid
             transporter-like, Class I, type 8A, member 2), a novel
             pseudogene and a vomeronasal receptor pseudogene, complete
             sequence
          Length = 149730

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 15    tttcttttgcatatggatat 34
             ||||||||||||||||||||
Sbjct: 10326 tttcttttgcatatggatat 10345
to top
>gb|AC129980.6| Homo sapiens chromosome 15, clone CTD-2529M12, complete sequence
          Length = 236391

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 15    tttcttttgcatatggatat 34
             ||||||||||||||||||||
Sbjct: 70624 tttcttttgcatatggatat 70605
to top
>emb|BX640443.1| Bordetella bronchiseptica strain RB50, complete genome; segment 7/16
          Length = 346274

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 334    cgaacagctgcagctcttcc 353
              ||||||||||||||||||||
Sbjct: 251238 cgaacagctgcagctcttcc 251257
to top
>emb|BX640412.1| Bordetella pertussis strain Tohama I, complete genome; segment 2/12
          Length = 348171

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 334    cgaacagctgcagctcttcc 353
              ||||||||||||||||||||
Sbjct: 172917 cgaacagctgcagctcttcc 172936
to top
>emb|AL939106.1|SCO939106 Streptomyces coelicolor A3(2) complete genome; segment 3/29
          Length = 314100

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 357    tcggcctgctcagcggcgccgccg 380
              ||||||||||||||||| ||||||
Sbjct: 158292 tcggcctgctcagcggcaccgccg 158269
to top
>gb|AC106789.2| Homo sapiens chromosome 5 clone RP11-371M22, complete sequence
          Length = 115165

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 16    ttcttttgcatatggatata 35
             ||||||||||||||||||||
Sbjct: 31953 ttcttttgcatatggatata 31972
to top
>gb|AC104420.2| Homo sapiens chromosome 15, clone RP11-945A13, complete sequence
          Length = 178756

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 15    tttcttttgcatatggatat 34
             ||||||||||||||||||||
Sbjct: 16340 tttcttttgcatatggatat 16359
to top
>gb|AC113405.2| Homo sapiens chromosome 5 clone RP11-467C9, complete sequence
          Length = 134319

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 15    tttcttttgcatatggatat 34
             ||||||||||||||||||||
Sbjct: 93958 tttcttttgcatatggatat 93977
to top
>gb|AC094088.3| Homo sapiens chromosome 5 clone CTD-2180L22, complete sequence
          Length = 80091

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 16    ttcttttgcatatggatata 35
             ||||||||||||||||||||
Sbjct: 64836 ttcttttgcatatggatata 64855
to top
>gb|AC093156.2| Homo sapiens chromosome 1 clone RP11-87O11, complete sequence
          Length = 198846

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 14     ctttcttttgcatatggata 33
              ||||||||||||||||||||
Sbjct: 151383 ctttcttttgcatatggata 151402
to top
>gb|AC022104.3|AC022104 Homo sapiens chromosome 5 clone CTC-257B12, complete sequence
          Length = 160703

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 15     tttcttttgcatatggatat 34
              ||||||||||||||||||||
Sbjct: 125297 tttcttttgcatatggatat 125278
to top
>gb|AC007560.4| Homo sapiens BAC clone RP11-386G20 from 2, complete sequence
          Length = 124185

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 17    tcttttgcatatggatatat 36
             ||||||||||||||||||||
Sbjct: 73415 tcttttgcatatggatatat 73396
to top
>gb|AC023795.18| Homo sapiens 12 BAC RP11-242B24 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 161838

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 16    ttcttttgcatatggatata 35
             ||||||||||||||||||||
Sbjct: 19605 ttcttttgcatatggatata 19624
to top
>gb|AC005095.2|AC005095 Homo sapiens BAC clone CTA-332P12 from 7q22-q31.1, complete sequence
          Length = 119937

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 13     actttcttttgcatatggatatat 36
              ||||| ||||||||||||||||||
Sbjct: 110098 acttttttttgcatatggatatat 110121
to top
>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 344     cagctcttcctcgtcggcctgctc 367
               |||||| |||||||||||||||||
Sbjct: 2605053 cagctcgtcctcgtcggcctgctc 2605030
to top
>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome
          Length = 2595221

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 346    gctcttcctcgtcggcctgc 365
              ||||||||||||||||||||
Sbjct: 684648 gctcttcctcgtcggcctgc 684667
to top
>gb|DQ278492.1| Lysobacter lactamgenus nonribosomal peptide synthetase - polyketide
            synthase hybrid (cpbI) gene, complete cds
          Length = 15150

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 319  gcaggtccggcaggtcgaac 338
            ||||||||||||||||||||
Sbjct: 7762 gcaggtccggcaggtcgaac 7743


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,613,851
Number of Sequences: 3902068
Number of extensions: 2613851
Number of successful extensions: 52479
Number of sequences better than 10.0: 68
Number of HSP's better than 10.0 without gapping: 69
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 52112
Number of HSP's gapped (non-prelim): 362
length of query: 385
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 363
effective length of database: 17,147,199,772
effective search space: 6224433517236
effective search space used: 6224433517236
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top