ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart14e06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY157498.1| Synechococcus sp. PCC 7942 cosmid 4G8, complete s... 1158 0.0
2dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete g... 1158 0.0
3gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome 1158 0.0
4emb|AJ312391.1|CTR312391 Chloroplast transformation vector pRB70 100 1e-17
5gb|U25061.1|XXU25061 Cloning vector pBBR1MCS-5 REP, LacZ alpha p... 94 7e-16
6gb|U25060.1|XXU25060 Cloning vector pBBR1MCS-4 REP, LacZ alpha p... 94 7e-16
7gb|U25059.1|XXU25059 Cloning vector pBBR1MCS-3 REP and LacZ alph... 94 7e-16
8gb|U23751.1|CVU23751 Cloning vector pBBR1MCS-2 plasmid pBBR1MCS-... 94 7e-16
9gb|U02374.1|XXU02374 Cloning vector pBBR1MCS plasmid pBBR1MCS, c... 94 7e-16
10gb|AY827555.1| Shuttle vector pNAK1, complete sequence 94 7e-16
11gb|DQ228131.1| Moss transformation vector pMBL6, complete sequence 94 7e-16
12gb|DQ228130.1| Moss transformation vector pMBL5, complete sequence 94 7e-16
13gb|DQ230324.1| Shuttle vector pMQ61, complete sequence 94 7e-16
14gb|DQ230323.1| Shuttle vector pMQ52, complete sequence 94 7e-16
15gb|DQ230322.1| Shuttle vector pMQ51, complete sequence 94 7e-16
16gb|AY456904.1| Binary vector pRE1, complete sequence 94 7e-16
17gb|AY672109.3| Bursa aurealis delivery vector pBursa, complete s... 94 7e-16
18gb|DQ490965.1| Mutant Zea mays clone pGR25C22 disrupted DOF1 (Do... 94 7e-16
19gb|AY423865.1| Cloning vector pMK2017, complete sequence 94 7e-16
20gb|AY557621.1| Shuttle vector pELS200, complete sequence 94 7e-16
21gb|M32616.1|SYNDROCL Cloning vector pHS85 heat-shock protein 82/... 94 7e-16
22gb|AY150810.1| Cloning vector pRS327, complete sequence 94 7e-16
23gb|AY150809.1| Cloning vector pRS317, complete sequence 94 7e-16
24gb|AY150808.1| Cloning vector pRS307, complete sequence 94 7e-16
25emb|AJ508373.1|FHE508373 Fasciola hepatica microsatellite DNA, c... 94 7e-16
26emb|AJ417488.2|SIN417488 Shuttle integration vector pPL1 94 7e-16
27emb|AJ417449.2|SIN417449 Shuttle integration vector pPL2 94 7e-16
28gb|AF251497.1| Cloning vector HKBS1, complete sequence 94 7e-16
29gb|AF187996.1| Promoter probe vector pPR9TT, complete sequence 94 7e-16
30gb|AF140579.1| Integration vector mini-CTX-lacZ, complete sequence 94 7e-16
31gb|AF140577.1| Integration vector mini-CTX2, complete sequence 94 7e-16
32gb|AF140576.1| Integration vector mini-CTX1, complete sequence 94 7e-16
33gb|L25927.1|YSPSEQA Shuttle vector pJK148, complete sequence 94 7e-16
34gb|DQ452049.1| Binary vector pGPro1, complete sequence 94 7e-16
35gb|AY115560.1| Transposon delivery vector pSC189, complete sequence 94 7e-16
36gb|AD001531.1|SYNPGR8V Cloning vector pGR8, complete sequence 94 7e-16
37gb|AY301066.1| Transposition vector RescueMu, complete sequence 94 7e-16
38gb|AY291460.1| Shuttle vector pNG168, complete sequence 94 7e-16
39gb|L25928.3|YSPSEQB Shuttle vector pJK210, complete sequence 94 7e-16
40emb|AJ278283.1|ACL278283 Cloning vector pBRINT-TsKm 94 7e-16
41emb|AJ278282.1|ACL278282 Cloning vector pBRINT-TsGm 94 7e-16
42emb|AJ278281.1|ACL278281 Cloning vector pBRINT-TsCm 94 7e-16
43emb|AJ278280.1|CVE278280 Cloning vector pBRINTs-Kan2 94 7e-16
44emb|AJ278279.1|CVE278279 Cloning vector pBRINTs-Gen4 94 7e-16
45emb|AJ278278.1|CVE278278 Cloning vector pBRINTs-Cat2 94 7e-16
46emb|AJ277653.1|ECO277653 Escherichia coli plasmid pGBG1 94 7e-16
47emb|AJ277560.1|LES277560 Lycopersicon esculentum partial mRNA fo... 94 7e-16
48emb|AJ277471.1|OSA277471 Oryza sativa rbbi2-4 gene for putative ... 94 7e-16
49emb|AJ277206.1|CSI277206 Camellia sinensis gene for s-adenosylme... 94 7e-16
50emb|AJ237707.1|YLI237707 Yarrowia lipolytica odc gene for ornith... 94 7e-16
51emb|AJ868289.1| Transconjugation plasmid pBMK1 94 7e-16
52gb|AY733072.1| Cloning vector pSW29, complete sequence 94 7e-16
53gb|AY733065.1| Cloning vector pSW23, complete sequence 94 7e-16
54emb|AJ416708.1|PDE416708 Populus deltoides MER locus, genomic DN... 94 7e-16
55gb|AF531173.1| Cloning vector pDblet, complete sequence 94 7e-16
56gb|AF504908.1| Cloning vector pBBRT, complete sequence 94 7e-16
57dbj|AB114435.1| Pseudorasbora parva DNA, microsatelite marker PA19 94 7e-16
58gb|AF402295.1| pk[BIG-alpha] piggyBac transformation vector, com... 94 7e-16
59gb|DQ236098.1| Himar1-delivery and mutagenesis vector pFNLTP16 H... 94 7e-16
60gb|AF309798.1|AF309798 Clupea pallasi microsatellite Cha134 sequ... 94 7e-16
61gb|AF309795.1|AF309795 Clupea pallasi microsatellite Cha120 sequ... 94 7e-16
62gb|AF309794.1|AF309794 Clupea pallasi microsatellite Cha115 sequ... 94 7e-16
63gb|AF309793.1|AF309793 Clupea pallasi microsatellite Cha113 sequ... 94 7e-16
64gb|AF309790.1|AF309790 Clupea pallasi microsatellite Cha100 sequ... 94 7e-16
65gb|AF519494.1| Shuttle vector pSpcP-lac, complete sequence 94 7e-16
66gb|AF411123.1|AF411123 Transposon vector phiMycoMarT7, complete ... 94 7e-16
67gb|AF174133.1|AF174133 Cloning vector pRS4213, complete sequence 94 7e-16
68gb|AF174132.1|AF174132 Cloning vector pRS4210, complete sequence 94 7e-16
69gb|AF174131.1|AF174131 Cloning vector pRS4110, complete sequence 94 7e-16
70emb|AJ620495.1| Mus musculus partial mRNA for non-selective cati... 94 7e-16
71gb|AY237648.1| Cloning vector pHR50, complete sequence 94 7e-16
72gb|AY237649.1| Cloning vector pHR3-km, complete sequence 94 7e-16
73gb|U56995.1|U56995 Cloning vector pGreenscript A complete sequence 94 7e-16
74gb|AY008370.1| Glossina palpalis palpalis clone Pgp14 microsatel... 94 7e-16
75gb|AY008368.1| Glossina palpalis palpalis clone Pgp29 microsatel... 94 7e-16
76gb|AY034154.1| Cloning vector pIDN4, complete sequence 94 7e-16
77gb|AF517126.1| Cloning vector pSPC-lac, complete sequence 94 7e-16
78emb|AJ626721.1| Acetobacter pasteurianus partial ITS1, strain CC... 94 7e-16
79gb|AY785149.1| Cloning vector pFL122, complete sequence 94 7e-16
80gb|AY785148.1| Suicide plasmid pEE3, complete sequence 94 7e-16
81gb|AY237647.1| Cloning Vector pHRGFPGUS, complete sequence 94 7e-16
82gb|AF327894.1|AF327894 Cloning vector pExchange 1, complete sequ... 94 7e-16
83dbj|AB119275.1| Mus musculus GATA6 gene, exon 1 94 7e-16
84gb|AF309797.1|AF309797 Clupea pallasi microsatellite Cha128 sequ... 94 7e-16
85gb|U64449.2|CVU64449 Cloning vector pOPRSVIMCS from Lacswitch II... 94 7e-16
86gb|AY196821.1| PiggyBac helper plasmid pBlu-uTp, complete sequence 94 7e-16
87gb|AF178453.1|AF178453 Integration vector pCD13PSK aminoglycosid... 94 7e-16
88gb|AF178452.1|AF178452 Integration vector pCD13PKS aminoglycosid... 94 7e-16
89gb|AF178450.1|AF178450 Integration vector pCD11PSK chloramphenic... 94 7e-16
90gb|AF178449.1|AF178449 Integration vector pCD11PKS chloramphenic... 94 7e-16
91dbj|AB005559.1| Mus musculus DNA for cyclin G, complete cds 94 7e-16
92gb|AF153422.1|AF153422 Cloning vector pTG8, complete sequence 94 7e-16
93gb|M74016.1|YSCTRAM2 Cloning vector pYADE4 TRP1 and AMPr genes, ... 94 7e-16
94gb|L08785.1|SYNBLKSPV BlueScribe KS Plus cloning vector 94 7e-16
95gb|M22848.1|SYNPLKRB Cloning vector pUC129 DNA, polylinker region 94 7e-16
96gb|M22847.1|SYNPLKRA Cloning vector pUC128 DNA, polylinker region 94 7e-16
97emb|AJ277561.1|LES277561 Lycopersicon esculentum partial mRNA fo... 94 7e-16
98emb|X79425.1|ATAG4 A.thaliana microsatellite [repeated motif (tc)7] 94 7e-16
99gb|AF135243.1|MMFBLN2S06 Mus musculus fibulin-2 (Fbln2) gene, ex... 94 7e-16
100gb|U46018.1|CVU46018 Cloning vector pCRSCRIPT Cam, complete sequ... 94 7e-16
101gb|U46017.1|CVU46017 Cloning vector pCRSCRIPT SK[+], complete se... 94 7e-16
102gb|AF139061.1|AF139061 Binary vector pCB301, complete sequence 94 7e-16
103gb|AF092842.1|AF092842 Mycobacterium marinum G13 promoter construct 94 7e-16
104emb|X81813.1|SCCDC1 S.cerevisiae CDC1 gene 94 7e-16
105gb|AY568055.1| Cloning vector pAGRIKOLA, complete sequence 94 7e-16
106gb|AF071266.1|AF071266 Danio rerio homeobox protein (hoxc6b) gen... 94 7e-16
107gb|U47947.1|CVU47947 Cloning vector pGreenscript I, complete seq... 94 7e-16
108emb|AJ428509.1|MMU428509 Mus musculus partial NID-2 gene for nid... 94 7e-16
109emb|AJ428508.1|MMU428508 Mus musculus partial NID-2 gene for nid... 94 7e-16
110gb|U43955.1|XXU43955 Expression vector pBRz, complete cds 94 7e-16
111dbj|D85525.1|SYNPBEN66 Cloning vector pBEN66 DNA for aminoglycos... 94 7e-16
112emb|Y09374.1|ASPGREEN2 Artificial sequences, plasmid vector pGre... 94 7e-16
113gb|AY557620.1| Shuttle vector pELS100, complete sequence 94 7e-16
114emb|X52330.1|ARBL2SKM pBluescript II SK(-) vector DNA, phagemid ... 94 7e-16
115emb|X52329.1|ARBL2KSM pBluescript II KS(-) vector DNA, phagemid ... 94 7e-16
116emb|X52328.1|ARBL2SKP pBluescript II SK(+) vector DNA, phagemid ... 94 7e-16
117emb|X52327.1|ARBL2KSP pBluescript II KS(+) vector DNA, phagemid ... 94 7e-16
118emb|X52331.1|ARBLKSP pBluescript KS(+) vector DNA, phagemid exci... 94 7e-16
119emb|X52326.1|ARBLKSM pBluescript KS(-) vector DNA, phagemid exci... 94 7e-16
120emb|X52325.1|ARBLSKP pBluescript SK(+) vector DNA, phagemid exci... 94 7e-16
121emb|X52324.1|ARBLSKM pBluescript SK(-) vector DNA, phagemid exci... 94 7e-16
122emb|AJ403984.1|CVE403984 Cloning vector pBPSKan2 94 7e-16
123emb|AJ403983.1|CVE403983 Cloning vector pBPSGen4 94 7e-16
124emb|AJ403982.1|CVE403982 Cloning vector pBPSCat2 94 7e-16
125emb|AJ005330.1|ASAJ5330 pGAII(-) SK positive selection cloning v... 94 7e-16
126emb|AJ005329.1|ASAJ5329 pGAII(-) KS positive selection cloning v... 94 7e-16
127emb|AJ005327.1|ASAJ5327 pGAII(+) SK positive selection cloning v... 94 7e-16
128emb|AJ005326.1|ASAJ5326 pGAII(+) KS positive selection cloning v... 94 7e-16
129emb|AJ005324.1|ASAJ5324 pCP1(-) SK positive selection cloning ve... 94 7e-16
130emb|AJ005323.1|ASAJ5323 pCP1(-) KS positive selection cloning ve... 94 7e-16
131emb|AJ007829.1|CVE7829 Cloning Vector pGreen 94 7e-16
132emb|X93517.1|ECMSASB3 Equus caballus microsatellite DNA marker (... 94 7e-16
133emb|AM179852.1| Synthetic construct nptI gene for aminoglycoside... 94 7e-16
134emb|Z29381.1|ECMPZ004 Equus caballus (mpz006) microsatellite DNA 94 7e-16
135gb|DQ225752.1| Immobile Ac/T-DNA vector pNU400, complete sequence 94 7e-16
136gb|DQ225751.1| Immobile Ac/T-DNA vector pKU352NA, complete sequence 94 7e-16
137gb|U35235.1|XXU35235 Plasmid pBSL167 cloning vector, complete se... 94 7e-16
138gb|U35137.1|XXU35137 Plasmid pBSL99 cloning vector, complete seq... 94 7e-16
139gb|U35136.1|XXU35136 Plasmid pBSL97 cloning vector, complete seq... 94 7e-16
140gb|U35135.1|XXU35135 Plasmid pBSL193 cloning vector, complete se... 94 7e-16
141gb|U35134.1|XXU35134 Plasmid pBSL190 cloning vector, complete se... 94 7e-16
142gb|U35133.1|XXU35133 Plasmid pBSL175 cloning vector, complete se... 94 7e-16
143gb|U35132.1|XXU35132 Plasmid pBSL168 cloning vector, complete se... 94 7e-16
144gb|U35131.1|XXU35131 Plasmid pBSL159 cloning vector, complete se... 94 7e-16
145gb|U35130.1|XXU35130 Plasmid pBSL142 cloning vector, complete se... 94 7e-16
146gb|U35129.1|XXU35129 Plasmid pBSL141 cloning vector, complete se... 94 7e-16
147gb|U35128.1|XXU35128 Plasmid pBSL130 cloning vector, complete se... 94 7e-16
148gb|U35127.1|XXU35127 Plasmid pBSL128 cloning vector, complete se... 94 7e-16
149gb|U35126.1|XXU35126 Plasmid pBSL121 cloning vector, complete se... 94 7e-16
150gb|U35125.1|XXU35125 Plasmid pBSL119 cloning vector, complete se... 94 7e-16
151emb|AJ621843.1| Acetobacter pasteurianus partial 23S rRNA gene, ... 94 7e-16
152gb|AF072999.1|AF072999 Cloning vector pCMVTAG3c, complete sequence 94 7e-16
153gb|AF072998.1|AF072998 Cloning vector pCMVTAG3b, complete sequence 94 7e-16
154gb|AF072997.1|AF072997 Cloning vector pCMVTAG3a, complete sequence 94 7e-16
155gb|AF072540.1|AF072540 Cloning vector pCMVTAG2c, complete sequence 94 7e-16
156gb|AF072539.1|AF072539 Cloning vector pCMVTAG2b, complete sequence 94 7e-16
157gb|AF072538.1|AF072538 Cloning vector pCMVTAG2a, complete sequence 94 7e-16
158gb|AF067646.1|AF067646 Cloning vector pCMV-scriptEX, complete se... 94 7e-16
159gb|AF028239.1|AF028239 Mammalian expression vector pCMV-Script, ... 94 7e-16
160gb|AF016889.1|AF016889 Cloning vector pWSK29, complete sequence 94 7e-16
161emb|X91477.1|BSPX91477 Uncultured bacterium partial 16S rRNA gen... 94 7e-16
162gb|AF015771.1|AF015771 Magnaporthe grisea putative transcription... 94 7e-16
163gb|U93719.1| Cloning vector pRS422 with 2micron ADE2 marker, com... 94 7e-16
164gb|U93718.1| Cloning vector pRS412 with CEN/ARS ADE2 marker, com... 94 7e-16
165gb|U93717.1| Cloning vector pRS402 with ADE2 marker, complete se... 94 7e-16
166gb|U93716.1| Cloning vector pRS421 with 2micron MET15 marker, co... 94 7e-16
167gb|U93715.1| Cloning vector pRS411 with CEN/ARS MET15 marker, co... 94 7e-16
168gb|U93714.1| Cloning vector pRS401 with MET15 marker, complete s... 94 7e-16
169gb|U93713.1| Cloning vector pRS400 with kanMX4 marker, complete ... 94 7e-16
170gb|U66313.1|U66313 Expression vector pUHS*2Plac/ara-1 MCS1, comp... 94 7e-16
171dbj|AB241267.1| Verasper moseri DNA, microsatellite marker Vemos64 94 7e-16
172gb|U40860.1|NMU40860 Neisseria meningitidis hemoglobin receptor ... 94 7e-16
173gb|U64694.1|SCU64694 Yeast integrating vector pRSQ2-URA3, comple... 94 7e-16
174gb|U34887.1|U34887 Yeast integrating vector pRS306 containing a ... 94 7e-16
175emb|AJ312393.1|CTR312393 Chloroplast transformation vector pRB95 94 7e-16
176emb|AJ312392.1|CTR312392 Chloroplast transformation vector pRB94 94 7e-16
177emb|X91293.1|BSPX91293 Bacterial sp. partial 16S rRNA gene (clon... 94 7e-16
178gb|U03442.1|PRS316 Yeast centromere vector pRS316 with URA3 mark... 94 7e-16
179gb|U03441.1|PRS315 Yeast centromere vector pRS315 with LEU2 mark... 94 7e-16
180gb|U03440.1|PRS314 Yeast centromere vector pRS314 with TRP1 mark... 94 7e-16
181gb|U03439.1|PRS313 Yeast centromere vector pRS313 with HIS3 mark... 94 7e-16
182gb|U03438.1|PRS306 Yeast integrative vector pRS306 with URA3 mar... 94 7e-16
183gb|U03437.1|PRS305 Yeast integrative vector pRS305 with LEU2 mar... 94 7e-16
184gb|U03436.1|PRS304 Yeast integrative vector pRS304 with TRP1 mar... 94 7e-16
185gb|U03435.1|PRS303 Yeast integrative vector pRS303 with HIS3 mar... 94 7e-16
186emb|Y13161.1|SSMSAT60 Sus scrofa microsatellite DNA isolate pGC.60 94 7e-16
187gb|U03451.1|PRS426 Yeast episomal vector pRS426 with URA3 marker... 94 7e-16
188gb|U03452.1|PRS425 Yeast episomal vector pRS425 with LEU2 marker... 94 7e-16
189gb|U03453.1|PRS424 Yeast episomal vector pRS424 with TRP1 marker... 94 7e-16
190gb|U03454.1|PRS423 Yeast episomal vector pRS423 with HIS3 marker... 94 7e-16
191gb|U03450.1|PRS416 Yeast centromere vector pRS416 with URA3 mark... 94 7e-16
192gb|U03449.1|PRS415 Yeast centromere vector pRS415 with LEU2 mark... 94 7e-16
193gb|U03448.1|PRS414 Yeast centromere vector pRS414 with TRP1 mark... 94 7e-16
194gb|U03447.1|PRS413 Yeast centromere vector pRS413 with HIS3 mark... 94 7e-16
195gb|U03446.1|PRS406 Yeast integrative vector pRS406 with URA3 mar... 94 7e-16
196gb|U03445.1|PRS405 Yeast integrative vector pRS405 with LEU2 mar... 94 7e-16
197gb|U03444.1|PRS404 Yeast integrative vector pRS404 with TRP1 mar... 94 7e-16
198gb|U03443.1|PRS403 Yeast integrative vector pRS403 with HIS3 mar... 94 7e-16
199gb|U14125.1|CVU14125 Cloning vector pSG926, HIS4-based plasmid, ... 94 7e-16
200gb|U14122.1|CVU14122 Cloning vector pSG935, HIS4-based plasmid, ... 94 7e-16
201gb|U14120.1|CVU14120 Cloning vector pSG927, HIS4-based plasmid, ... 94 7e-16
202gb|L08874.1|SYNPHSCSKV PhageScript SK cloning vector 94 7e-16
203gb|L08786.1|SYNBLSKMV BlueScribe SK Minus cloning vector 94 7e-16
204gb|L08784.1|SYNBLKSMV BlueScribe KS Minus cloning vector 94 7e-16
205gb|L08787.1|SYNBLDKPV BlueScribe SK Plus cloning vector 94 7e-16
206emb|AJ007320.1|HSA7320 Homo sapiens mRNA for immunoglobulin heav... 94 7e-16
207gb|L11060.1|SYNECOYST Cloning vector sequence (E. coli/yeast/pha... 94 7e-16
208dbj|AB005666.1| Homo sapiens mRNA for GTPase-activating protein,... 94 7e-16
209dbj|AB039884.1| Myxococcus xanthus accB, accA genes for acetyl-C... 94 7e-16
210emb|AJ294956.1|CCA294956 Catla catla microsatellite DNA, clone Cc8 94 7e-16
211gb|AY189981.1| Expression vector pBS-35S-YFP, complete sequence 92 3e-15
212gb|AY189980.1| Expression vector pBS-35S-Rluc, complete sequence 92 3e-15
213gb|DQ015899.1| Synthetic construct loxP-URA3-loxP disruption cas... 92 3e-15
214emb|Z70242.1|TSAL6BGLT Thermococcus sp. AL662 bglT gene 92 3e-15
215gb|AF309796.1|AF309796 Clupea pallasi microsatellite Cha125 sequ... 92 3e-15
216gb|AY995141.1| Cloning vector pBS 35S attR-YFP, complete sequence 92 3e-15
217gb|AY995140.1| Cloning vector pBS 35S attR-hRluc, complete sequence 92 3e-15
218gb|AY995139.1| Cloning vector pBS 35S attR-Rluc, complete sequence 92 3e-15
219gb|AY995138.1| Cloning vector pBS 35S hRluc-attR, complete sequence 92 3e-15
220gb|AY995137.1| Cloning vector pBS 35S YFP-attR, complete sequence 92 3e-15
221gb|AY995136.1| Cloning vector pBS 35S Rluc-attR, complete sequence 92 3e-15
222gb|AY189985.1| Expression vector pBS-35S-YFP-Ala, complete sequence 92 3e-15
223gb|AY189984.1| Expression vector pBS-35S-Ala-YFP, complete sequence 92 3e-15
224gb|AY189983.1| Expression vector pBS-35S-Rluc-Ala, complete sequ... 92 3e-15
225gb|AY189982.1| Expression vector pBS-35S-Ala-Rluc, complete sequ... 92 3e-15
226emb|AJ012010.1|CCA012010 Cyprinus carpio partial type II rhodops... 92 3e-15
227emb|Z46733.1|ASP123T Artificial DNA for p123T PCR cloning vector 92 3e-15
228gb|AF078810.1|AF078810 Cloning vector pAVA319, complete sequence 92 3e-15
229emb|AJ567368.2|VVI567368 Vitis vinifera samdc gene for S-adenosy... 92 3e-15
230emb|Z31700.1|HSHLAXRP H.sapiens HLA-Xrp gene 92 3e-15
231emb|AJ009991.1|MMU009991 Mus musculus ALDP gene including 5'UTR,... 92 3e-15
232dbj|AB069689.1| Aspergillus oryzae vmaC gene for vacuolar membra... 92 3e-15
233gb|AF219920.1|F219907S14 Homo sapiens diacylglycerol kinase iota... 90 1e-14
234gb|U82676.1|AUU82676 Aphelocoma ultramarina AAAG/CTTT repeat reg... 88 4e-14
235emb|X85744.1|GGMYOGEN Gallus gallus myogenin gene 88 4e-14
236dbj|AB241259.1| Verasper moseri DNA, microsatellite marker Vemos44 88 4e-14
237gb|AY436765.1| Binary vector pAMPAT-MCS, complete sequence 86 2e-13
238dbj|AB197018.1| Haliotis discus hannai DNA, microsatellite Hdh1426 86 2e-13
239gb|AF309792.1|AF309792 Clupea pallasi microsatellite Cha107 sequ... 86 2e-13
240emb|AJ626720.1| Acetobacter pasteurianus partial ITS1, strain CC... 86 2e-13
241gb|AY237646.1| Cloning vector pHRGFPTC, complete sequence 86 2e-13
242gb|AF110459.1|AF110459 Cloning vector pBBR1-GFP, complete sequence 86 2e-13
243dbj|AB064982.1| Mus musculus gene for Bmal1, 5' upstream sequenc... 86 2e-13
244emb|AJ621846.1| Acetobacter aceti partial 23S rRNA gene, strain ... 86 2e-13
245gb|AF073000.1|AF073000 Cloning vector pCMVTAG4a, complete sequence 86 2e-13
246gb|DQ019862.2| Saccharomyces cerevisiae expression vector p423GA... 84 6e-13
247gb|DQ019861.2| Saccharomyces cerevisiae expression vector p426GP... 84 6e-13
248gb|DQ015897.1| Synthetic construct loxP-ARG4-loxP disruption cas... 84 6e-13
249emb|AJ305371.1|PAN305371 Podospora anserina sod2 gene for mangan... 84 6e-13
250gb|AY733070.1| Cloning vector pSW25, complete sequence 84 6e-13
251gb|AY733067.1| Cloning vector pSW24, complete sequence 84 6e-13
252dbj|AB060172.1| Misgurnus anguillicaudatus DNA, microsatellite Mac2 84 6e-13
253gb|DQ023608.1| Yeast expression vector p426GALL, complete sequence 84 6e-13
254gb|AY822461.1| Yeast expression vector pJG515 chloramphenicol re... 84 6e-13
255gb|AY822460.1| Yeast expression vector pJG514 chloramphenicol re... 84 6e-13
256gb|AY822459.1| Yeast expression vector pJG483 chloramphenicol re... 84 6e-13
257gb|AY822458.1| Yeast expression vector pJG482 chloramphenicol re... 84 6e-13
258gb|AY822457.1| Yeast expression vector pJG518 chloramphenicol re... 84 6e-13
259gb|AY822456.1| Yeast expression vector pJG516 chloramphenicol re... 84 6e-13
260gb|AY822455.1| Yeast expression vector pJG484 chloramphenicol re... 84 6e-13
261gb|AY822454.1| Yeast expression vector pJG485 chloramphenicol re... 84 6e-13
262gb|AF298791.1|AF298791 N-terminal GFP fusion vector pUG36, compl... 84 6e-13
263gb|AF298784.1|AF298784 N-terminal GFP fusion vector pUG34, compl... 84 6e-13
264gb|AY196822.1| PiggyBac transformation vector pB-MCS w+, complet... 84 6e-13
265gb|AF005420.1|AF005420 Expression vector pRIBOTEX, complete sequ... 84 6e-13
266gb|DQ232601.1| Receiver Vector p415-CYC1-CRE1a-TR-SSRE-GFP, comp... 84 6e-13
267gb|DQ232600.1| Receiver Vector p415-CYC1-CRE1a-SSRE-GFP, complet... 84 6e-13
268gb|DQ232593.1| Expression Vector p413-TR-SSRE, complete sequence 84 6e-13
269gb|DQ232592.1| Expression Vector p413-SSRE, complete sequence 84 6e-13
270gb|U46128.1|GGU46128 Gallus gallus cardiac-enriched TEA domain t... 84 6e-13
271gb|AF076312.1|AF076312 Cloning vector pCMVTAG5a, complete sequence 84 6e-13
272gb|DQ269148.1| Yeast centromeric expression vector p416GPD, comp... 84 6e-13
273gb|M60510.1|MUSBETAA Mouse beta-D-galactosidase fusion protein m... 84 6e-13
274gb|AY944582.1| Cloning vector LUCTRAP-2, complete sequence 82 3e-12
275gb|AY944581.1| Cloning vector LUCTRAP-1, complete sequence 82 3e-12
276gb|AY968054.1| Cloning vector LUCTRAP-3(GW), complete sequence 82 3e-12
277gb|DQ073044.1| Cloning vector LUCTRAP, complete sequence 82 3e-12
278emb|Y10120.1|XLHDPA7 Xenopus laevis mRNA for paired box protein,... 82 3e-12
279emb|Y09668.1|DRTKLELF1 D.rerio mRNA for tyrosine kinase ligand (... 82 3e-12
280emb|AJ556548.1|DRE556548 Danio rerio mRNA for TRAF4 protein, spl... 82 3e-12
281emb|AJ421626.1|XLA421626 Xenopus laevis LTBP-1 gene for latent T... 82 3e-12
282gb|U01668.1|U01668 Phagemid cloning vector pKSS, complete sequence 82 3e-12
283gb|AY028412.1| YTT vector A, complete sequence 82 3e-12
284gb|AF176801.1|AF176800S2 Homo sapiens oxysterol 7alpha-hydroxyla... 82 3e-12
285gb|AF298787.1|AF298787 C-terminal GFP fusion vector pUG35, compl... 82 3e-12
286gb|AF298783.1|AF298783 C-terminal GFP fusion vector pUG23, compl... 82 3e-12
287dbj|AB108425.1| Xenopus laevis Mitf-M mRNA for micophthalmia-ass... 82 3e-12
288gb|S52444.1|S52444 {cloning vector} [pTF1, host=E.coli, Plasmid ... 82 3e-12
289dbj|D88110.1| Homo sapiens DNA, clone:pHGC39 82 3e-12
290gb|U79666.1|HSU79666 Homo sapiens alpha1A-voltage-dependent calc... 82 3e-12
291gb|U70311.1|CVU70311 Filamentous phage display expression clonin... 82 3e-12
292emb|AJ304860.1|MMU304860 Mus musculus partial Bfsp2 gene for pha... 82 3e-12
293gb|DQ250997.1| Expression vector pMF331, complete sequence 82 3e-12
294emb|AJ277968.1|DME277968 Drosophila melanogaster TRPgamma gene f... 82 3e-12
295emb|AJ277967.1|DME277967 Drosophila melanogaster TRPgamma gene f... 82 3e-12
296emb|X84816.1|HSRNAHST H.sapiens mRNA for hydroxysteroid sulfotra... 82 3e-12
297gb|AY598428.1| Expression vector pMF272, complete sequence 80 1e-11
298gb|AY598430.1| Expression vector pMF309, complete sequence 80 1e-11
299gb|AY598429.1| Expression vector pMF280, complete sequence 80 1e-11
300emb|AJ250260.1|CAR250260 Coffea arabica microsatellite DNA, clon... 80 1e-11
301emb|AJ250257.1|CAR250257 Coffea arabica microsatellite DNA, clon... 80 1e-11
302emb|AJ250254.1|CAR250254 Coffea arabica microsatellite DNA, clon... 80 1e-11
303emb|AJ250252.1|CAR250252 Coffea arabica microsatellite DNA, clon... 80 1e-11
304emb|AJ296695.1|PAB296695 Picea abies ATC microsatellite DNA, clo... 80 1e-11
305emb|AJ296686.1|PAB296686 Picea abies ATC microsatellite DNA, clo... 80 1e-11
306gb|AF140578.1| Integration vector mini-CTX-GFP, complete sequence 80 1e-11
307gb|DQ015895.1| Candida integrating vector CIp30, complete sequence 80 1e-11
308gb|DQ015894.1| Candida integrating vector CIp20, complete sequence 80 1e-11
309gb|U89315.1|AH005788S07 Homo sapiens nucleophosmin phosphoprotei... 80 1e-11
310gb|AY279344.1| Gene silencing vector pCPCbLCVB.002, complete seq... 80 1e-11
311emb|X90729.1|BNPBP3 B.napus mRNA for biotin carboxyl carrier pro... 80 1e-11
312emb|X82786.1|MMKI67 M.musculus mRNA for Ki-67 80 1e-11
313emb|X70842.1|MMFLK1M M.musculus Flk-1 mRNA 80 1e-11
314emb|X58436.1|DMIPOU D.melanogaster I-POU mRNA for a POU-domain p... 80 1e-11
315emb|X55499.1|MMIGEBP1 M.musculus Ig/EBP-1 gene for immunoglobuli... 80 1e-11
316emb|AJ854303.1| Branchiostoma floridae partial mRNA for forkhead... 80 1e-11
317emb|AJ489221.2|GGA489221 Gallus gallus mRNA for homeobox protein... 80 1e-11
318emb|AJ277470.1|OSA277470 Oryza sativa rbbi2-3 gene for putative ... 80 1e-11
319emb|AJ252205.1|PSP252205 Pseudanabaena sp. strain PCC 6903 murI,... 80 1e-11
320emb|AJ002685.1|ATPI4KG Arabidopsis thaliana mRNA for Phosphatidy... 80 1e-11
321emb|AJ001727.1|REDNAK Ralstonia sp. CH34 dnaK gene 80 1e-11
322gb|AY454397.1| Cloning vector pTA6, complete sequence 80 1e-11
323emb|Z47173.1|CSPAG13R Calothrix D253 genomic DNA (clone AG13R) 80 1e-11
324emb|Z47159.1|CSPAG5R Calothrix D253 genomic DNA (clone AG5R) 80 1e-11
325dbj|AB233453.1| Oryza sativa (japonica cultivar-group) OsPPCK2L ... 80 1e-11
326dbj|AB233452.1| Oryza sativa (japonica cultivar-group) OsPPCK2S ... 80 1e-11
327dbj|AB226176.1| Aspergillus oryzae cDNA, contig sequence: AoEST3034 80 1e-11
328dbj|AB226023.1| Aspergillus oryzae cDNA, contig sequence: AoEST2879 80 1e-11
329dbj|AB224727.1| Aspergillus oryzae cDNA, contig sequence: AoEST1576 80 1e-11
330dbj|AB224157.1| Aspergillus oryzae cDNA, contig sequence: AoEST0999 80 1e-11
331dbj|AB224122.1| Aspergillus oryzae cDNA, contig sequence: AoEST0964 80 1e-11
332dbj|AB223337.1| Aspergillus oryzae cDNA, contig sequence: AoEST0168 80 1e-11
333emb|CR354251.1| Gallus gallus finished cDNA, clone ChEST901n24 80 1e-11
334gb|AF181970.1|AF181970 Integrating vector CIp10, complete sequence 80 1e-11
335emb|AJ234634.1|HVU234634 Hordeum vulgare genomic DNA fragment; c... 80 1e-11
336gb|AF134119.1|AF134119 Mus musculus SKD1 (Skd1) gene, complete cds 80 1e-11
337gb|AY663845.1| Cloning vector p2059-RS-nirA, complete sequence 80 1e-11
338gb|AY663844.1| Cloning vector p2059-URA-RS, complete sequence 80 1e-11
339gb|AY663843.1| Cloning vector pZRM2059, complete sequence 80 1e-11
340dbj|AB080947.1| Paralichthys olivaceus TNFR-2 mRNA for tumor nec... 80 1e-11
341emb|AJ574874.1|UBA574874 Uncultured bacterium partial 16S rRNA g... 80 1e-11
342dbj|AB040534.1| Streptococcus mutans rgtB, orf1, pac genes for r... 80 1e-11
343gb|AY653732.1| Cloning vector pIYFP IyfP (iyfP) gene, complete cds 80 1e-11
344gb|AY653731.1| Cloning vector pICFP IcfP (icfP) gene, complete cds 80 1e-11
345gb|U32628.1|BSU32628 Bacillus sphaericus toxin degrading proteas... 80 1e-11
346gb|U02437.1|XXU02437 Cloning vector pT3/T7-LUC, complete sequence 80 1e-11
347gb|U02430.1|XXU02430 Cloning vector pMAMneoBlue, complete sequence 80 1e-11
348gb|U02449.1|U02449 Cloning vector pDIRECT, complete sequence 80 1e-11
349gb|M94676.1|HUMDINRPTA Homo sapiens dinucleotide repeat polymorp... 80 1e-11
350emb|AJ278625.1|CSU278625 Cuscuta subinclusa chloroplast tRNA-Val... 80 1e-11
351emb|AJ401355.1|CPL401355 Cuscuta platyloba chloroplast 16S rRNA ... 80 1e-11
352emb|AJ401353.1|CCA401353 Cuscuta campestris chloroplast 16S rRNA... 80 1e-11
353gb|U27867.1|SVU27867 Stealth virus clone C16290 T3 80 1e-11
354emb|AJ131952.1|OCU131952 Oryctolagus cuniculus pseudogene tpt1-ps1 80 1e-11
355gb|DQ250998.1| Expression vector pMF332, complete sequence 80 1e-11
356emb|Z46785.1|DMMSTBBGE D.melanogaster gene for protamine (mst35Bb) 80 1e-11
357gb|L29300.1|LEIRIBPP Leishmania chagasi (clone C1) ribosomal pro... 80 1e-11
358dbj|D89083.1| Oncorhynchus mykiss mRNA for transferrin, complete... 80 1e-11
359dbj|AB027145.1| Rattus norvegicus mRNA for CDCrel-1F, partial cds 80 1e-11
360dbj|AB067774.1| Homo sapiens mRNA for h-SHIPPO 1, complete cds 80 1e-11
361gb|AY008367.1| Glossina palpalis palpalis clone Pgp28 microsatel... 78 4e-11
362gb|AF106619.1|AF106619 Cloning vector pDR1149 complete sequence 78 4e-11
363dbj|AB241258.1| Verasper moseri DNA, microsatellite marker Vemos43 78 4e-11
364dbj|AB007810.1| Mus musculus mGLT-1 mRNA, complete cds 78 4e-11
365dbj|D83414.1|YSPCUT6C Schizosaccharomyces pombe cut6+ gene for a... 78 4e-11
366emb|AJ005682.1|ATH5682 Arabidopsis thaliana mRNA for inositol 1,... 76 2e-10
367ref|NM_008882.1| Mus musculus plexin A2 (Plxna2), mRNA 76 2e-10
368emb|AJ132233.1|EGE132233 Enterobacter gergoviae glgC (partial) a... 76 2e-10
369emb|AJ234770.1|HVU234770 Hordeum vulgare genomic DNA fragment; c... 76 2e-10
370dbj|AB081563.1| Paralichthys olivaceus TCRJd-Cd2-L gene for T ce... 76 2e-10
371gb|AF067142.1|AF067142 Cloning vector pSFI polylinker, complete ... 76 2e-10
372dbj|D86949.1| Mus musculus mRNA for plexin 2, complete cds 76 2e-10
373dbj|D34625.2| Homo sapiens TBXAS1 gene for thromboxane synthase,... 74 6e-10
374emb|Z17399.1|ATORFB Arabidopsis thaliana PIP1b gene 74 6e-10
375gb|AY303671.1| Broad host range expression vector pMHE7Tc, compl... 72 2e-09
376gb|AY303669.1| Broad host range expression vector pMHE7, complet... 72 2e-09
377gb|AY299697.1| Broad host range expression vector pMHE5Tc, compl... 72 2e-09
378gb|AY299696.1| Broad host range expression vector pMHE5, complet... 72 2e-09
379gb|AY299693.1| Broad host range expression vector pMHE2, complet... 72 2e-09
380emb|AJ278266.2|RNO278266 Rattus norvegicus mRNA for SH3-domain b... 72 2e-09
381gb|AY733073.1| Cloning vector pSW29T, complete sequence 72 2e-09
382gb|AY733071.1| Cloning vector pSW25T, complete sequence 72 2e-09
383gb|AY733066.1| Cloning vector pSW23T, complete sequence 72 2e-09
384ref|NM_022693.2| Rattus norvegicus SH3-domain binding protein 4 ... 72 2e-09
385dbj|AB226652.1| Aspergillus oryzae cDNA, contig sequence: AoEST3514 72 2e-09
386dbj|AB225960.1| Aspergillus oryzae cDNA, contig sequence: AoEST2816 72 2e-09
387gb|S71728.1| truncated protein {frame 1, multiple cloning site} ... 72 2e-09
388dbj|BA000022.2| Synechocystis sp. PCC 6803 DNA, complete genome 72 2e-09
389gb|AF179625.1|AF179625 Shuttle vector pCS513, complete sequence 72 2e-09
390gb|AF179626.1|AF179626 Expression vector pGP100, complete sequence 72 2e-09
391gb|AF178582.1|AF178582 Expression vector pCS316 complete sequence 72 2e-09
392gb|AF076778.1|AF076778 Cloning vector pCMVTAG5c, complete sequence 72 2e-09
393gb|AF076777.1|AF076777 Cloning vector pCMVTAG5b, complete sequence 72 2e-09
394gb|AF076311.1|AF076311 Cloning vector pCMVTAG4c, complete sequence 72 2e-09
395gb|AF076310.1|AF076310 Cloning vector pCMVTAG4b, complete sequence 72 2e-09
396gb|DQ289040.1| Gene replacement vector pLAW344, complete sequence 72 2e-09
397emb|AJ002972.1|AFAJ2972 Artemia franciscana mRNA for actin 403, ... 72 2e-09
398dbj|AB049715.1| Pisum sativum ssa-4 mRNA for putative senescence... 72 2e-09
399emb|Y18852.1|SOL18852 Spinacia oleracea mRNA for DNA-dependent R... 70 1e-08
400emb|AJ276295.1|CSI276295 Citrus sinensis partial mRNA for ACC sy... 70 1e-08
401emb|X92518.1|HSHMGICP H.sapiens mRNA for HMGI-C protein 70 1e-08
402dbj|AB213560.1| Xenopus laevis mRNA for ERK5, complete cds 70 1e-08
403gb|AF298789.1| Recombinase expression vector pSH63, complete seq... 70 1e-08
404gb|AF298785.1| Recombinase expression vector pSH62, complete seq... 70 1e-08
405gb|AF298782.1| Recombinase expression vector pSH47, complete seq... 70 1e-08
406gb|AF298780.1| Recombinase expression vector pSH65, partial sequ... 70 1e-08
407gb|S71730.1| influenza virus hemagglutinin 5' epitope tag=fusion... 70 1e-08
408gb|U09476.1|XXU09476 Synthetic construct dihydrofolate reductase... 70 1e-08
409gb|AF093826.1|AF093826 Plasmodium berghei GTP binding protein (r... 70 1e-08
410gb|AY104397.1| Zea mays PCO152838 mRNA sequence 70 1e-08
411dbj|AK116781.1| Ciona intestinalis cDNA, clone:cieg015b06, full ... 70 1e-08
412gb|L40071.1|CHKMCW8 Gallus domesticus DNA microsatellite marker ... 70 1e-08
413gb|L27850.1|HRSTCRAG Equus caballus (clone T131) T-cell receptor... 70 1e-08
414emb|X83699.1|HSIGF2RX1 Homo sapiens IGF2R gene (subclone pEX1-P) 70 1e-08
415gb|AY445093.2| Drosophila lummei heat shock protein Hsp70c pseud... 68 4e-08
416gb|AY710294.1| Synthetic construct Maa7/X IR artificial transgene 68 4e-08
417gb|AY170009.1| Cloning vector pCAT-3', complete sequence 68 4e-08
418emb|X59727.1|HS63KDAP H.sapiens 63 kDa protein kinase related to... 68 4e-08
419gb|AF474332.1| Cloning vector pBC214, complete sequence 68 4e-08
420emb|X94368.1|GGLRPP40G G.gallus gene 37LRP/p40 68 4e-08
421emb|X87971.1|MTNIFGLNS M.thermoautotrophicum nifH, glnBa, glnBb,... 68 4e-08
422gb|AY640628.1| SiRNA vector pSUPER-hSyn-DsRed2N1-CytB-AS, comple... 68 4e-08
423gb|AY640627.1| SiRNA vector pSUPER-CMV-EGFP-CytB-AS-ohneBgl, com... 68 4e-08
424gb|AY640626.1| SiRNA vector pSUPER-CMV-EGFP-CytB-AS, complete se... 68 4e-08
425gb|AY640625.1| SiRNA vector pSUPER-CMV-DsRed2N1-CytB-AS, complet... 68 4e-08
426emb|AM180349.1| Transconjugation vector pROKB1 68 4e-08
427emb|AM180348.1| Transconjugation vector pROCKB2 68 4e-08
428gb|AF002251.1|AF002251 Rattus norvegicus Maxp1 mRNA, complete cds 68 4e-08
429gb|L40050.1|CHKMCW30 Gallus domesticus DNA microsatellite marker... 68 4e-08
430emb|Z95377.1|HSZ95377 H.sapiens genomic DNA fragment (clone NRLA... 68 4e-08
431emb|X84002.1|HSTAFII20 H.sapiens TAFII20 mRNA for transcription ... 68 4e-08
432dbj|AB085846.1| Chlorella vulgaris g6pdh mRNA for glucose-6-phos... 68 4e-08
433emb|AJ868288.1| Transconjugation Plasmid pEMOC2 66 1e-07
434dbj|AB227617.1| Aspergillus oryzae cDNA, contig sequence: AoEST4490 66 1e-07
435dbj|AB226655.1| Aspergillus oryzae cDNA, contig sequence: AoEST3517 66 1e-07
436dbj|AB226651.1| Aspergillus oryzae cDNA, contig sequence: AoEST3513 66 1e-07
437dbj|AB226650.1| Aspergillus oryzae cDNA, contig sequence: AoEST3512 66 1e-07
438dbj|AB226043.1| Aspergillus oryzae cDNA, contig sequence: AoEST2899 66 1e-07
439dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 66 1e-07
440dbj|AB120408.1| Equus caballus ILT11A mRNA for immunoglobulin-li... 66 1e-07
441emb|AJ228585.1|CVAJ8585 cotton leaf curl virus DNA fragment, iso... 66 1e-07
442dbj|AB088845.1| Rana catesbeiana PAalpha mRNA for parvalbumin al... 66 1e-07
443gb|U63898.1|U63898 Arabidopsis thaliana AppB protein (AppB1) mRN... 66 1e-07
444gb|L15365.1|SUSSSAP Strongylocentrotus purpuratus stage specific... 66 1e-07
445dbj|D14015.1|RATCYCLE Rattus rattus mRNA for cyclin E, complete cds 66 1e-07
446gb|U65078.1|CVU65078 Cloning shuttle vector pNF2214 with kanamyc... 66 1e-07
447gb|U65077.1|CVU65077 Promoter-probe vector pNF2283 with ampicill... 66 1e-07
448gb|L40401.1|HUMORFK Homo sapiens (clone zap128) mRNA, 3' end of cds 66 1e-07
449gb|AF016705.1|HSUBE3AL3 Homo sapiens E6-AP ubiquitin-protein lig... 66 1e-07
450emb|Z79475.1|HSPA9E1 H.sapiens flow-sorted chromosome 6 TaqI fra... 66 1e-07
451gb|M21579.1|DROSALA D.orena homeotic gene spalt (sal), complete cds 66 1e-07
452dbj|AB045011.1| Homo sapiens hmGluR2 gene for metabotropic gluta... 66 1e-07
453gb|AY197749.1| Solanum tuberosum UDP-glucose 4-epimerase (StUGE4... 64 6e-07
454emb|AJ575747.1|LJA575747 Lotus japonicus partial mRNA for argini... 64 6e-07
455emb|AJ277472.1|OSA277472 Oryza sativa rbbi2-5 gene for putative ... 64 6e-07
456emb|AJ000265.1|SOJ00265 Spinacia oleracea mRNA (nuclear-encoded)... 64 6e-07
457dbj|AB227775.1| Aspergillus oryzae cDNA, contig sequence: AoEST4648 64 6e-07
458dbj|AB226321.1| Aspergillus oryzae cDNA, contig sequence: AoEST3183 64 6e-07
459gb|S63208.1| proteolipid protein (PLP) {5' region, exon 1, promo... 64 6e-07
460emb|AJ228587.1|CVAJ8587 cotton leaf curl virus DNA fragment, iso... 64 6e-07
461emb|Z28640.1|ACRBPCX Acetabularia cliftonii gene for ribulose-1-... 64 6e-07
462emb|X90560.1|PPCAMPROT Physcomitrella patens mRNA for calmodulin 64 6e-07
463gb|U64693.1|SCU64693 Yeast integrating vector pRSQ2-LEU2, comple... 64 6e-07
464gb|U27919.1|SVU27919 Stealth virus 1 clone 3B65 T7 64 6e-07
465gb|U68056.1|DMU68056 Drosophila melanogaster SOX HMG domain prot... 64 6e-07
466gb|L41561.1|MDVFRA Gallid herpesvirus mRNA fragment 64 6e-07
467emb|AJ277721.1|AST277721 Anopheles stephensi 3' flanking end of ... 64 6e-07
468gb|U09632.1|XLU09632 Xenopus laevis thrombin receptor mRNA, comp... 64 6e-07
469gb|AY218693.1| Uncultured bacterium clone KD8-79 16S ribosomal R... 62 2e-06
470gb|AY218689.1| Uncultured bacterium clone KD8-62 16S ribosomal R... 62 2e-06
471emb|AJ402787.1|SSA402787 Salmo salar microsatellite DNA, clone 1... 62 2e-06
472ref|XM_664062.1| Plasmodium berghei strain ANKA hypothetical pro... 62 2e-06
473ref|XM_666562.1| Plasmodium berghei strain ANKA hypothetical pro... 62 2e-06
474ref|XM_673849.1| Plasmodium berghei strain ANKA hypothetical pro... 62 2e-06
475ref|XM_659772.1| Cryptosporidium hominis TU502 hypothetical prot... 62 2e-06
476emb|Z31401.1|ATCYC2B A.thaliana (Columbia) cyc2b mRAN for cyclin... 62 2e-06
477emb|Y14981.1|BOY14981 Brassica oleracea fae1 gene 62 2e-06
478emb|AJ243692.1|MHO243692 Mycoplasma hominis gap gene encoding gl... 62 2e-06
479gb|DQ023272.1| NiaD::cre expression module recombinase (cre) gen... 62 2e-06
480dbj|AB226994.1| Aspergillus oryzae cDNA, contig sequence: AoEST3856 62 2e-06
481dbj|AB226654.1| Aspergillus oryzae cDNA, contig sequence: AoEST3516 62 2e-06
482gb|AF060648.1|AF060648 Gossypium barbadense clone pXP1-58 repeti... 62 2e-06
483gb|AF433043.1|AF433043 Cloning vector pWS32, complete sequence 62 2e-06
484gb|AF433042.1|AF433042 Cloning vector pWS31, complete sequence 62 2e-06
485gb|L79898.1|FUGGNAI2D Fugu rubripes guanine nucleotide binding p... 62 2e-06
486gb|AF179463.1|AF179463 Mus musculus modified fragile X mental re... 62 2e-06
487gb|AF016404.1|AF016404 Chloroplast transformation vector pEZC204... 62 2e-06
488gb|AF190131.1|AF190131 Cloning vector pVO205 hygromycin-B-phosph... 62 2e-06
489dbj|AB167812.1| Achaearanea tepidariorum wnt16-like mRNA, comple... 62 2e-06
490dbj|AB081312.1| Paralichthys olivaceus CCR9 mRNA for C-C chemoki... 62 2e-06
491emb|X79428.1|ATATG3 A.thaliana microsatellite [repeated motif (g... 62 2e-06
492emb|X54650.1|DMFRIZZ3 D. melanogaster frizzled gene exons 3 and 4 62 2e-06
493emb|Z29380.1|ECMPZ003 Equus caballus (mpz005) microsatellite DNA 62 2e-06
494dbj|D16230.1|BMODHPA Bombyx mori gene for diapause hormone precu... 62 2e-06
495dbj|AB055403.1| Cavia porcellus NQO1 mRNA for NAD(P)H: quinone o... 62 2e-06
496gb|DQ225747.1| Gene trapping Ds/T-DNA vector pUR224NB, complete ... 62 2e-06
497gb|DQ225746.1| Gene trapping Ds/T-DNA vector pUR224NA, complete ... 62 2e-06
498gb|U80584.1|WSU80584 Wolbachia sp. 16S ribosomal RNA gene, parti... 62 2e-06
499gb|U40859.1|NMU40859 Neisseria meningitidis hemoglobin receptor ... 62 2e-06
500emb|Z14037.1|BTMS121 B.taurus microsatellite (ETH121) 62 2e-06

>gb|AY157498.1| Synechococcus sp. PCC 7942 cosmid 4G8, complete sequence
          Length = 31404

 Score = 1158 bits (584), Expect = 0.0
 Identities = 584/584 (100%)
 Strand = Plus / Minus

                                                                         
Query: 45    ctgcagcagggattgcacctcctcacgactggactcactcagtcgggtattggtaatgac 104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21376 ctgcagcagggattgcacctcctcacgactggactcactcagtcgggtattggtaatgac 21317

                                                                         
Query: 105   atccgataaggagatcgcagcgatcgctgtaaaggttgtccccactccaaacaacaggaa 164
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21316 atccgataaggagatcgcagcgatcgctgtaaaggttgtccccactccaaacaacaggaa 21257

                                                                         
Query: 165   ttggcggcgcagcttcatggcagtcgagggttaggggggcaaccaaggctcgcgacggtg 224
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21256 ttggcggcgcagcttcatggcagtcgagggttaggggggcaaccaaggctcgcgacggtg 21197

                                                                         
Query: 225   gctctagcgttcgagcaactgagcaattttactgagcaggcgcggtagctcgattggctt 284
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21196 gctctagcgttcgagcaactgagcaattttactgagcaggcgcggtagctcgattggctt 21137

                                                                         
Query: 285   ggtgtcgtagtcgtcacagcccgcggcgatcgccttttcgcgatcgctagccatggcgtg 344
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21136 ggtgtcgtagtcgtcacagcccgcggcgatcgccttttcgcgatcgctagccatggcgtg 21077

                                                                         
Query: 345   ggcagtcagtgcaatcaccggcgtctgttgcagttcaggatcggctttgagttggcgcgt 404
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21076 ggcagtcagtgcaatcaccggcgtctgttgcagttcaggatcggctttgagttggcgcgt 21017

                                                                         
Query: 405   ggcctcccagccatccatcactggcaagctcatatccatcaaaatcagatccggttgctc 464
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21016 ggcctcccagccatccatcactggcaagctcatatccatcaaaatcagatccggttgctc 20957

                                                                         
Query: 465   gcgccgtgccgtatccacaccggcagctccatcgtgagccaagaccacttcaaaaccctt 524
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20956 gcgccgtgccgtatccacaccggcagctccatcgtgagccaagaccacttcaaaaccctt 20897

                                                                         
Query: 525   gcgagtcagacggcgcgacaacatatcccaattgtcttcgttgtcttctaccaacaagat 584
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20896 gcgagtcagacggcgcgacaacatatcccaattgtcttcgttgtcttctaccaacaagat 20837

                                                         
Query: 585   tttagtcatccctaatcctctcaccccgattgatcacctcaccg 628
             ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20836 tttagtcatccctaatcctctcaccccgattgatcacctcaccg 20793



to top

>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 1158 bits (584), Expect = 0.0
 Identities = 584/584 (100%)
 Strand = Plus / Minus

                                                                           
Query: 45      ctgcagcagggattgcacctcctcacgactggactcactcagtcgggtattggtaatgac 104
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2425811 ctgcagcagggattgcacctcctcacgactggactcactcagtcgggtattggtaatgac 2425752

                                                                           
Query: 105     atccgataaggagatcgcagcgatcgctgtaaaggttgtccccactccaaacaacaggaa 164
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2425751 atccgataaggagatcgcagcgatcgctgtaaaggttgtccccactccaaacaacaggaa 2425692

                                                                           
Query: 165     ttggcggcgcagcttcatggcagtcgagggttaggggggcaaccaaggctcgcgacggtg 224
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2425691 ttggcggcgcagcttcatggcagtcgagggttaggggggcaaccaaggctcgcgacggtg 2425632

                                                                           
Query: 225     gctctagcgttcgagcaactgagcaattttactgagcaggcgcggtagctcgattggctt 284
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2425631 gctctagcgttcgagcaactgagcaattttactgagcaggcgcggtagctcgattggctt 2425572

                                                                           
Query: 285     ggtgtcgtagtcgtcacagcccgcggcgatcgccttttcgcgatcgctagccatggcgtg 344
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2425571 ggtgtcgtagtcgtcacagcccgcggcgatcgccttttcgcgatcgctagccatggcgtg 2425512

                                                                           
Query: 345     ggcagtcagtgcaatcaccggcgtctgttgcagttcaggatcggctttgagttggcgcgt 404
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2425511 ggcagtcagtgcaatcaccggcgtctgttgcagttcaggatcggctttgagttggcgcgt 2425452

                                                                           
Query: 405     ggcctcccagccatccatcactggcaagctcatatccatcaaaatcagatccggttgctc 464
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2425451 ggcctcccagccatccatcactggcaagctcatatccatcaaaatcagatccggttgctc 2425392

                                                                           
Query: 465     gcgccgtgccgtatccacaccggcagctccatcgtgagccaagaccacttcaaaaccctt 524
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2425391 gcgccgtgccgtatccacaccggcagctccatcgtgagccaagaccacttcaaaaccctt 2425332

                                                                           
Query: 525     gcgagtcagacggcgcgacaacatatcccaattgtcttcgttgtcttctaccaacaagat 584
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2425331 gcgagtcagacggcgcgacaacatatcccaattgtcttcgttgtcttctaccaacaagat 2425272

                                                           
Query: 585     tttagtcatccctaatcctctcaccccgattgatcacctcaccg 628
               ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2425271 tttagtcatccctaatcctctcaccccgattgatcacctcaccg 2425228



to top

>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome
          Length = 2695903

 Score = 1158 bits (584), Expect = 0.0
 Identities = 584/584 (100%)
 Strand = Plus / Plus

                                                                           
Query: 45      ctgcagcagggattgcacctcctcacgactggactcactcagtcgggtattggtaatgac 104
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1891240 ctgcagcagggattgcacctcctcacgactggactcactcagtcgggtattggtaatgac 1891299

                                                                           
Query: 105     atccgataaggagatcgcagcgatcgctgtaaaggttgtccccactccaaacaacaggaa 164
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1891300 atccgataaggagatcgcagcgatcgctgtaaaggttgtccccactccaaacaacaggaa 1891359

                                                                           
Query: 165     ttggcggcgcagcttcatggcagtcgagggttaggggggcaaccaaggctcgcgacggtg 224
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1891360 ttggcggcgcagcttcatggcagtcgagggttaggggggcaaccaaggctcgcgacggtg 1891419

                                                                           
Query: 225     gctctagcgttcgagcaactgagcaattttactgagcaggcgcggtagctcgattggctt 284
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1891420 gctctagcgttcgagcaactgagcaattttactgagcaggcgcggtagctcgattggctt 1891479

                                                                           
Query: 285     ggtgtcgtagtcgtcacagcccgcggcgatcgccttttcgcgatcgctagccatggcgtg 344
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1891480 ggtgtcgtagtcgtcacagcccgcggcgatcgccttttcgcgatcgctagccatggcgtg 1891539

                                                                           
Query: 345     ggcagtcagtgcaatcaccggcgtctgttgcagttcaggatcggctttgagttggcgcgt 404
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1891540 ggcagtcagtgcaatcaccggcgtctgttgcagttcaggatcggctttgagttggcgcgt 1891599

                                                                           
Query: 405     ggcctcccagccatccatcactggcaagctcatatccatcaaaatcagatccggttgctc 464
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1891600 ggcctcccagccatccatcactggcaagctcatatccatcaaaatcagatccggttgctc 1891659

                                                                           
Query: 465     gcgccgtgccgtatccacaccggcagctccatcgtgagccaagaccacttcaaaaccctt 524
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1891660 gcgccgtgccgtatccacaccggcagctccatcgtgagccaagaccacttcaaaaccctt 1891719

                                                                           
Query: 525     gcgagtcagacggcgcgacaacatatcccaattgtcttcgttgtcttctaccaacaagat 584
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1891720 gcgagtcagacggcgcgacaacatatcccaattgtcttcgttgtcttctaccaacaagat 1891779

                                                           
Query: 585     tttagtcatccctaatcctctcaccccgattgatcacctcaccg 628
               ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1891780 tttagtcatccctaatcctctcaccccgattgatcacctcaccg 1891823



to top

>emb|AJ312391.1|CTR312391 Chloroplast transformation vector pRB70
          Length = 7454

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 53/54 (98%)
 Strand = Plus / Plus

                                                                  
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagcagg 54
            ||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 4754 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagcagg 4807



to top

>gb|U25061.1|XXU25061 Cloning vector pBBR1MCS-5 REP, LacZ alpha peptide (lacZ alpha), and
            gentamicin-3-acetyltransferase genes, complete cds
          Length = 4768

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3312 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3262



to top

>gb|U25060.1|XXU25060 Cloning vector pBBR1MCS-4 REP, LacZ alpha peptide (lacZ alpha), and
            beta-lactamase genes, complete cds
          Length = 4950

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3312 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3262



to top

>gb|U25059.1|XXU25059 Cloning vector pBBR1MCS-3 REP and LacZ alpha peptide (lacZ alpha)
            genes, complete cds; and unknown gene
          Length = 5228

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3312 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3262



to top

>gb|U23751.1|CVU23751 Cloning vector pBBR1MCS-2 plasmid pBBR1MCS-2, complete sequence
          Length = 5144

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3312 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3262



to top

>gb|U02374.1|XXU02374 Cloning vector pBBR1MCS plasmid pBBR1MCS, complete sequence
          Length = 4707

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3312 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3262



to top

>gb|AY827555.1| Shuttle vector pNAK1, complete sequence
          Length = 5223

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 135 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 85



to top

>gb|DQ228131.1| Moss transformation vector pMBL6, complete sequence
          Length = 4295

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3344 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3294



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 953  cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1003



to top

>gb|DQ228130.1| Moss transformation vector pMBL5, complete sequence
          Length = 4296

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2278 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2228



to top

>gb|DQ230324.1| Shuttle vector pMQ61, complete sequence
          Length = 7978

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3977 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4027



to top

>gb|DQ230323.1| Shuttle vector pMQ52, complete sequence
          Length = 7277

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3977 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4027



to top

>gb|DQ230322.1| Shuttle vector pMQ51, complete sequence
          Length = 8105

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3977 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4027



to top

>gb|AY456904.1| Binary vector pRE1, complete sequence
          Length = 9769

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 5  cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 55



to top

>gb|AY672109.3| Bursa aurealis delivery vector pBursa, complete sequence
          Length = 7383

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 5798 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 5848



to top

>gb|DQ490965.1| Mutant Zea mays clone pGR25C22 disrupted DOF1 (Dof1) gene, promoter
            region and complete cds
          Length = 12502

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 8093 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 8043



to top

>gb|AY423865.1| Cloning vector pMK2017, complete sequence
          Length = 4252

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 867 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 817



to top

>gb|AY557621.1| Shuttle vector pELS200, complete sequence
          Length = 7828

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 7334 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 7384



to top

>gb|M32616.1|SYNDROCL Cloning vector pHS85 heat-shock protein 82/neomycin
            phosphotransferase fusion protein (hsp82-neo fusion)
            gene, complete cds
          Length = 3727

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3719 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3669



to top

>gb|AY150810.1| Cloning vector pRS327, complete sequence
          Length = 9560

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 5936 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 5886



to top

>gb|AY150809.1| Cloning vector pRS317, complete sequence
          Length = 8601

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 5787 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 5737



to top

>gb|AY150808.1| Cloning vector pRS307, complete sequence
          Length = 8219

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 5936 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 5886



to top

>emb|AJ508373.1|FHE508373 Fasciola hepatica microsatellite DNA, clone FH25
          Length = 749

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 739 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 689



to top

>emb|AJ417488.2|SIN417488 Shuttle integration vector pPL1
          Length = 6094

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 47 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 97



to top

>emb|AJ417449.2|SIN417449 Shuttle integration vector pPL2
          Length = 6116

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 46 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 96



to top

>gb|AF251497.1| Cloning vector HKBS1, complete sequence
          Length = 12538

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 7883 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 7833



to top

>gb|AF187996.1| Promoter probe vector pPR9TT, complete sequence
          Length = 9388

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 8920 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 8870



to top

>gb|AF140579.1| Integration vector mini-CTX-lacZ, complete sequence
          Length = 8875

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 4220 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4170



to top

>gb|AF140577.1| Integration vector mini-CTX2, complete sequence
          Length = 6755

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 955 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 905



to top

>gb|AF140576.1| Integration vector mini-CTX1, complete sequence
          Length = 5610

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 955 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 905



to top

>gb|L25927.1|YSPSEQA Shuttle vector pJK148, complete sequence
          Length = 5343

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2973 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3023



to top

>gb|DQ452049.1| Binary vector pGPro1, complete sequence
          Length = 8833

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 8829 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 8779



to top

>gb|AY115560.1| Transposon delivery vector pSC189, complete sequence
          Length = 6982

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2752 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2702



to top

>gb|AD001531.1|SYNPGR8V Cloning vector pGR8, complete sequence
          Length = 9655

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 7436 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 7386



to top

>gb|AY301066.1| Transposition vector RescueMu, complete sequence
          Length = 4739

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 754 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 804



to top

>gb|AY291460.1| Shuttle vector pNG168, complete sequence
          Length = 8960

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 4607 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4657



to top

>gb|L25928.3|YSPSEQB Shuttle vector pJK210, complete sequence
          Length = 5032

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2662 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2712



to top

>emb|AJ278283.1|ACL278283 Cloning vector pBRINT-TsKm
          Length = 8310

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1205 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1155



to top

>emb|AJ278282.1|ACL278282 Cloning vector pBRINT-TsGm
          Length = 7922

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1205 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1155



to top

>emb|AJ278281.1|ACL278281 Cloning vector pBRINT-TsCm
          Length = 8094

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1205 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1155



to top

>emb|AJ278280.1|CVE278280 Cloning vector pBRINTs-Kan2
          Length = 8405

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1205 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1155



to top

>emb|AJ278279.1|CVE278279 Cloning vector pBRINTs-Gen4
          Length = 8017

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1205 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1155



to top

>emb|AJ278278.1|CVE278278 Cloning vector pBRINTs-Cat2
          Length = 8201

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1205 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1155



to top

>emb|AJ277653.1|ECO277653 Escherichia coli plasmid pGBG1
          Length = 7620

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 6225 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 6175



to top

>emb|AJ277560.1|LES277560 Lycopersicon esculentum partial mRNA for putative asparaginyl-tRNA
           synthetase (ats1 gene)
          Length = 799

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 320 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 370



to top

>emb|AJ277471.1|OSA277471 Oryza sativa rbbi2-4 gene for putative Bowman Bird trypsin
          inhibitor
          Length = 3036

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 4  cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 54



to top

>emb|AJ277206.1|CSI277206 Camellia sinensis gene for s-adenosylmethinonine synthetase
          Length = 1776

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 49 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 99



to top

>emb|AJ237707.1|YLI237707 Yarrowia lipolytica odc gene for ornithine decarboxylase
          Length = 2599

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2532 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2582



to top

>emb|AJ868289.1| Transconjugation plasmid pBMK1
          Length = 8613

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 55  cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 105



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Minus

                                               
Query: 13 tcgacggcatcgataagcttgatatcgaattcctgca 49
          ||||||| |||||||||||||||||||||||||||||
Sbjct: 37 tcgacggtatcgataagcttgatatcgaattcctgca 1



to top

>gb|AY733072.1| Cloning vector pSW29, complete sequence
          Length = 1723

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 56  cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 106



to top

>gb|AY733065.1| Cloning vector pSW23, complete sequence
          Length = 1582

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 56  cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 106



to top

>emb|AJ416708.1|PDE416708 Populus deltoides MER locus, genomic DNA, cultivar S9-2
          Length = 95055

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                                
Query: 1     cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
             ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 95008 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 94958



to top

>gb|AF531173.1| Cloning vector pDblet, complete sequence
          Length = 6238

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2670 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2720



to top

>gb|AF504908.1| Cloning vector pBBRT, complete sequence
          Length = 5973

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3312 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3262



to top

>dbj|AB114435.1| Pseudorasbora parva DNA, microsatelite marker PA19
          Length = 371

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 338 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 288



to top

>gb|AF402295.1| pk[BIG-alpha] piggyBac transformation vector, complete sequence
          Length = 7414

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1147 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1097



to top

>gb|DQ236098.1| Himar1-delivery and mutagenesis vector pFNLTP16 H3, complete sequence
          Length = 10027

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3452 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3502



to top

>gb|AF309798.1|AF309798 Clupea pallasi microsatellite Cha134 sequence
          Length = 508

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 468 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 418



to top

>gb|AF309795.1|AF309795 Clupea pallasi microsatellite Cha120 sequence
          Length = 656

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 613 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 563



to top

>gb|AF309794.1|AF309794 Clupea pallasi microsatellite Cha115 sequence
          Length = 945

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 906 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 856



to top

>gb|AF309793.1|AF309793 Clupea pallasi microsatellite Cha113 sequence
          Length = 525

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 44 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 94



to top

>gb|AF309790.1|AF309790 Clupea pallasi microsatellite Cha100 sequence
          Length = 678

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 629 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 579



to top

>gb|AF519494.1| Shuttle vector pSpcP-lac, complete sequence
          Length = 4570

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 4193 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4143



to top

>gb|AF411123.1|AF411123 Transposon vector phiMycoMarT7, complete sequence
          Length = 2068

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 809 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 759



to top

>gb|AF174133.1|AF174133 Cloning vector pRS4213, complete sequence
          Length = 8182

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 4470 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4520



to top

>gb|AF174132.1|AF174132 Cloning vector pRS4210, complete sequence
          Length = 7168

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3456 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3506



to top

>gb|AF174131.1|AF174131 Cloning vector pRS4110, complete sequence
          Length = 6333

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3449 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3499



to top

>emb|AJ620495.1| Mus musculus partial mRNA for non-selective cation channel TRPV1
            (trpv1 gene)
          Length = 2669

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2650 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2600



to top

>gb|AY237648.1| Cloning vector pHR50, complete sequence
          Length = 11973

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                                
Query: 1     cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
             ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 10238 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 10288



to top

>gb|AY237649.1| Cloning vector pHR3-km, complete sequence
          Length = 6762

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 5027 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 5077



to top

>gb|U56995.1|U56995 Cloning vector pGreenscript A complete sequence
          Length = 3062

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 756 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 806



to top

>gb|AY008370.1| Glossina palpalis palpalis clone Pgp14 microsatellite sequence
          Length = 765

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 23 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 73



to top

>gb|AY008368.1| Glossina palpalis palpalis clone Pgp29 microsatellite sequence
          Length = 1001

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 28 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 78



to top

>gb|AY034154.1| Cloning vector pIDN4, complete sequence
          Length = 2059

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 80  cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 130



to top

>gb|AF517126.1| Cloning vector pSPC-lac, complete sequence
          Length = 2650

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2273 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2223



to top

>emb|AJ626721.1| Acetobacter pasteurianus partial ITS1, strain CCM 3615
          Length = 913

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 40 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 90



to top

>gb|AY785149.1| Cloning vector pFL122, complete sequence
          Length = 8652

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 8252 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 8202



to top

>gb|AY785148.1| Suicide plasmid pEE3, complete sequence
          Length = 6393

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 6076 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 6026



to top

>gb|AY237647.1| Cloning Vector pHRGFPGUS, complete sequence
          Length = 10313

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 8578 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 8628



to top

>gb|AF327894.1|AF327894 Cloning vector pExchange 1, complete sequence
          Length = 3602

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 748 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 698



to top

>dbj|AB119275.1| Mus musculus GATA6 gene, exon 1
          Length = 12813

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2212 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2262



to top

>gb|AF309797.1|AF309797 Clupea pallasi microsatellite Cha128 sequence
          Length = 671

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 41 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 91



to top

>gb|U64449.2|CVU64449 Cloning vector pOPRSVIMCS from Lacswitch II System, complete sequence
          Length = 5647

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3109 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3159



to top

>gb|AY196821.1| PiggyBac helper plasmid pBlu-uTp, complete sequence
          Length = 7085

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 4874 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4824



to top

>gb|AF178453.1|AF178453 Integration vector pCD13PSK aminoglycoside adenyltransferase (aadA)
            and beta-galactosidase alpha peptide (lacZa) genes,
            complete cds
          Length = 4549

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 4048 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4098



to top

>gb|AF178452.1|AF178452 Integration vector pCD13PKS aminoglycoside adenyltransferase (aadA)
            and beta-galactosidase alpha peptide (lacZa) genes,
            complete cds
          Length = 4549

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 4135 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4085



to top

>gb|AF178450.1|AF178450 Integration vector pCD11PSK chloramphenicol transacetylase (cat) and
            beta-galactosidase alpha peptide (lacZa) genes, complete
            cds
          Length = 3485

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2984 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3034



to top

>gb|AF178449.1|AF178449 Integration vector pCD11PKS chloramphenicol transacetylase (cat) and
            beta-galactosidase alpha peptide (lacZa) genes, complete
            cds
          Length = 3485

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3071 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3021



to top

>dbj|AB005559.1| Mus musculus DNA for cyclin G, complete cds
          Length = 7846

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 61  cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 111



to top

>gb|AF153422.1|AF153422 Cloning vector pTG8, complete sequence
          Length = 3417

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 759 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 709



to top

>gb|M74016.1|YSCTRAM2 Cloning vector pYADE4 TRP1 and AMPr genes, complete cds
          Length = 6037

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 8  cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 58



to top

>gb|L08785.1|SYNBLKSPV BlueScribe KS Plus cloning vector
          Length = 2964

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 750 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 700



to top

>gb|M22848.1|SYNPLKRB Cloning vector pUC129 DNA, polylinker region
          Length = 147

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 43 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 93



to top

>gb|M22847.1|SYNPLKRA Cloning vector pUC128 DNA, polylinker region
          Length = 144

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 118 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 68



to top

>emb|AJ277561.1|LES277561 Lycopersicon esculentum partial mRNA for putative glutamine
           synthase (gts1 gene)
          Length = 905

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 656 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 606



to top

>emb|X79425.1|ATAG4 A.thaliana microsatellite [repeated motif (tc)7]
          Length = 280

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 38 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 88



to top

>gb|AF135243.1|MMFBLN2S06 Mus musculus fibulin-2 (Fbln2) gene, exon 6
          Length = 490

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 56  cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 106



to top

>gb|U46018.1|CVU46018 Cloning vector pCRSCRIPT Cam, complete sequence
          Length = 3399

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 663 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>gb|U46017.1|CVU46017 Cloning vector pCRSCRIPT SK[+], complete sequence
          Length = 2961

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 663 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>gb|AF139061.1|AF139061 Binary vector pCB301, complete sequence
          Length = 3574

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3397 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3347



to top

>gb|AF092842.1|AF092842 Mycobacterium marinum G13 promoter construct
          Length = 766

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 518 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 468



to top

>emb|X81813.1|SCCDC1 S.cerevisiae CDC1 gene
          Length = 2664

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 8  cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 58



to top

>gb|AY568055.1| Cloning vector pAGRIKOLA, complete sequence
          Length = 10459

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3888 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3938



to top

>gb|AF071266.1|AF071266 Danio rerio homeobox protein (hoxc6b) gene, complete cds
          Length = 1972

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 12 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 62



to top

>gb|U47947.1|CVU47947 Cloning vector pGreenscript I, complete sequence including green
           fluorescent protein (AGP1) mRNA, partial cds
          Length = 3062

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 756 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 806



to top

>emb|AJ428509.1|MMU428509 Mus musculus partial NID-2 gene for nidogen-2, exon 15
          Length = 1067

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 43 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 93



to top

>emb|AJ428508.1|MMU428508 Mus musculus partial NID-2 gene for nidogen-2, exon 14
          Length = 813

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 777 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 727



to top

>gb|U43955.1|XXU43955 Expression vector pBRz, complete cds
          Length = 2998

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 663 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>dbj|D85525.1|SYNPBEN66 Cloning vector pBEN66 DNA for aminoglycoside 3'-phosphotransferase,
           beta-lactamase, complete cds
          Length = 3306

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 58  cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 108



to top

>emb|Y09374.1|ASPGREEN2 Artificial sequences, plasmid vector pGreen-2
          Length = 3633

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2307 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2257



to top

>gb|AY557620.1| Shuttle vector pELS100, complete sequence
          Length = 7022

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 6528 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 6578



to top

>emb|X52330.1|ARBL2SKM pBluescript II SK(-) vector DNA, phagemid excised from lambda ZAPII
          Length = 2961

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 663 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>emb|X52329.1|ARBL2KSM pBluescript II KS(-) vector DNA, phagemid excised from lambda ZAPII
          Length = 2961

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 750 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 700



to top

>emb|X52328.1|ARBL2SKP pBluescript II SK(+) vector DNA, phagemid excised from lambda ZAPII
          Length = 2961

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 663 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>emb|X52327.1|ARBL2KSP pBluescript II KS(+) vector DNA, phagemid excised from lambda ZAPII
          Length = 2961

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 750 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 700



to top

>emb|X52331.1|ARBLKSP pBluescript KS(+) vector DNA, phagemid excised from lambda ZAP
          Length = 2958

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 750 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 700



to top

>emb|X52326.1|ARBLKSM pBluescript KS(-) vector DNA, phagemid excised from lambda ZAP
          Length = 2958

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 750 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 700



to top

>emb|X52325.1|ARBLSKP pBluescript SK(+) vector DNA, phagemid excised from lambda ZAP
          Length = 2958

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 663 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>emb|X52324.1|ARBLSKM pBluescript SK(-) vector DNA, phagemid excised from lambda ZAP
          Length = 2958

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 663 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>emb|AJ403984.1|CVE403984 Cloning vector pBPSKan2
          Length = 4358

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2058 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2108



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 661 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 711



to top

>emb|AJ403983.1|CVE403983 Cloning vector pBPSGen4
          Length = 3970

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1670 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1720



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 661 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 711



to top

>emb|AJ403982.1|CVE403982 Cloning vector pBPSCat2
          Length = 4154

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1854 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1904



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 661 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 711



to top

>emb|AJ005330.1|ASAJ5330 pGAII(-) SK positive selection cloning vector gltS gene
          Length = 4670

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1857 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1907



to top

>emb|AJ005329.1|ASAJ5329 pGAII(-) KS positive selection cloning vector gltS gene
          Length = 4670

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1944 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1894



to top

>emb|AJ005327.1|ASAJ5327 pGAII(+) SK positive selection cloning vector gltS gene
          Length = 4670

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1524 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1474



to top

>emb|AJ005326.1|ASAJ5326 pGAII(+) KS positive selection cloning vector gltS gene
          Length = 4670

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1437 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1487



to top

>emb|AJ005324.1|ASAJ5324 pCP1(-) SK positive selection cloning vector gltS gene
          Length = 6340

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1058 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1008



to top

>emb|AJ005323.1|ASAJ5323 pCP1(-) KS positive selection cloning vector gltS gene
          Length = 6340

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 971  cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1021



to top

>emb|AJ007829.1|CVE7829 Cloning Vector pGreen
          Length = 3228

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 787 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 837



to top

>emb|X93517.1|ECMSASB3 Equus caballus microsatellite DNA marker (clone ASB3)
          Length = 481

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 44 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 94



to top

>emb|AM179852.1| Synthetic construct nptI gene for aminoglycoside
            3'-phosphotransferase and bla gene for beta-lactamase
          Length = 4155

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1944 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1894



to top

>emb|Z29381.1|ECMPZ004 Equus caballus (mpz006) microsatellite DNA
          Length = 344

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1  cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 51



to top

>gb|DQ225752.1| Immobile Ac/T-DNA vector pNU400, complete sequence
          Length = 15970

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 9356 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 9306



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgat 35
            ||||||||||||||||||| |||||||||||||||
Sbjct: 2279 cccccctcgaggtcgacggtatcgataagcttgat 2313



to top

>gb|DQ225751.1| Immobile Ac/T-DNA vector pKU352NA, complete sequence
          Length = 18090

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 9356 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 9306



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgat 35
            ||||||||||||||||||| |||||||||||||||
Sbjct: 2279 cccccctcgaggtcgacggtatcgataagcttgat 2313



to top

>gb|U35235.1|XXU35235 Plasmid pBSL167 cloning vector, complete sequence
          Length = 3345

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1917 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1967



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 624 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 674



to top

>gb|U35137.1|XXU35137 Plasmid pBSL99 cloning vector, complete sequence
          Length = 4285

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1987 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2037



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 750 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 700



to top

>gb|U35136.1|XXU35136 Plasmid pBSL97 cloning vector, complete sequence
          Length = 4289

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2078 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2028



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 663 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>gb|U35135.1|XXU35135 Plasmid pBSL193 cloning vector, complete sequence
          Length = 5275

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2977 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3027



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 663 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>gb|U35134.1|XXU35134 Plasmid pBSL190 cloning vector, complete sequence
          Length = 4480

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2182 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2232



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 663 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>gb|U35133.1|XXU35133 Plasmid pBSL175 cloning vector, complete sequence
          Length = 4252

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2824 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2874



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 624 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 674



to top

>gb|U35132.1|XXU35132 Plasmid pBSL168 cloning vector, complete sequence
          Length = 3357

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1915 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1965



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 711 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 661



to top

>gb|U35131.1|XXU35131 Plasmid pBSL159 cloning vector, complete sequence
          Length = 4144

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2789 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2739



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 624 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 674



to top

>gb|U35130.1|XXU35130 Plasmid pBSL142 cloning vector, complete sequence
          Length = 4669

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2371 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2421



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 663 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>gb|U35129.1|XXU35129 Plasmid pBSL141 cloning vector, complete sequence
          Length = 3886

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1588 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1638



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 663 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>gb|U35128.1|XXU35128 Plasmid pBSL130 cloning vector, complete sequence
          Length = 5035

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2737 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2787



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 663 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>gb|U35127.1|XXU35127 Plasmid pBSL128 cloning vector, complete sequence
          Length = 5060

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2762 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2812



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 663 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>gb|U35126.1|XXU35126 Plasmid pBSL121 cloning vector, complete sequence
          Length = 4051

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1753 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1803



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 663 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>gb|U35125.1|XXU35125 Plasmid pBSL119 cloning vector, complete sequence
          Length = 4842

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2544 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2594



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 663 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>emb|AJ621843.1| Acetobacter pasteurianus partial 23S rRNA gene, strain CCM 2374
          Length = 845

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 814 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 764



to top

>gb|AF072999.1|AF072999 Cloning vector pCMVTAG3c, complete sequence
          Length = 4328

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 780 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 730



to top

>gb|AF072998.1|AF072998 Cloning vector pCMVTAG3b, complete sequence
          Length = 4327

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 779 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 729



to top

>gb|AF072997.1|AF072997 Cloning vector pCMVTAG3a, complete sequence
          Length = 4326

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 778 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 728



to top

>gb|AF072540.1|AF072540 Cloning vector pCMVTAG2c, complete sequence
          Length = 4325

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 777 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 727



to top

>gb|AF072539.1|AF072539 Cloning vector pCMVTAG2b, complete sequence
          Length = 4324

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 776 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 726



to top

>gb|AF072538.1|AF072538 Cloning vector pCMVTAG2a, complete sequence
          Length = 4323

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 775 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 725



to top

>gb|AF067646.1|AF067646 Cloning vector pCMV-scriptEX, complete sequence
          Length = 4307

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 748 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 698



to top

>gb|AF028239.1|AF028239 Mammalian expression vector pCMV-Script, complete sequence
          Length = 4278

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 748 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 698



to top

>gb|AF016889.1|AF016889 Cloning vector pWSK29, complete sequence
          Length = 5434

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1795 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1845



to top

>emb|X91477.1|BSPX91477 Uncultured bacterium partial 16S rRNA gene (clone group A54n)
          Length = 338

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 32 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 82



to top

>gb|AF015771.1|AF015771 Magnaporthe grisea putative transcriptional regulator (CON7) gene,
            complete cds
          Length = 3240

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1692 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1742



to top

>gb|U93719.1| Cloning vector pRS422 with 2micron ADE2 marker, complete sequence
          Length = 6868

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3158 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3208



to top

>gb|U93718.1| Cloning vector pRS412 with CEN/ARS ADE2 marker, complete sequence
          Length = 6042

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3158 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3208



to top

>gb|U93717.1| Cloning vector pRS402 with ADE2 marker, complete sequence
          Length = 5528

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3158 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3208



to top

>gb|U93716.1| Cloning vector pRS421 with 2micron MET15 marker, complete sequence
          Length = 6233

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2523 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2573



to top

>gb|U93715.1| Cloning vector pRS411 with CEN/ARS MET15 marker, complete sequence
          Length = 5407

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2523 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2573



to top

>gb|U93714.1| Cloning vector pRS401 with MET15 marker, complete sequence
          Length = 4893

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2523 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2573



to top

>gb|U93713.1| Cloning vector pRS400 with kanMX4 marker, complete sequence
          Length = 4755

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2385 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2435



to top

>gb|U66313.1|U66313 Expression vector pUHS*2Plac/ara-1 MCS1, complete sequence
          Length = 4004

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 531 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 581



to top

>dbj|AB241267.1| Verasper moseri DNA, microsatellite marker Vemos64
          Length = 421

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 397 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 347



to top

>gb|U40860.1|NMU40860 Neisseria meningitidis hemoglobin receptor (hmbR) gene, complete cds
          Length = 2568

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2510 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2460



to top

>gb|U64694.1|SCU64694 Yeast integrating vector pRSQ2-URA3, complete sequence
          Length = 5056

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2833 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2883



to top

>gb|U34887.1|U34887 Yeast integrating vector pRS306 containing a fragment of lacZ
          Length = 5187

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2090 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2040



to top

>emb|AJ312393.1|CTR312393 Chloroplast transformation vector pRB95
          Length = 7626

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 7563 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 7513



to top

>emb|AJ312392.1|CTR312392 Chloroplast transformation vector pRB94
          Length = 7626

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 7461 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 7511



to top

>emb|X91293.1|BSPX91293 Bacterial sp. partial 16S rRNA gene (clone group G41)
          Length = 322

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1  cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 51



to top

>gb|U03442.1|PRS316 Yeast centromere vector pRS316 with URA3 marker, complete sequence
          Length = 4887

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2090 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2040



to top

>gb|U03441.1|PRS315 Yeast centromere vector pRS315 with LEU2 marker, complete sequence
          Length = 6018

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3221 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3171



to top

>gb|U03440.1|PRS314 Yeast centromere vector pRS314 with TRP1 marker, complete sequence
          Length = 4783

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1986 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1936



to top

>gb|U03439.1|PRS313 Yeast centromere vector pRS313 with HIS3 marker, complete sequence
          Length = 4967

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2170 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2120



to top

>gb|U03438.1|PRS306 Yeast integrative vector pRS306 with URA3 marker, complete sequence
          Length = 4373

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2090 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2040



to top

>gb|U03437.1|PRS305 Yeast integrative vector pRS305 with LEU2 marker, complete sequence
          Length = 5504

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3221 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3171



to top

>gb|U03436.1|PRS304 Yeast integrative vector pRS304 with TRP1 marker, complete sequence
          Length = 4267

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1984 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1934



to top

>gb|U03435.1|PRS303 Yeast integrative vector pRS303 with HIS3 marker, complete sequence
          Length = 4443

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2170 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2120



to top

>emb|Y13161.1|SSMSAT60 Sus scrofa microsatellite DNA isolate pGC.60
          Length = 1350

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 13 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 63



to top

>gb|U03451.1|PRS426 Yeast episomal vector pRS426 with URA3 marker, complete sequence
          Length = 5726

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2014 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2064



to top

>gb|U03452.1|PRS425 Yeast episomal vector pRS425 with LEU2 marker, complete sequence
          Length = 6849

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3137 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3187



to top

>gb|U03453.1|PRS424 Yeast episomal vector pRS424 with TRP1 marker, complete sequence
          Length = 5616

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1904 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1954



to top

>gb|U03454.1|PRS423 Yeast episomal vector pRS423 with HIS3 marker, complete sequence
          Length = 5797

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2086 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2136



to top

>gb|U03450.1|PRS416 Yeast centromere vector pRS416 with URA3 marker, complete sequence
          Length = 4898

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2014 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2064



to top

>gb|U03449.1|PRS415 Yeast centromere vector pRS415 with LEU2 marker, complete sequence
          Length = 6021

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3137 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3187



to top

>gb|U03448.1|PRS414 Yeast centromere vector pRS414 with TRP1 marker, complete sequence
          Length = 4788

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1904 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1954



to top

>gb|U03447.1|PRS413 Yeast centromere vector pRS413 with HIS3 marker, complete sequence
          Length = 4970

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2086 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2136



to top

>gb|U03446.1|PRS406 Yeast integrative vector pRS406 with URA3 marker, complete sequence
          Length = 4384

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2014 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2064



to top

>gb|U03445.1|PRS405 Yeast integrative vector pRS405 with LEU2 marker, complete sequence
          Length = 5507

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3137 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3187



to top

>gb|U03444.1|PRS404 Yeast integrative vector pRS404 with TRP1 marker, complete sequence
          Length = 4274

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1904 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1954



to top

>gb|U03443.1|PRS403 Yeast integrative vector pRS403 with HIS3 marker, complete sequence
          Length = 4456

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2086 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2136



to top

>gb|U14125.1|CVU14125 Cloning vector pSG926, HIS4-based plasmid, complete sequence
          Length = 5634

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 764 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 714



to top

>gb|U14122.1|CVU14122 Cloning vector pSG935, HIS4-based plasmid, complete sequence
          Length = 5639

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 694 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 744



to top

>gb|U14120.1|CVU14120 Cloning vector pSG927, HIS4-based plasmid, complete sequence
          Length = 5634

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 677 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 727



to top

>gb|L08874.1|SYNPHSCSKV PhageScript SK cloning vector
          Length = 7372

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 6370 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 6320



to top

>gb|L08786.1|SYNBLSKMV BlueScribe SK Minus cloning vector
          Length = 2964

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 663 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>gb|L08784.1|SYNBLKSMV BlueScribe KS Minus cloning vector
          Length = 2964

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 750 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 700



to top

>gb|L08787.1|SYNBLDKPV BlueScribe SK Plus cloning vector
          Length = 2964

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 663 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>emb|AJ007320.1|HSA7320 Homo sapiens mRNA for immunoglobulin heavy chain variable region,
           clone KC4
          Length = 308

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 294 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 244



to top

>gb|L11060.1|SYNECOYST Cloning vector sequence (E. coli/yeast/phage P1) ADH2 gene,
          promoter; beta-lactamase gene; TRP1 gene; CYC1 gene,
          terminator; and two replication origins
          Length = 6445

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 10 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 60



to top

>dbj|AB005666.1| Homo sapiens mRNA for GTPase-activating protein, complete cds
          Length = 3885

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3847 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3797



to top

>dbj|AB039884.1| Myxococcus xanthus accB, accA genes for acetyl-CoA carboxylase
            carboxyltransferase, acetyl-CoA carboxylase biotin
            carboxylase subunit, complete cds
          Length = 3526

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3523 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3473



to top

>emb|AJ294956.1|CCA294956 Catla catla microsatellite DNA, clone Cc8
          Length = 392

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 5  cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 55



to top

>gb|AY189981.1| Expression vector pBS-35S-YFP, complete sequence
          Length = 4789

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                             
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 50
           ||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 662 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 711



to top

>gb|AY189980.1| Expression vector pBS-35S-Rluc, complete sequence
          Length = 5005

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                             
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 50
           ||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 662 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 711



to top

>gb|DQ015899.1| Synthetic construct loxP-URA3-loxP disruption cassette, complete
            sequence
          Length = 1720

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 49/50 (98%)
 Strand = Plus / Minus

                                                              
Query: 1    cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 50
            ||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 1664 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 1615



to top

>emb|Z70242.1|TSAL6BGLT Thermococcus sp. AL662 bglT gene
          Length = 1515

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                            
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 50
          ||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 9  cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 58



to top

>gb|AF309796.1|AF309796 Clupea pallasi microsatellite Cha125 sequence
          Length = 591

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                            
Query: 2  ccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          |||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 7  ccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 56



to top

>gb|AY995141.1| Cloning vector pBS 35S attR-YFP, complete sequence
          Length = 6500

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                             
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 50
           ||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 662 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 711



to top

>gb|AY995140.1| Cloning vector pBS 35S attR-hRluc, complete sequence
          Length = 6716

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                             
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 50
           ||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 662 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 711



to top

>gb|AY995139.1| Cloning vector pBS 35S attR-Rluc, complete sequence
          Length = 6716

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                             
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 50
           ||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 662 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 711



to top

>gb|AY995138.1| Cloning vector pBS 35S hRluc-attR, complete sequence
          Length = 6781

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                             
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 50
           ||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 662 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 711



to top

>gb|AY995137.1| Cloning vector pBS 35S YFP-attR, complete sequence
          Length = 6565

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                             
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 50
           ||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 662 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 711



to top

>gb|AY995136.1| Cloning vector pBS 35S Rluc-attR, complete sequence
          Length = 6781

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                             
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 50
           ||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 662 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 711



to top

>gb|AY189985.1| Expression vector pBS-35S-YFP-Ala, complete sequence
          Length = 4823

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                             
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 50
           ||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 662 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 711



to top

>gb|AY189984.1| Expression vector pBS-35S-Ala-YFP, complete sequence
          Length = 4835

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                             
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 50
           ||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 662 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 711



to top

>gb|AY189983.1| Expression vector pBS-35S-Rluc-Ala, complete sequence
          Length = 5039

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                             
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 50
           ||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 662 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 711



to top

>gb|AY189982.1| Expression vector pBS-35S-Ala-Rluc, complete sequence
          Length = 5051

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                             
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 50
           ||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 662 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 711



to top

>emb|AJ012010.1|CCA012010 Cyprinus carpio partial type II rhodopsin gene, 3' flanking region
          Length = 360

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 49/50 (98%)
 Strand = Plus / Minus

                                                             
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 50
           ||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 274 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 225



to top

>emb|Z46733.1|ASP123T Artificial DNA for p123T PCR cloning vector
          Length = 3003

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                             
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 50
           ||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 663 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 712



to top

>gb|AF078810.1|AF078810 Cloning vector pAVA319, complete sequence
          Length = 4780

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                             
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 50
           ||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 662 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 711



to top

>emb|AJ567368.2|VVI567368 Vitis vinifera samdc gene for S-adenosylmethionine decarboxylase
          proenzyme, mRNA
          Length = 1709

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                            
Query: 2  ccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          |||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 15 ccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 64



to top

>emb|Z31700.1|HSHLAXRP H.sapiens HLA-Xrp gene
          Length = 840

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                            
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 50
          ||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 28 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 77



to top

>emb|AJ009991.1|MMU009991 Mus musculus ALDP gene including 5'UTR, partial
          Length = 2687

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                            
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 50
          ||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 21 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 70



to top

>dbj|AB069689.1| Aspergillus oryzae vmaC gene for vacuolar membrane ATPase C, complete
            cds
          Length = 1323

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                              
Query: 2    ccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            |||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1124 ccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1173



to top

>gb|AF219920.1|F219907S14 Homo sapiens diacylglycerol kinase iota (DGKI) gene, exon 16
          Length = 1060

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 48/49 (97%)
 Strand = Plus / Minus

                                                             
Query: 3    cccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1059 cccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1011



to top

>gb|U82676.1|AUU82676 Aphelocoma ultramarina AAAG/CTTT repeat region, locus MJG6
          Length = 799

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 49/51 (96%)
 Strand = Plus / Plus

                                                             
Query: 1  cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          |||||||||||||| |||| |||||||||||||||||||||||||||||||
Sbjct: 11 cccccctcgaggtcnacggtatcgataagcttgatatcgaattcctgcagc 61



to top

>emb|X85744.1|GGMYOGEN Gallus gallus myogenin gene
          Length = 876

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 47/48 (97%)
 Strand = Plus / Plus

                                                          
Query: 4  ccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          |||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1  ccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 48



to top

>dbj|AB241259.1| Verasper moseri DNA, microsatellite marker Vemos44
          Length = 465

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 49/51 (96%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||| ||||| |||||||||||||||||||||||||||||||
Sbjct: 433 cccccctcgaggtngacggtatcgataagcttgatatcgaattcctgcagc 383



to top

>gb|AY436765.1| Binary vector pAMPAT-MCS, complete sequence
          Length = 5274

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 46/47 (97%)
 Strand = Plus / Plus

                                                           
Query: 5    cctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1957 cctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2003



to top

>dbj|AB197018.1| Haliotis discus hannai DNA, microsatellite Hdh1426
          Length = 409

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 49/51 (96%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||||||| |||||||||||||||||||||||| ||||||
Sbjct: 344 cccccctcgaggtcgacggtatcgataagcttgatatcgaattcttgcagc 294



to top

>gb|AF309792.1|AF309792 Clupea pallasi microsatellite Cha107 sequence
          Length = 404

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 46/47 (97%)
 Strand = Plus / Minus

                                                          
Query: 5   cctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 404 cctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 358



to top

>emb|AJ626720.1| Acetobacter pasteurianus partial ITS1, strain CCM 2374
          Length = 832

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 49/51 (96%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           |||||||||||| |||||| |||||||||||||||||||||||||||||||
Sbjct: 793 cccccctcgaggacgacggtatcgataagcttgatatcgaattcctgcagc 743



to top

>gb|AY237646.1| Cloning vector pHRGFPTC, complete sequence
          Length = 9233

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 46/47 (97%)
 Strand = Plus / Minus

                                                           
Query: 5    cctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2683 cctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2637



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 27   aagcttgatatcgaattcctgcag 50
            ||||||||||||||||||||||||
Sbjct: 4182 aagcttgatatcgaattcctgcag 4205



to top

>gb|AF110459.1|AF110459 Cloning vector pBBR1-GFP, complete sequence
          Length = 6640

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 46/47 (97%)
 Strand = Plus / Minus

                                                           
Query: 5    cctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            ||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2683 cctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2637



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 27   aagcttgatatcgaattcctgcag 50
            ||||||||||||||||||||||||
Sbjct: 4182 aagcttgatatcgaattcctgcag 4205



to top

>dbj|AB064982.1| Mus musculus gene for Bmal1, 5' upstream sequence and exon 1
          Length = 8143

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 46/47 (97%)
 Strand = Plus / Plus

                                                         
Query: 5  cctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
          ||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1  cctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 47



to top

>emb|AJ621846.1| Acetobacter aceti partial 23S rRNA gene, strain CCM 3620
          Length = 868

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 49/51 (96%)
 Strand = Plus / Minus

                                                              
Query: 1   cccccctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           |||||||| |||||||||| |||||||||||||||||||||||||||||||
Sbjct: 857 cccccctccaggtcgacggtatcgataagcttgatatcgaattcctgcagc 807



to top

>gb|AF073000.1|AF073000 Cloning vector pCMVTAG4a, complete sequence
          Length = 4319

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 46/47 (97%)
 Strand = Plus / Minus

                                                          
Query: 5   cctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           ||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 744 cctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 698



to top

>gb|DQ019862.2| Saccharomyces cerevisiae expression vector p423GALL, complete
            sequence
          Length = 6483

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 45/46 (97%)
 Strand = Plus / Minus

                                                          
Query: 6    ctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 4150 ctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4105



to top

>gb|DQ019861.2| Saccharomyces cerevisiae expression vector p426GPD, complete sequence
          Length = 6606

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 45/46 (97%)
 Strand = Plus / Minus

                                                          
Query: 6    ctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
            |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 4345 ctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4300



to top

>gb|DQ015897.1| Synthetic construct loxP-ARG4-loxP disruption cassette, complete
            sequence
          Length = 2350

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 45/46 (97%)
 Strand = Plus / Minus

                                                          
Query: 5    cctcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 50
            ||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 2350 cctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 2305



to top

>emb|AJ305371.1|PAN305371 Podospora anserina sod2 gene for manganese superoxide dismutase,
            exons 1-3
          Length = 2077

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 45/46 (97%)
 Strand = Plus / Plus

                                                          
Query: 5    cctcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 50
            ||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 2032 cctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 2077



to top

>gb|AY733070.1| Cloning vector pSW25, complete sequence
          Length = 2175

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 45/46 (97%)
 Strand = Plus / Plus

                                                         
Query: 6   ctcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 51
           |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 508 ctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 553


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,887,380
Number of Sequences: 3902068
Number of extensions: 3887380
Number of successful extensions: 64583
Number of sequences better than 10.0: 861
Number of HSP's better than 10.0 without gapping: 855
Number of HSP's successfully gapped in prelim test: 6
Number of HSP's that attempted gapping in prelim test: 62785
Number of HSP's gapped (non-prelim): 1794
length of query: 628
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 605
effective length of database: 17,143,297,704
effective search space: 10371695110920
effective search space used: 10371695110920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top