ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart14d08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY157498.1| Synechococcus sp. PCC 7942 cosmid 4G8, complete s... 1156 0.0
2dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete g... 1156 0.0
3gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome 1156 0.0
4emb|AJ312391.1|CTR312391 Chloroplast transformation vector pRB70 88 4e-14
5gb|U25061.1|XXU25061 Cloning vector pBBR1MCS-5 REP, LacZ alpha p... 82 3e-12
6gb|U25060.1|XXU25060 Cloning vector pBBR1MCS-4 REP, LacZ alpha p... 82 3e-12
7gb|U25059.1|XXU25059 Cloning vector pBBR1MCS-3 REP and LacZ alph... 82 3e-12
8gb|U23751.1|CVU23751 Cloning vector pBBR1MCS-2 plasmid pBBR1MCS-... 82 3e-12
9gb|U02374.1|XXU02374 Cloning vector pBBR1MCS plasmid pBBR1MCS, c... 82 3e-12
10gb|AY827555.1| Shuttle vector pNAK1, complete sequence 82 3e-12
11gb|DQ019862.2| Saccharomyces cerevisiae expression vector p423GA... 82 3e-12
12gb|DQ228131.1| Moss transformation vector pMBL6, complete sequence 82 3e-12
13gb|DQ228130.1| Moss transformation vector pMBL5, complete sequence 82 3e-12
14gb|DQ230324.1| Shuttle vector pMQ61, complete sequence 82 3e-12
15gb|DQ230323.1| Shuttle vector pMQ52, complete sequence 82 3e-12
16gb|DQ230322.1| Shuttle vector pMQ51, complete sequence 82 3e-12
17gb|AY456904.1| Binary vector pRE1, complete sequence 82 3e-12
18gb|AY672109.3| Bursa aurealis delivery vector pBursa, complete s... 82 3e-12
19gb|DQ490965.1| Mutant Zea mays clone pGR25C22 disrupted DOF1 (Do... 82 3e-12
20gb|DQ019861.2| Saccharomyces cerevisiae expression vector p426GP... 82 3e-12
21gb|AY423865.1| Cloning vector pMK2017, complete sequence 82 3e-12
22gb|AY557621.1| Shuttle vector pELS200, complete sequence 82 3e-12
23gb|M32616.1|SYNDROCL Cloning vector pHS85 heat-shock protein 82/... 82 3e-12
24gb|AY150810.1| Cloning vector pRS327, complete sequence 82 3e-12
25gb|AY150809.1| Cloning vector pRS317, complete sequence 82 3e-12
26gb|AY150808.1| Cloning vector pRS307, complete sequence 82 3e-12
27emb|AJ508373.1|FHE508373 Fasciola hepatica microsatellite DNA, c... 82 3e-12
28emb|AJ417488.2|SIN417488 Shuttle integration vector pPL1 82 3e-12
29emb|AJ417449.2|SIN417449 Shuttle integration vector pPL2 82 3e-12
30gb|AF251497.1| Cloning vector HKBS1, complete sequence 82 3e-12
31gb|AF187996.1| Promoter probe vector pPR9TT, complete sequence 82 3e-12
32gb|AF140579.1| Integration vector mini-CTX-lacZ, complete sequence 82 3e-12
33gb|AF140577.1| Integration vector mini-CTX2, complete sequence 82 3e-12
34gb|AF140576.1| Integration vector mini-CTX1, complete sequence 82 3e-12
35gb|AY436765.1| Binary vector pAMPAT-MCS, complete sequence 82 3e-12
36gb|L25927.1|YSPSEQA Shuttle vector pJK148, complete sequence 82 3e-12
37gb|DQ452049.1| Binary vector pGPro1, complete sequence 82 3e-12
38gb|AY115560.1| Transposon delivery vector pSC189, complete sequence 82 3e-12
39gb|AD001531.1|SYNPGR8V Cloning vector pGR8, complete sequence 82 3e-12
40gb|AY301066.1| Transposition vector RescueMu, complete sequence 82 3e-12
41gb|AY291460.1| Shuttle vector pNG168, complete sequence 82 3e-12
42gb|L25928.3|YSPSEQB Shuttle vector pJK210, complete sequence 82 3e-12
43emb|AJ278283.1|ACL278283 Cloning vector pBRINT-TsKm 82 3e-12
44emb|AJ278282.1|ACL278282 Cloning vector pBRINT-TsGm 82 3e-12
45emb|AJ278281.1|ACL278281 Cloning vector pBRINT-TsCm 82 3e-12
46emb|AJ278280.1|CVE278280 Cloning vector pBRINTs-Kan2 82 3e-12
47emb|AJ278279.1|CVE278279 Cloning vector pBRINTs-Gen4 82 3e-12
48emb|AJ278278.1|CVE278278 Cloning vector pBRINTs-Cat2 82 3e-12
49emb|AJ277653.1|ECO277653 Escherichia coli plasmid pGBG1 82 3e-12
50emb|AJ277560.1|LES277560 Lycopersicon esculentum partial mRNA fo... 82 3e-12
51emb|AJ277471.1|OSA277471 Oryza sativa rbbi2-4 gene for putative ... 82 3e-12
52emb|AJ277206.1|CSI277206 Camellia sinensis gene for s-adenosylme... 82 3e-12
53emb|AJ237707.1|YLI237707 Yarrowia lipolytica odc gene for ornith... 82 3e-12
54emb|AJ868289.1| Transconjugation plasmid pBMK1 82 3e-12
55gb|AY733072.1| Cloning vector pSW29, complete sequence 82 3e-12
56gb|AY733070.1| Cloning vector pSW25, complete sequence 82 3e-12
57gb|AY733067.1| Cloning vector pSW24, complete sequence 82 3e-12
58gb|AY733065.1| Cloning vector pSW23, complete sequence 82 3e-12
59emb|AJ416708.1|PDE416708 Populus deltoides MER locus, genomic DN... 82 3e-12
60gb|AF531173.1| Cloning vector pDblet, complete sequence 82 3e-12
61gb|AF504908.1| Cloning vector pBBRT, complete sequence 82 3e-12
62dbj|AB114435.1| Pseudorasbora parva DNA, microsatelite marker PA19 82 3e-12
63gb|AF219920.1|F219907S14 Homo sapiens diacylglycerol kinase iota... 82 3e-12
64gb|AF402295.1| pk[BIG-alpha] piggyBac transformation vector, com... 82 3e-12
65gb|DQ236098.1| Himar1-delivery and mutagenesis vector pFNLTP16 H... 82 3e-12
66gb|AF309798.1|AF309798 Clupea pallasi microsatellite Cha134 sequ... 82 3e-12
67gb|AF309796.1|AF309796 Clupea pallasi microsatellite Cha125 sequ... 82 3e-12
68gb|AF309795.1|AF309795 Clupea pallasi microsatellite Cha120 sequ... 82 3e-12
69gb|AF309794.1|AF309794 Clupea pallasi microsatellite Cha115 sequ... 82 3e-12
70gb|AF309793.1|AF309793 Clupea pallasi microsatellite Cha113 sequ... 82 3e-12
71gb|AF309792.1|AF309792 Clupea pallasi microsatellite Cha107 sequ... 82 3e-12
72gb|AF309790.1|AF309790 Clupea pallasi microsatellite Cha100 sequ... 82 3e-12
73gb|AF519494.1| Shuttle vector pSpcP-lac, complete sequence 82 3e-12
74gb|AF411123.1|AF411123 Transposon vector phiMycoMarT7, complete ... 82 3e-12
75gb|AF174133.1|AF174133 Cloning vector pRS4213, complete sequence 82 3e-12
76gb|AF174132.1|AF174132 Cloning vector pRS4210, complete sequence 82 3e-12
77gb|AF174131.1|AF174131 Cloning vector pRS4110, complete sequence 82 3e-12
78emb|AJ620495.1| Mus musculus partial mRNA for non-selective cati... 82 3e-12
79gb|AY237648.1| Cloning vector pHR50, complete sequence 82 3e-12
80gb|AY237649.1| Cloning vector pHR3-km, complete sequence 82 3e-12
81gb|U56995.1|U56995 Cloning vector pGreenscript A complete sequence 82 3e-12
82gb|AY008370.1| Glossina palpalis palpalis clone Pgp14 microsatel... 82 3e-12
83gb|AY008368.1| Glossina palpalis palpalis clone Pgp29 microsatel... 82 3e-12
84gb|AY034154.1| Cloning vector pIDN4, complete sequence 82 3e-12
85gb|AF517126.1| Cloning vector pSPC-lac, complete sequence 82 3e-12
86gb|DQ023608.1| Yeast expression vector p426GALL, complete sequence 82 3e-12
87emb|AJ626721.1| Acetobacter pasteurianus partial ITS1, strain CC... 82 3e-12
88gb|AY785149.1| Cloning vector pFL122, complete sequence 82 3e-12
89gb|AY785148.1| Suicide plasmid pEE3, complete sequence 82 3e-12
90gb|AY237647.1| Cloning Vector pHRGFPGUS, complete sequence 82 3e-12
91gb|AY237646.1| Cloning vector pHRGFPTC, complete sequence 82 3e-12
92gb|AF327894.1|AF327894 Cloning vector pExchange 1, complete sequ... 82 3e-12
93dbj|AB119275.1| Mus musculus GATA6 gene, exon 1 82 3e-12
94gb|AF309797.1|AF309797 Clupea pallasi microsatellite Cha128 sequ... 82 3e-12
95gb|AY822461.1| Yeast expression vector pJG515 chloramphenicol re... 82 3e-12
96gb|AY822460.1| Yeast expression vector pJG514 chloramphenicol re... 82 3e-12
97gb|AY822459.1| Yeast expression vector pJG483 chloramphenicol re... 82 3e-12
98gb|AY822458.1| Yeast expression vector pJG482 chloramphenicol re... 82 3e-12
99gb|AY822457.1| Yeast expression vector pJG518 chloramphenicol re... 82 3e-12
100gb|AY822456.1| Yeast expression vector pJG516 chloramphenicol re... 82 3e-12
101gb|AY822455.1| Yeast expression vector pJG484 chloramphenicol re... 82 3e-12
102gb|AY822454.1| Yeast expression vector pJG485 chloramphenicol re... 82 3e-12
103gb|U64449.2|CVU64449 Cloning vector pOPRSVIMCS from Lacswitch II... 82 3e-12
104gb|AF298791.1|AF298791 N-terminal GFP fusion vector pUG36, compl... 82 3e-12
105gb|AF298787.1|AF298787 C-terminal GFP fusion vector pUG35, compl... 82 3e-12
106gb|AF298784.1|AF298784 N-terminal GFP fusion vector pUG34, compl... 82 3e-12
107gb|AF298783.1|AF298783 C-terminal GFP fusion vector pUG23, compl... 82 3e-12
108gb|AY196822.1| PiggyBac transformation vector pB-MCS w+, complet... 82 3e-12
109gb|AY196821.1| PiggyBac helper plasmid pBlu-uTp, complete sequence 82 3e-12
110gb|AF178453.1|AF178453 Integration vector pCD13PSK aminoglycosid... 82 3e-12
111gb|AF178452.1|AF178452 Integration vector pCD13PKS aminoglycosid... 82 3e-12
112gb|AF178450.1|AF178450 Integration vector pCD11PSK chloramphenic... 82 3e-12
113gb|AF178449.1|AF178449 Integration vector pCD11PKS chloramphenic... 82 3e-12
114gb|AF005420.1|AF005420 Expression vector pRIBOTEX, complete sequ... 82 3e-12
115dbj|AB005559.1| Mus musculus DNA for cyclin G, complete cds 82 3e-12
116gb|AF153422.1|AF153422 Cloning vector pTG8, complete sequence 82 3e-12
117emb|X85744.1|GGMYOGEN Gallus gallus myogenin gene 82 3e-12
118gb|M74016.1|YSCTRAM2 Cloning vector pYADE4 TRP1 and AMPr genes, ... 82 3e-12
119gb|L08785.1|SYNBLKSPV BlueScribe KS Plus cloning vector 82 3e-12
120gb|M22848.1|SYNPLKRB Cloning vector pUC129 DNA, polylinker region 82 3e-12
121gb|M22847.1|SYNPLKRA Cloning vector pUC128 DNA, polylinker region 82 3e-12
122emb|AJ277561.1|LES277561 Lycopersicon esculentum partial mRNA fo... 82 3e-12
123emb|X79425.1|ATAG4 A.thaliana microsatellite [repeated motif (tc)7] 82 3e-12
124gb|AF135243.1|MMFBLN2S06 Mus musculus fibulin-2 (Fbln2) gene, ex... 82 3e-12
125gb|U46018.1|CVU46018 Cloning vector pCRSCRIPT Cam, complete sequ... 82 3e-12
126gb|U46017.1|CVU46017 Cloning vector pCRSCRIPT SK[+], complete se... 82 3e-12
127gb|AF139061.1|AF139061 Binary vector pCB301, complete sequence 82 3e-12
128gb|AF092842.1|AF092842 Mycobacterium marinum G13 promoter construct 82 3e-12
129gb|AF110459.1|AF110459 Cloning vector pBBR1-GFP, complete sequence 82 3e-12
130emb|X81813.1|SCCDC1 S.cerevisiae CDC1 gene 82 3e-12
131gb|AY568055.1| Cloning vector pAGRIKOLA, complete sequence 82 3e-12
132gb|AF071266.1|AF071266 Danio rerio homeobox protein (hoxc6b) gen... 82 3e-12
133dbj|AB064982.1| Mus musculus gene for Bmal1, 5' upstream sequenc... 82 3e-12
134gb|U47947.1|CVU47947 Cloning vector pGreenscript I, complete seq... 82 3e-12
135emb|AJ428509.1|MMU428509 Mus musculus partial NID-2 gene for nid... 82 3e-12
136emb|AJ428508.1|MMU428508 Mus musculus partial NID-2 gene for nid... 82 3e-12
137gb|U43955.1|XXU43955 Expression vector pBRz, complete cds 82 3e-12
138dbj|D85525.1|SYNPBEN66 Cloning vector pBEN66 DNA for aminoglycos... 82 3e-12
139emb|Y09374.1|ASPGREEN2 Artificial sequences, plasmid vector pGre... 82 3e-12
140gb|AY557620.1| Shuttle vector pELS100, complete sequence 82 3e-12
141emb|X52330.1|ARBL2SKM pBluescript II SK(-) vector DNA, phagemid ... 82 3e-12
142emb|X52329.1|ARBL2KSM pBluescript II KS(-) vector DNA, phagemid ... 82 3e-12
143emb|X52328.1|ARBL2SKP pBluescript II SK(+) vector DNA, phagemid ... 82 3e-12
144emb|X52327.1|ARBL2KSP pBluescript II KS(+) vector DNA, phagemid ... 82 3e-12
145emb|X52331.1|ARBLKSP pBluescript KS(+) vector DNA, phagemid exci... 82 3e-12
146emb|X52326.1|ARBLKSM pBluescript KS(-) vector DNA, phagemid exci... 82 3e-12
147emb|X52325.1|ARBLSKP pBluescript SK(+) vector DNA, phagemid exci... 82 3e-12
148emb|X52324.1|ARBLSKM pBluescript SK(-) vector DNA, phagemid exci... 82 3e-12
149emb|AJ403984.1|CVE403984 Cloning vector pBPSKan2 82 3e-12
150emb|AJ403983.1|CVE403983 Cloning vector pBPSGen4 82 3e-12
151emb|AJ403982.1|CVE403982 Cloning vector pBPSCat2 82 3e-12
152emb|AJ005330.1|ASAJ5330 pGAII(-) SK positive selection cloning v... 82 3e-12
153emb|AJ005329.1|ASAJ5329 pGAII(-) KS positive selection cloning v... 82 3e-12
154emb|AJ005327.1|ASAJ5327 pGAII(+) SK positive selection cloning v... 82 3e-12
155emb|AJ005326.1|ASAJ5326 pGAII(+) KS positive selection cloning v... 82 3e-12
156emb|AJ005324.1|ASAJ5324 pCP1(-) SK positive selection cloning ve... 82 3e-12
157emb|AJ005323.1|ASAJ5323 pCP1(-) KS positive selection cloning ve... 82 3e-12
158emb|AJ007829.1|CVE7829 Cloning Vector pGreen 82 3e-12
159emb|X93517.1|ECMSASB3 Equus caballus microsatellite DNA marker (... 82 3e-12
160dbj|D88110.1| Homo sapiens DNA, clone:pHGC39 82 3e-12
161emb|AM179852.1| Synthetic construct nptI gene for aminoglycoside... 82 3e-12
162emb|Z29381.1|ECMPZ004 Equus caballus (mpz006) microsatellite DNA 82 3e-12
163gb|DQ232601.1| Receiver Vector p415-CYC1-CRE1a-TR-SSRE-GFP, comp... 82 3e-12
164gb|DQ232600.1| Receiver Vector p415-CYC1-CRE1a-SSRE-GFP, complet... 82 3e-12
165gb|DQ232593.1| Expression Vector p413-TR-SSRE, complete sequence 82 3e-12
166gb|DQ232592.1| Expression Vector p413-SSRE, complete sequence 82 3e-12
167gb|DQ225752.1| Immobile Ac/T-DNA vector pNU400, complete sequence 82 3e-12
168gb|DQ225751.1| Immobile Ac/T-DNA vector pKU352NA, complete sequence 82 3e-12
169emb|AJ567368.2|VVI567368 Vitis vinifera samdc gene for S-adenosy... 82 3e-12
170gb|U35235.1|XXU35235 Plasmid pBSL167 cloning vector, complete se... 82 3e-12
171gb|U35137.1|XXU35137 Plasmid pBSL99 cloning vector, complete seq... 82 3e-12
172gb|U35136.1|XXU35136 Plasmid pBSL97 cloning vector, complete seq... 82 3e-12
173gb|U35135.1|XXU35135 Plasmid pBSL193 cloning vector, complete se... 82 3e-12
174gb|U35134.1|XXU35134 Plasmid pBSL190 cloning vector, complete se... 82 3e-12
175gb|U35133.1|XXU35133 Plasmid pBSL175 cloning vector, complete se... 82 3e-12
176gb|U35132.1|XXU35132 Plasmid pBSL168 cloning vector, complete se... 82 3e-12
177gb|U35131.1|XXU35131 Plasmid pBSL159 cloning vector, complete se... 82 3e-12
178gb|U35130.1|XXU35130 Plasmid pBSL142 cloning vector, complete se... 82 3e-12
179gb|U35129.1|XXU35129 Plasmid pBSL141 cloning vector, complete se... 82 3e-12
180gb|U35128.1|XXU35128 Plasmid pBSL130 cloning vector, complete se... 82 3e-12
181gb|U35127.1|XXU35127 Plasmid pBSL128 cloning vector, complete se... 82 3e-12
182gb|U35126.1|XXU35126 Plasmid pBSL121 cloning vector, complete se... 82 3e-12
183gb|U35125.1|XXU35125 Plasmid pBSL119 cloning vector, complete se... 82 3e-12
184emb|AJ621843.1| Acetobacter pasteurianus partial 23S rRNA gene, ... 82 3e-12
185gb|AF076312.1|AF076312 Cloning vector pCMVTAG5a, complete sequence 82 3e-12
186gb|AF073000.1|AF073000 Cloning vector pCMVTAG4a, complete sequence 82 3e-12
187gb|AF072999.1|AF072999 Cloning vector pCMVTAG3c, complete sequence 82 3e-12
188gb|AF072998.1|AF072998 Cloning vector pCMVTAG3b, complete sequence 82 3e-12
189gb|AF072997.1|AF072997 Cloning vector pCMVTAG3a, complete sequence 82 3e-12
190gb|AF072540.1|AF072540 Cloning vector pCMVTAG2c, complete sequence 82 3e-12
191gb|AF072539.1|AF072539 Cloning vector pCMVTAG2b, complete sequence 82 3e-12
192gb|AF072538.1|AF072538 Cloning vector pCMVTAG2a, complete sequence 82 3e-12
193gb|AF067646.1|AF067646 Cloning vector pCMV-scriptEX, complete se... 82 3e-12
194gb|AF028239.1|AF028239 Mammalian expression vector pCMV-Script, ... 82 3e-12
195gb|AF016889.1|AF016889 Cloning vector pWSK29, complete sequence 82 3e-12
196emb|X91477.1|BSPX91477 Uncultured bacterium partial 16S rRNA gen... 82 3e-12
197gb|AF015771.1|AF015771 Magnaporthe grisea putative transcription... 82 3e-12
198gb|U93719.1| Cloning vector pRS422 with 2micron ADE2 marker, com... 82 3e-12
199gb|U93718.1| Cloning vector pRS412 with CEN/ARS ADE2 marker, com... 82 3e-12
200gb|U93717.1| Cloning vector pRS402 with ADE2 marker, complete se... 82 3e-12
201gb|U93716.1| Cloning vector pRS421 with 2micron MET15 marker, co... 82 3e-12
202gb|U93715.1| Cloning vector pRS411 with CEN/ARS MET15 marker, co... 82 3e-12
203gb|U93714.1| Cloning vector pRS401 with MET15 marker, complete s... 82 3e-12
204gb|U93713.1| Cloning vector pRS400 with kanMX4 marker, complete ... 82 3e-12
205gb|U66313.1|U66313 Expression vector pUHS*2Plac/ara-1 MCS1, comp... 82 3e-12
206dbj|AB241267.1| Verasper moseri DNA, microsatellite marker Vemos64 82 3e-12
207gb|U40860.1|NMU40860 Neisseria meningitidis hemoglobin receptor ... 82 3e-12
208gb|U64694.1|SCU64694 Yeast integrating vector pRSQ2-URA3, comple... 82 3e-12
209gb|DQ269148.1| Yeast centromeric expression vector p416GPD, comp... 82 3e-12
210gb|U34887.1|U34887 Yeast integrating vector pRS306 containing a ... 82 3e-12
211emb|AJ312393.1|CTR312393 Chloroplast transformation vector pRB95 82 3e-12
212emb|AJ312392.1|CTR312392 Chloroplast transformation vector pRB94 82 3e-12
213emb|X91293.1|BSPX91293 Bacterial sp. partial 16S rRNA gene (clon... 82 3e-12
214gb|U03442.1|PRS316 Yeast centromere vector pRS316 with URA3 mark... 82 3e-12
215gb|U03441.1|PRS315 Yeast centromere vector pRS315 with LEU2 mark... 82 3e-12
216gb|U03440.1|PRS314 Yeast centromere vector pRS314 with TRP1 mark... 82 3e-12
217gb|U03439.1|PRS313 Yeast centromere vector pRS313 with HIS3 mark... 82 3e-12
218gb|U03438.1|PRS306 Yeast integrative vector pRS306 with URA3 mar... 82 3e-12
219gb|U03437.1|PRS305 Yeast integrative vector pRS305 with LEU2 mar... 82 3e-12
220gb|U03436.1|PRS304 Yeast integrative vector pRS304 with TRP1 mar... 82 3e-12
221gb|U03435.1|PRS303 Yeast integrative vector pRS303 with HIS3 mar... 82 3e-12
222emb|Y13161.1|SSMSAT60 Sus scrofa microsatellite DNA isolate pGC.60 82 3e-12
223gb|U03451.1|PRS426 Yeast episomal vector pRS426 with URA3 marker... 82 3e-12
224gb|U03452.1|PRS425 Yeast episomal vector pRS425 with LEU2 marker... 82 3e-12
225gb|U03453.1|PRS424 Yeast episomal vector pRS424 with TRP1 marker... 82 3e-12
226gb|U03454.1|PRS423 Yeast episomal vector pRS423 with HIS3 marker... 82 3e-12
227gb|U03450.1|PRS416 Yeast centromere vector pRS416 with URA3 mark... 82 3e-12
228gb|U03449.1|PRS415 Yeast centromere vector pRS415 with LEU2 mark... 82 3e-12
229gb|U03448.1|PRS414 Yeast centromere vector pRS414 with TRP1 mark... 82 3e-12
230gb|U03447.1|PRS413 Yeast centromere vector pRS413 with HIS3 mark... 82 3e-12
231gb|U03446.1|PRS406 Yeast integrative vector pRS406 with URA3 mar... 82 3e-12
232gb|U03445.1|PRS405 Yeast integrative vector pRS405 with LEU2 mar... 82 3e-12
233gb|U03444.1|PRS404 Yeast integrative vector pRS404 with TRP1 mar... 82 3e-12
234gb|U03443.1|PRS403 Yeast integrative vector pRS403 with HIS3 mar... 82 3e-12
235gb|U14125.1|CVU14125 Cloning vector pSG926, HIS4-based plasmid, ... 82 3e-12
236gb|U14122.1|CVU14122 Cloning vector pSG935, HIS4-based plasmid, ... 82 3e-12
237gb|U14120.1|CVU14120 Cloning vector pSG927, HIS4-based plasmid, ... 82 3e-12
238gb|L08874.1|SYNPHSCSKV PhageScript SK cloning vector 82 3e-12
239gb|L08786.1|SYNBLSKMV BlueScribe SK Minus cloning vector 82 3e-12
240gb|L08784.1|SYNBLKSMV BlueScribe KS Minus cloning vector 82 3e-12
241gb|L08787.1|SYNBLDKPV BlueScribe SK Plus cloning vector 82 3e-12
242emb|AJ007320.1|HSA7320 Homo sapiens mRNA for immunoglobulin heav... 82 3e-12
243gb|L11060.1|SYNECOYST Cloning vector sequence (E. coli/yeast/pha... 82 3e-12
244dbj|AB069689.1| Aspergillus oryzae vmaC gene for vacuolar membra... 82 3e-12
245dbj|AB005666.1| Homo sapiens mRNA for GTPase-activating protein,... 82 3e-12
246dbj|AB039884.1| Myxococcus xanthus accB, accA genes for acetyl-C... 82 3e-12
247emb|AJ294956.1|CCA294956 Catla catla microsatellite DNA, clone Cc8 82 3e-12
248gb|AY189981.1| Expression vector pBS-35S-YFP, complete sequence 80 1e-11
249gb|AY189980.1| Expression vector pBS-35S-Rluc, complete sequence 80 1e-11
250gb|DQ015899.1| Synthetic construct loxP-URA3-loxP disruption cas... 80 1e-11
251gb|DQ015897.1| Synthetic construct loxP-ARG4-loxP disruption cas... 80 1e-11
252emb|Z70242.1|TSAL6BGLT Thermococcus sp. AL662 bglT gene 80 1e-11
253emb|AJ305371.1|PAN305371 Podospora anserina sod2 gene for mangan... 80 1e-11
254gb|AY995141.1| Cloning vector pBS 35S attR-YFP, complete sequence 80 1e-11
255gb|AY995140.1| Cloning vector pBS 35S attR-hRluc, complete sequence 80 1e-11
256gb|AY995139.1| Cloning vector pBS 35S attR-Rluc, complete sequence 80 1e-11
257gb|AY995138.1| Cloning vector pBS 35S hRluc-attR, complete sequence 80 1e-11
258gb|AY995137.1| Cloning vector pBS 35S YFP-attR, complete sequence 80 1e-11
259gb|AY995136.1| Cloning vector pBS 35S Rluc-attR, complete sequence 80 1e-11
260gb|AY189985.1| Expression vector pBS-35S-YFP-Ala, complete sequence 80 1e-11
261gb|AY189984.1| Expression vector pBS-35S-Ala-YFP, complete sequence 80 1e-11
262gb|AY189983.1| Expression vector pBS-35S-Rluc-Ala, complete sequ... 80 1e-11
263gb|AY189982.1| Expression vector pBS-35S-Ala-Rluc, complete sequ... 80 1e-11
264emb|AJ012010.1|CCA012010 Cyprinus carpio partial type II rhodops... 80 1e-11
265emb|Z46733.1|ASP123T Artificial DNA for p123T PCR cloning vector 80 1e-11
266gb|AF078810.1|AF078810 Cloning vector pAVA319, complete sequence 80 1e-11
267emb|Z31700.1|HSHLAXRP H.sapiens HLA-Xrp gene 80 1e-11
268emb|AJ009991.1|MMU009991 Mus musculus ALDP gene including 5'UTR,... 80 1e-11
269gb|L29300.1|LEIRIBPP Leishmania chagasi (clone C1) ribosomal pro... 80 1e-11
270gb|AY008367.1| Glossina palpalis palpalis clone Pgp28 microsatel... 78 4e-11
271dbj|AB241258.1| Verasper moseri DNA, microsatellite marker Vemos43 78 4e-11
272gb|U82676.1|AUU82676 Aphelocoma ultramarina AAAG/CTTT repeat reg... 76 2e-10
273dbj|AB060172.1| Misgurnus anguillicaudatus DNA, microsatellite Mac2 76 2e-10
274emb|AJ132233.1|EGE132233 Enterobacter gergoviae glgC (partial) a... 76 2e-10
275dbj|AB081563.1| Paralichthys olivaceus TCRJd-Cd2-L gene for T ce... 76 2e-10
276gb|AF067142.1|AF067142 Cloning vector pSFI polylinker, complete ... 76 2e-10
277emb|AJ621846.1| Acetobacter aceti partial 23S rRNA gene, strain ... 76 2e-10
278dbj|AB241259.1| Verasper moseri DNA, microsatellite marker Vemos44 76 2e-10
279dbj|AB197018.1| Haliotis discus hannai DNA, microsatellite Hdh1426 74 6e-10
280emb|AJ626720.1| Acetobacter pasteurianus partial ITS1, strain CC... 74 6e-10
281dbj|D34625.2| Homo sapiens TBXAS1 gene for thromboxane synthase,... 74 6e-10
282gb|AY303671.1| Broad host range expression vector pMHE7Tc, compl... 72 2e-09
283gb|AY303669.1| Broad host range expression vector pMHE7, complet... 72 2e-09
284gb|AY299697.1| Broad host range expression vector pMHE5Tc, compl... 72 2e-09
285gb|AY299696.1| Broad host range expression vector pMHE5, complet... 72 2e-09
286gb|AY299693.1| Broad host range expression vector pMHE2, complet... 72 2e-09
287emb|Y10120.1|XLHDPA7 Xenopus laevis mRNA for paired box protein,... 72 2e-09
288emb|AJ278266.2|RNO278266 Rattus norvegicus mRNA for SH3-domain b... 72 2e-09
289gb|AY733073.1| Cloning vector pSW29T, complete sequence 72 2e-09
290gb|AY733071.1| Cloning vector pSW25T, complete sequence 72 2e-09
291gb|AY733066.1| Cloning vector pSW23T, complete sequence 72 2e-09
292ref|NM_022693.2| Rattus norvegicus SH3-domain binding protein 4 ... 72 2e-09
293gb|S71728.1| truncated protein {frame 1, multiple cloning site} ... 72 2e-09
294dbj|BA000022.2| Synechocystis sp. PCC 6803 DNA, complete genome 72 2e-09
295gb|AF179625.1|AF179625 Shuttle vector pCS513, complete sequence 72 2e-09
296gb|AF179626.1|AF179626 Expression vector pGP100, complete sequence 72 2e-09
297gb|AF178582.1|AF178582 Expression vector pCS316 complete sequence 72 2e-09
298gb|U46128.1|GGU46128 Gallus gallus cardiac-enriched TEA domain t... 72 2e-09
299gb|AF076778.1|AF076778 Cloning vector pCMVTAG5c, complete sequence 72 2e-09
300gb|AF076777.1|AF076777 Cloning vector pCMVTAG5b, complete sequence 72 2e-09
301gb|AF076311.1|AF076311 Cloning vector pCMVTAG4c, complete sequence 72 2e-09
302gb|AF076310.1|AF076310 Cloning vector pCMVTAG4b, complete sequence 72 2e-09
303gb|DQ289040.1| Gene replacement vector pLAW344, complete sequence 72 2e-09
304emb|AJ002972.1|AFAJ2972 Artemia franciscana mRNA for actin 403, ... 72 2e-09
305gb|M60510.1|MUSBETAA Mouse beta-D-galactosidase fusion protein m... 72 2e-09
306gb|AY944582.1| Cloning vector LUCTRAP-2, complete sequence 70 1e-08
307gb|AY944581.1| Cloning vector LUCTRAP-1, complete sequence 70 1e-08
308gb|AY968054.1| Cloning vector LUCTRAP-3(GW), complete sequence 70 1e-08
309gb|DQ073044.1| Cloning vector LUCTRAP, complete sequence 70 1e-08
310emb|Y09668.1|DRTKLELF1 D.rerio mRNA for tyrosine kinase ligand (... 70 1e-08
311emb|AJ556548.1|DRE556548 Danio rerio mRNA for TRAF4 protein, spl... 70 1e-08
312emb|AJ421626.1|XLA421626 Xenopus laevis LTBP-1 gene for latent T... 70 1e-08
313emb|X92518.1|HSHMGICP H.sapiens mRNA for HMGI-C protein 70 1e-08
314gb|AF298789.1| Recombinase expression vector pSH63, complete seq... 70 1e-08
315gb|AF298785.1| Recombinase expression vector pSH62, complete seq... 70 1e-08
316gb|AF298782.1| Recombinase expression vector pSH47, complete seq... 70 1e-08
317gb|AF298780.1| Recombinase expression vector pSH65, partial sequ... 70 1e-08
318gb|U01668.1|U01668 Phagemid cloning vector pKSS, complete sequence 70 1e-08
319gb|S71730.1| influenza virus hemagglutinin 5' epitope tag=fusion... 70 1e-08
320gb|AY028412.1| YTT vector A, complete sequence 70 1e-08
321gb|AF176801.1|AF176800S2 Homo sapiens oxysterol 7alpha-hydroxyla... 70 1e-08
322dbj|AB108425.1| Xenopus laevis Mitf-M mRNA for micophthalmia-ass... 70 1e-08
323gb|S52444.1|S52444 {cloning vector} [pTF1, host=E.coli, Plasmid ... 70 1e-08
324gb|AF093826.1|AF093826 Plasmodium berghei GTP binding protein (r... 70 1e-08
325dbj|AB040534.1| Streptococcus mutans rgtB, orf1, pac genes for r... 70 1e-08
326gb|U79666.1|HSU79666 Homo sapiens alpha1A-voltage-dependent calc... 70 1e-08
327gb|U70311.1|CVU70311 Filamentous phage display expression clonin... 70 1e-08
328gb|L40071.1|CHKMCW8 Gallus domesticus DNA microsatellite marker ... 70 1e-08
329emb|AJ304860.1|MMU304860 Mus musculus partial Bfsp2 gene for pha... 70 1e-08
330gb|DQ250997.1| Expression vector pMF331, complete sequence 70 1e-08
331emb|AJ277968.1|DME277968 Drosophila melanogaster TRPgamma gene f... 70 1e-08
332emb|AJ277967.1|DME277967 Drosophila melanogaster TRPgamma gene f... 70 1e-08
333emb|X84816.1|HSRNAHST H.sapiens mRNA for hydroxysteroid sulfotra... 70 1e-08
334emb|X83699.1|HSIGF2RX1 Homo sapiens IGF2R gene (subclone pEX1-P) 70 1e-08
335dbj|D83414.1|YSPCUT6C Schizosaccharomyces pombe cut6+ gene for a... 70 1e-08
336gb|AY445093.2| Drosophila lummei heat shock protein Hsp70c pseud... 68 4e-08
337gb|AY598428.1| Expression vector pMF272, complete sequence 68 4e-08
338gb|AY598430.1| Expression vector pMF309, complete sequence 68 4e-08
339gb|AY598429.1| Expression vector pMF280, complete sequence 68 4e-08
340emb|AJ250260.1|CAR250260 Coffea arabica microsatellite DNA, clon... 68 4e-08
341emb|AJ250257.1|CAR250257 Coffea arabica microsatellite DNA, clon... 68 4e-08
342emb|AJ250254.1|CAR250254 Coffea arabica microsatellite DNA, clon... 68 4e-08
343emb|AJ250252.1|CAR250252 Coffea arabica microsatellite DNA, clon... 68 4e-08
344emb|AJ296695.1|PAB296695 Picea abies ATC microsatellite DNA, clo... 68 4e-08
345emb|AJ296686.1|PAB296686 Picea abies ATC microsatellite DNA, clo... 68 4e-08
346gb|AF140578.1| Integration vector mini-CTX-GFP, complete sequence 68 4e-08
347gb|DQ015895.1| Candida integrating vector CIp30, complete sequence 68 4e-08
348gb|DQ015894.1| Candida integrating vector CIp20, complete sequence 68 4e-08
349gb|AF474332.1| Cloning vector pBC214, complete sequence 68 4e-08
350gb|U89315.1|AH005788S07 Homo sapiens nucleophosmin phosphoprotei... 68 4e-08
351gb|AY279344.1| Gene silencing vector pCPCbLCVB.002, complete seq... 68 4e-08
352emb|X94368.1|GGLRPP40G G.gallus gene 37LRP/p40 68 4e-08
353emb|X90729.1|BNPBP3 B.napus mRNA for biotin carboxyl carrier pro... 68 4e-08
354emb|X82786.1|MMKI67 M.musculus mRNA for Ki-67 68 4e-08
355emb|X70842.1|MMFLK1M M.musculus Flk-1 mRNA 68 4e-08
356emb|X58436.1|DMIPOU D.melanogaster I-POU mRNA for a POU-domain p... 68 4e-08
357emb|X55499.1|MMIGEBP1 M.musculus Ig/EBP-1 gene for immunoglobuli... 68 4e-08
358emb|AJ276295.1|CSI276295 Citrus sinensis partial mRNA for ACC sy... 68 4e-08
359emb|AJ854303.1| Branchiostoma floridae partial mRNA for forkhead... 68 4e-08
360emb|AJ489221.2|GGA489221 Gallus gallus mRNA for homeobox protein... 68 4e-08
361emb|AJ277470.1|OSA277470 Oryza sativa rbbi2-3 gene for putative ... 68 4e-08
362emb|AJ252205.1|PSP252205 Pseudanabaena sp. strain PCC 6903 murI,... 68 4e-08
363emb|AJ002685.1|ATPI4KG Arabidopsis thaliana mRNA for Phosphatidy... 68 4e-08
364emb|AJ001727.1|REDNAK Ralstonia sp. CH34 dnaK gene 68 4e-08
365gb|AY454397.1| Cloning vector pTA6, complete sequence 68 4e-08
366emb|Z47173.1|CSPAG13R Calothrix D253 genomic DNA (clone AG13R) 68 4e-08
367emb|Z47159.1|CSPAG5R Calothrix D253 genomic DNA (clone AG5R) 68 4e-08
368dbj|AB233453.1| Oryza sativa (japonica cultivar-group) OsPPCK2L ... 68 4e-08
369dbj|AB233452.1| Oryza sativa (japonica cultivar-group) OsPPCK2S ... 68 4e-08
370dbj|AB226176.1| Aspergillus oryzae cDNA, contig sequence: AoEST3034 68 4e-08
371dbj|AB226023.1| Aspergillus oryzae cDNA, contig sequence: AoEST2879 68 4e-08
372dbj|AB224727.1| Aspergillus oryzae cDNA, contig sequence: AoEST1576 68 4e-08
373dbj|AB224157.1| Aspergillus oryzae cDNA, contig sequence: AoEST0999 68 4e-08
374dbj|AB224122.1| Aspergillus oryzae cDNA, contig sequence: AoEST0964 68 4e-08
375dbj|AB223337.1| Aspergillus oryzae cDNA, contig sequence: AoEST0168 68 4e-08
376dbj|AB213560.1| Xenopus laevis mRNA for ERK5, complete cds 68 4e-08
377gb|U09476.1|XXU09476 Synthetic construct dihydrofolate reductase... 68 4e-08
378emb|CR354251.1| Gallus gallus finished cDNA, clone ChEST901n24 68 4e-08
379gb|AF181970.1|AF181970 Integrating vector CIp10, complete sequence 68 4e-08
380emb|AJ234634.1|HVU234634 Hordeum vulgare genomic DNA fragment; c... 68 4e-08
381emb|Z17399.1|ATORFB Arabidopsis thaliana PIP1b gene 68 4e-08
382gb|AY104397.1| Zea mays PCO152838 mRNA sequence 68 4e-08
383gb|AF134119.1|AF134119 Mus musculus SKD1 (Skd1) gene, complete cds 68 4e-08
384gb|AY663845.1| Cloning vector p2059-RS-nirA, complete sequence 68 4e-08
385gb|AY663844.1| Cloning vector p2059-URA-RS, complete sequence 68 4e-08
386gb|AY663843.1| Cloning vector pZRM2059, complete sequence 68 4e-08
387dbj|AB080947.1| Paralichthys olivaceus TNFR-2 mRNA for tumor nec... 68 4e-08
388emb|AJ574874.1|UBA574874 Uncultured bacterium partial 16S rRNA g... 68 4e-08
389dbj|AK116781.1| Ciona intestinalis cDNA, clone:cieg015b06, full ... 68 4e-08
390gb|AY653732.1| Cloning vector pIYFP IyfP (iyfP) gene, complete cds 68 4e-08
391gb|AY653731.1| Cloning vector pICFP IcfP (icfP) gene, complete cds 68 4e-08
392emb|AM180349.1| Transconjugation vector pROKB1 68 4e-08
393emb|AM180348.1| Transconjugation vector pROCKB2 68 4e-08
394gb|U32628.1|BSU32628 Bacillus sphaericus toxin degrading proteas... 68 4e-08
395gb|U02437.1|XXU02437 Cloning vector pT3/T7-LUC, complete sequence 68 4e-08
396gb|U02430.1|XXU02430 Cloning vector pMAMneoBlue, complete sequence 68 4e-08
397gb|U02449.1|U02449 Cloning vector pDIRECT, complete sequence 68 4e-08
398gb|M94676.1|HUMDINRPTA Homo sapiens dinucleotide repeat polymorp... 68 4e-08
399gb|L40050.1|CHKMCW30 Gallus domesticus DNA microsatellite marker... 68 4e-08
400emb|AJ278625.1|CSU278625 Cuscuta subinclusa chloroplast tRNA-Val... 68 4e-08
401emb|AJ401355.1|CPL401355 Cuscuta platyloba chloroplast 16S rRNA ... 68 4e-08
402emb|AJ401353.1|CCA401353 Cuscuta campestris chloroplast 16S rRNA... 68 4e-08
403gb|U27867.1|SVU27867 Stealth virus clone C16290 T3 68 4e-08
404emb|Z95377.1|HSZ95377 H.sapiens genomic DNA fragment (clone NRLA... 68 4e-08
405gb|L27850.1|HRSTCRAG Equus caballus (clone T131) T-cell receptor... 68 4e-08
406emb|AJ131952.1|OCU131952 Oryctolagus cuniculus pseudogene tpt1-ps1 68 4e-08
407gb|DQ250998.1| Expression vector pMF332, complete sequence 68 4e-08
408emb|Z46785.1|DMMSTBBGE D.melanogaster gene for protamine (mst35Bb) 68 4e-08
409emb|X84002.1|HSTAFII20 H.sapiens TAFII20 mRNA for transcription ... 68 4e-08
410dbj|D89083.1| Oncorhynchus mykiss mRNA for transferrin, complete... 68 4e-08
411dbj|AB027145.1| Rattus norvegicus mRNA for CDCrel-1F, partial cds 68 4e-08
412dbj|AB007810.1| Mus musculus mGLT-1 mRNA, complete cds 68 4e-08
413dbj|AB067774.1| Homo sapiens mRNA for h-SHIPPO 1, complete cds 68 4e-08
414dbj|AB085846.1| Chlorella vulgaris g6pdh mRNA for glucose-6-phos... 68 4e-08
415gb|AY710294.1| Synthetic construct Maa7/X IR artificial transgene 66 2e-07
416emb|AJ868288.1| Transconjugation Plasmid pEMOC2 66 2e-07
417dbj|AB227617.1| Aspergillus oryzae cDNA, contig sequence: AoEST4490 66 2e-07
418dbj|AB226655.1| Aspergillus oryzae cDNA, contig sequence: AoEST3517 66 2e-07
419dbj|AB226652.1| Aspergillus oryzae cDNA, contig sequence: AoEST3514 66 2e-07
420dbj|AB226651.1| Aspergillus oryzae cDNA, contig sequence: AoEST3513 66 2e-07
421dbj|AB226650.1| Aspergillus oryzae cDNA, contig sequence: AoEST3512 66 2e-07
422dbj|AB226043.1| Aspergillus oryzae cDNA, contig sequence: AoEST2899 66 2e-07
423dbj|AB225960.1| Aspergillus oryzae cDNA, contig sequence: AoEST2816 66 2e-07
424dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 66 2e-07
425dbj|AB120408.1| Equus caballus ILT11A mRNA for immunoglobulin-li... 66 2e-07
426emb|AJ228585.1|CVAJ8585 cotton leaf curl virus DNA fragment, iso... 66 2e-07
427gb|AF106619.1|AF106619 Cloning vector pDR1149 complete sequence 66 2e-07
428dbj|AB088845.1| Rana catesbeiana PAalpha mRNA for parvalbumin al... 66 2e-07
429dbj|D14015.1|RATCYCLE Rattus rattus mRNA for cyclin E, complete cds 66 2e-07
430gb|U65078.1|CVU65078 Cloning shuttle vector pNF2214 with kanamyc... 66 2e-07
431gb|U65077.1|CVU65077 Promoter-probe vector pNF2283 with ampicill... 66 2e-07
432gb|L40401.1|HUMORFK Homo sapiens (clone zap128) mRNA, 3' end of cds 66 2e-07
433gb|AF016705.1|HSUBE3AL3 Homo sapiens E6-AP ubiquitin-protein lig... 66 2e-07
434emb|Z79475.1|HSPA9E1 H.sapiens flow-sorted chromosome 6 TaqI fra... 66 2e-07
435dbj|AB045011.1| Homo sapiens hmGluR2 gene for metabotropic gluta... 66 2e-07
436emb|AJ575747.1|LJA575747 Lotus japonicus partial mRNA for argini... 64 6e-07
437emb|AJ005682.1|ATH5682 Arabidopsis thaliana mRNA for inositol 1,... 64 6e-07
438emb|AJ000265.1|SOJ00265 Spinacia oleracea mRNA (nuclear-encoded)... 64 6e-07
439dbj|AB227775.1| Aspergillus oryzae cDNA, contig sequence: AoEST4648 64 6e-07
440dbj|AB226321.1| Aspergillus oryzae cDNA, contig sequence: AoEST3183 64 6e-07
441gb|S63208.1| proteolipid protein (PLP) {5' region, exon 1, promo... 64 6e-07
442ref|NM_008882.1| Mus musculus plexin A2 (Plxna2), mRNA 64 6e-07
443emb|AJ228587.1|CVAJ8587 cotton leaf curl virus DNA fragment, iso... 64 6e-07
444emb|AJ234770.1|HVU234770 Hordeum vulgare genomic DNA fragment; c... 64 6e-07
445emb|X90560.1|PPCAMPROT Physcomitrella patens mRNA for calmodulin 64 6e-07
446gb|U68056.1|DMU68056 Drosophila melanogaster SOX HMG domain prot... 64 6e-07
447gb|L41561.1|MDVFRA Gallid herpesvirus mRNA fragment 64 6e-07
448dbj|D86949.1| Mus musculus mRNA for plexin 2, complete cds 64 6e-07
449gb|U09632.1|XLU09632 Xenopus laevis thrombin receptor mRNA, comp... 64 6e-07
450emb|Y14981.1|BOY14981 Brassica oleracea fae1 gene 62 2e-06
451emb|AJ243692.1|MHO243692 Mycoplasma hominis gap gene encoding gl... 62 2e-06
452dbj|AB226994.1| Aspergillus oryzae cDNA, contig sequence: AoEST3856 62 2e-06
453dbj|AB226654.1| Aspergillus oryzae cDNA, contig sequence: AoEST3516 62 2e-06
454gb|AF433043.1|AF433043 Cloning vector pWS32, complete sequence 62 2e-06
455gb|AF433042.1|AF433042 Cloning vector pWS31, complete sequence 62 2e-06
456dbj|AB081312.1| Paralichthys olivaceus CCR9 mRNA for C-C chemoki... 62 2e-06
457emb|X79428.1|ATATG3 A.thaliana microsatellite [repeated motif (g... 62 2e-06
458emb|X54650.1|DMFRIZZ3 D. melanogaster frizzled gene exons 3 and 4 62 2e-06
459emb|Z29380.1|ECMPZ003 Equus caballus (mpz005) microsatellite DNA 62 2e-06
460dbj|D16230.1|BMODHPA Bombyx mori gene for diapause hormone precu... 62 2e-06
461gb|DQ225747.1| Gene trapping Ds/T-DNA vector pUR224NB, complete ... 62 2e-06
462gb|DQ225746.1| Gene trapping Ds/T-DNA vector pUR224NA, complete ... 62 2e-06
463emb|Z14037.1|BTMS121 B.taurus microsatellite (ETH121) 62 2e-06
464gb|L27275.1|CVNRHO Chromatium vinosum rho gene, complete cds 62 2e-06
465gb|M73292.1|CHKARASEC7 Chicken aromatase gene, exon 7 62 2e-06
466dbj|D37934.1|RAT5E5ANTE Rat mRNA for 5E5 antigen, complete cds 62 2e-06
467gb|DQ015898.1| Synthetic construct loxP-HIS1-loxP disruption cas... 60 9e-06
468emb|AJ544235.1|SFR544235 Shewanella frigidimarina omcA gene, mtr... 60 9e-06
469dbj|AB226842.1| Aspergillus oryzae cDNA, contig sequence: AoEST3704 60 9e-06
470gb|AF179463.1|AF179463 Mus musculus modified fragile X mental re... 60 9e-06
471dbj|D50017.2| Homo sapiens PDGFRA gene for alpha-platelet-derive... 60 9e-06
472gb|AY196826.1| PiggyBac ubiquitin-transposase P replacement vect... 60 9e-06
473gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome 60 9e-06
474emb|AJ417527.1|OSA417527 Oryza sativa partial mRNA for putative ... 60 9e-06
475gb|U27919.1|SVU27919 Stealth virus 1 clone 3B65 T7 60 9e-06
476emb|X81889.1|HSP0071 H.sapiens mRNA for p0071 protein 60 9e-06
477dbj|AB049715.1| Pisum sativum ssa-4 mRNA for putative senescence... 60 9e-06
478emb|AJ297276.1|PNI297276 Populus nigra microsatellite DNA, clone... 58 4e-05
479emb|X59727.1|HS63KDAP H.sapiens 63 kDa protein kinase related to... 58 4e-05
480emb|AJ011383.1|CAR011383 Cicer arietinum mRNA for 20S proteasome... 58 4e-05
481emb|Y18852.1|SOL18852 Spinacia oleracea mRNA for DNA-dependent R... 58 4e-05
482emb|Z30183.1|HSMIGGE H.sapiens mig-5 gene 58 4e-05
483emb|Y10157.1|ATSULFRED A.thaliana gene encoding sulfite reductase 58 4e-05
484dbj|AB230862.1| Aspergillus oryzae cDNA, contig sequence: AoEST9049 58 4e-05
485dbj|AB226299.1| Aspergillus oryzae cDNA, contig sequence: AoEST3161 58 4e-05
486gb|S74039.1| creatine transporter [human, brainstem/spinal cord,... 58 4e-05
487gb|S71745.1| influenza virus hemagglutinin 5' epitope tag=fusion... 58 4e-05
488gb|S71742.1| influenza virus hemagglutinin 5' epitope tag=fusion... 58 4e-05
489emb|X96758.1|ZMCCAP Z.mays mRNA for clathrin coat assembly protein 58 4e-05
490gb|AY810440.1| Schistosoma japonicum clone SJCHGC09357 unknown mRNA 58 4e-05
491gb|AF184978.1|AF184978 Binary vector pCLD04541, complete sequence 58 4e-05
492gb|M37394.2|RATEGFR Rattus norvegicus epidermal growth factor re... 58 4e-05
493emb|AJ292039.1|LME292039 Leishmania mexicana exgmp gene for GDP-... 58 4e-05
494gb|M21227.1|DROSALAZ D.simulans homeotic gene spalt (sal), compl... 58 4e-05
495gb|AY457636.1| Plant binary vector pXCS-HAStrep, complete sequence 56 1e-04
496ref|NM_011706.1| Mus musculus transient receptor potential catio... 56 1e-04
497emb|AJ249443.1|ECO249443 Escherichia coli partial luxA gene for ... 56 1e-04
498gb|AY170009.1| Cloning vector pCAT-3', complete sequence 56 1e-04
499emb|Y13892.1|HSPI3KINA Homo sapiens mRNA for PI-3 kinase 56 1e-04
500emb|X87971.1|MTNIFGLNS M.thermoautotrophicum nifH, glnBa, glnBb,... 56 1e-04

>gb|AY157498.1| Synechococcus sp. PCC 7942 cosmid 4G8, complete sequence
          Length = 31404

 Score = 1156 bits (583), Expect = 0.0
 Identities = 583/583 (100%)
 Strand = Plus / Minus

                                                                         
Query: 49    ctgcagcagggattgcacctcctcacgactggactcactcagtcgggtattggtaatgac 108
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21376 ctgcagcagggattgcacctcctcacgactggactcactcagtcgggtattggtaatgac 21317

                                                                         
Query: 109   atccgataaggagatcgcagcgatcgctgtaaaggttgtccccactccaaacaacaggaa 168
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21316 atccgataaggagatcgcagcgatcgctgtaaaggttgtccccactccaaacaacaggaa 21257

                                                                         
Query: 169   ttggcggcgcagcttcatggcagtcgagggttaggggggcaaccaaggctcgcgacggtg 228
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21256 ttggcggcgcagcttcatggcagtcgagggttaggggggcaaccaaggctcgcgacggtg 21197

                                                                         
Query: 229   gctctagcgttcgagcaactgagcaattttactgagcaggcgcggtagctcgattggctt 288
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21196 gctctagcgttcgagcaactgagcaattttactgagcaggcgcggtagctcgattggctt 21137

                                                                         
Query: 289   ggtgtcgtagtcgtcacagcccgcggcgatcgccttttcgcgatcgctagccatggcgtg 348
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21136 ggtgtcgtagtcgtcacagcccgcggcgatcgccttttcgcgatcgctagccatggcgtg 21077

                                                                         
Query: 349   ggcagtcagtgcaatcaccggcgtctgttgcagttcaggatcggctttgagttggcgcgt 408
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21076 ggcagtcagtgcaatcaccggcgtctgttgcagttcaggatcggctttgagttggcgcgt 21017

                                                                         
Query: 409   ggcctcccagccatccatcactggcaagctcatatccatcaaaatcagatccggttgctc 468
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21016 ggcctcccagccatccatcactggcaagctcatatccatcaaaatcagatccggttgctc 20957

                                                                         
Query: 469   gcgccgtgccgtatccacaccggcagctccatcgtgagccaagaccacttcaaaaccctt 528
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20956 gcgccgtgccgtatccacaccggcagctccatcgtgagccaagaccacttcaaaaccctt 20897

                                                                         
Query: 529   gcgagtcagacggcgcgacaacatatcccaattgtcttcgttgtcttctaccaacaagat 588
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20896 gcgagtcagacggcgcgacaacatatcccaattgtcttcgttgtcttctaccaacaagat 20837

                                                        
Query: 589   tttagtcatccctaatcctctcaccccgattgatcacctcacc 631
             |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20836 tttagtcatccctaatcctctcaccccgattgatcacctcacc 20794



to top

>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 1156 bits (583), Expect = 0.0
 Identities = 583/583 (100%)
 Strand = Plus / Minus

                                                                           
Query: 49      ctgcagcagggattgcacctcctcacgactggactcactcagtcgggtattggtaatgac 108
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2425811 ctgcagcagggattgcacctcctcacgactggactcactcagtcgggtattggtaatgac 2425752

                                                                           
Query: 109     atccgataaggagatcgcagcgatcgctgtaaaggttgtccccactccaaacaacaggaa 168
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2425751 atccgataaggagatcgcagcgatcgctgtaaaggttgtccccactccaaacaacaggaa 2425692

                                                                           
Query: 169     ttggcggcgcagcttcatggcagtcgagggttaggggggcaaccaaggctcgcgacggtg 228
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2425691 ttggcggcgcagcttcatggcagtcgagggttaggggggcaaccaaggctcgcgacggtg 2425632

                                                                           
Query: 229     gctctagcgttcgagcaactgagcaattttactgagcaggcgcggtagctcgattggctt 288
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2425631 gctctagcgttcgagcaactgagcaattttactgagcaggcgcggtagctcgattggctt 2425572

                                                                           
Query: 289     ggtgtcgtagtcgtcacagcccgcggcgatcgccttttcgcgatcgctagccatggcgtg 348
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2425571 ggtgtcgtagtcgtcacagcccgcggcgatcgccttttcgcgatcgctagccatggcgtg 2425512

                                                                           
Query: 349     ggcagtcagtgcaatcaccggcgtctgttgcagttcaggatcggctttgagttggcgcgt 408
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2425511 ggcagtcagtgcaatcaccggcgtctgttgcagttcaggatcggctttgagttggcgcgt 2425452

                                                                           
Query: 409     ggcctcccagccatccatcactggcaagctcatatccatcaaaatcagatccggttgctc 468
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2425451 ggcctcccagccatccatcactggcaagctcatatccatcaaaatcagatccggttgctc 2425392

                                                                           
Query: 469     gcgccgtgccgtatccacaccggcagctccatcgtgagccaagaccacttcaaaaccctt 528
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2425391 gcgccgtgccgtatccacaccggcagctccatcgtgagccaagaccacttcaaaaccctt 2425332

                                                                           
Query: 529     gcgagtcagacggcgcgacaacatatcccaattgtcttcgttgtcttctaccaacaagat 588
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2425331 gcgagtcagacggcgcgacaacatatcccaattgtcttcgttgtcttctaccaacaagat 2425272

                                                          
Query: 589     tttagtcatccctaatcctctcaccccgattgatcacctcacc 631
               |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2425271 tttagtcatccctaatcctctcaccccgattgatcacctcacc 2425229



to top

>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome
          Length = 2695903

 Score = 1156 bits (583), Expect = 0.0
 Identities = 583/583 (100%)
 Strand = Plus / Plus

                                                                           
Query: 49      ctgcagcagggattgcacctcctcacgactggactcactcagtcgggtattggtaatgac 108
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1891240 ctgcagcagggattgcacctcctcacgactggactcactcagtcgggtattggtaatgac 1891299

                                                                           
Query: 109     atccgataaggagatcgcagcgatcgctgtaaaggttgtccccactccaaacaacaggaa 168
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1891300 atccgataaggagatcgcagcgatcgctgtaaaggttgtccccactccaaacaacaggaa 1891359

                                                                           
Query: 169     ttggcggcgcagcttcatggcagtcgagggttaggggggcaaccaaggctcgcgacggtg 228
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1891360 ttggcggcgcagcttcatggcagtcgagggttaggggggcaaccaaggctcgcgacggtg 1891419

                                                                           
Query: 229     gctctagcgttcgagcaactgagcaattttactgagcaggcgcggtagctcgattggctt 288
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1891420 gctctagcgttcgagcaactgagcaattttactgagcaggcgcggtagctcgattggctt 1891479

                                                                           
Query: 289     ggtgtcgtagtcgtcacagcccgcggcgatcgccttttcgcgatcgctagccatggcgtg 348
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1891480 ggtgtcgtagtcgtcacagcccgcggcgatcgccttttcgcgatcgctagccatggcgtg 1891539

                                                                           
Query: 349     ggcagtcagtgcaatcaccggcgtctgttgcagttcaggatcggctttgagttggcgcgt 408
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1891540 ggcagtcagtgcaatcaccggcgtctgttgcagttcaggatcggctttgagttggcgcgt 1891599

                                                                           
Query: 409     ggcctcccagccatccatcactggcaagctcatatccatcaaaatcagatccggttgctc 468
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1891600 ggcctcccagccatccatcactggcaagctcatatccatcaaaatcagatccggttgctc 1891659

                                                                           
Query: 469     gcgccgtgccgtatccacaccggcagctccatcgtgagccaagaccacttcaaaaccctt 528
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1891660 gcgccgtgccgtatccacaccggcagctccatcgtgagccaagaccacttcaaaaccctt 1891719

                                                                           
Query: 529     gcgagtcagacggcgcgacaacatatcccaattgtcttcgttgtcttctaccaacaagat 588
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1891720 gcgagtcagacggcgcgacaacatatcccaattgtcttcgttgtcttctaccaacaagat 1891779

                                                          
Query: 589     tttagtcatccctaatcctctcaccccgattgatcacctcacc 631
               |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1891780 tttagtcatccctaatcctctcaccccgattgatcacctcacc 1891822



to top

>emb|AJ312391.1|CTR312391 Chloroplast transformation vector pRB70
          Length = 7454

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 47/48 (97%)
 Strand = Plus / Plus

                                                            
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagcagg 58
            ||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 4760 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagcagg 4807



to top

>gb|U25061.1|XXU25061 Cloning vector pBBR1MCS-5 REP, LacZ alpha peptide (lacZ alpha), and
            gentamicin-3-acetyltransferase genes, complete cds
          Length = 4768

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3306 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3262



to top

>gb|U25060.1|XXU25060 Cloning vector pBBR1MCS-4 REP, LacZ alpha peptide (lacZ alpha), and
            beta-lactamase genes, complete cds
          Length = 4950

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3306 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3262



to top

>gb|U25059.1|XXU25059 Cloning vector pBBR1MCS-3 REP and LacZ alpha peptide (lacZ alpha)
            genes, complete cds; and unknown gene
          Length = 5228

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3306 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3262



to top

>gb|U23751.1|CVU23751 Cloning vector pBBR1MCS-2 plasmid pBBR1MCS-2, complete sequence
          Length = 5144

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3306 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3262



to top

>gb|U02374.1|XXU02374 Cloning vector pBBR1MCS plasmid pBBR1MCS, complete sequence
          Length = 4707

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3306 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3262



to top

>gb|AY827555.1| Shuttle vector pNAK1, complete sequence
          Length = 5223

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 129 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 85



to top

>gb|DQ019862.2| Saccharomyces cerevisiae expression vector p423GALL, complete
            sequence
          Length = 6483

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 4149 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4105



to top

>gb|DQ228131.1| Moss transformation vector pMBL6, complete sequence
          Length = 4295

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3338 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3294



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 959  tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1003



to top

>gb|DQ228130.1| Moss transformation vector pMBL5, complete sequence
          Length = 4296

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2272 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2228



to top

>gb|DQ230324.1| Shuttle vector pMQ61, complete sequence
          Length = 7978

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3983 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4027



to top

>gb|DQ230323.1| Shuttle vector pMQ52, complete sequence
          Length = 7277

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3983 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4027



to top

>gb|DQ230322.1| Shuttle vector pMQ51, complete sequence
          Length = 8105

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3983 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4027



to top

>gb|AY456904.1| Binary vector pRE1, complete sequence
          Length = 9769

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 11 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 55



to top

>gb|AY672109.3| Bursa aurealis delivery vector pBursa, complete sequence
          Length = 7383

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 5804 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 5848



to top

>gb|DQ490965.1| Mutant Zea mays clone pGR25C22 disrupted DOF1 (Dof1) gene, promoter
            region and complete cds
          Length = 12502

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 8087 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 8043



to top

>gb|DQ019861.2| Saccharomyces cerevisiae expression vector p426GPD, complete sequence
          Length = 6606

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 4344 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4300



to top

>gb|AY423865.1| Cloning vector pMK2017, complete sequence
          Length = 4252

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 861 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 817



to top

>gb|AY557621.1| Shuttle vector pELS200, complete sequence
          Length = 7828

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 7340 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 7384



to top

>gb|M32616.1|SYNDROCL Cloning vector pHS85 heat-shock protein 82/neomycin
            phosphotransferase fusion protein (hsp82-neo fusion)
            gene, complete cds
          Length = 3727

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3713 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3669



to top

>gb|AY150810.1| Cloning vector pRS327, complete sequence
          Length = 9560

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 5930 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 5886



to top

>gb|AY150809.1| Cloning vector pRS317, complete sequence
          Length = 8601

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 5781 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 5737



to top

>gb|AY150808.1| Cloning vector pRS307, complete sequence
          Length = 8219

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 5930 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 5886



to top

>emb|AJ508373.1|FHE508373 Fasciola hepatica microsatellite DNA, clone FH25
          Length = 749

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 733 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 689



to top

>emb|AJ417488.2|SIN417488 Shuttle integration vector pPL1
          Length = 6094

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 53 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 97



to top

>emb|AJ417449.2|SIN417449 Shuttle integration vector pPL2
          Length = 6116

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 52 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 96



to top

>gb|AF251497.1| Cloning vector HKBS1, complete sequence
          Length = 12538

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 7877 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 7833



to top

>gb|AF187996.1| Promoter probe vector pPR9TT, complete sequence
          Length = 9388

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 8914 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 8870



to top

>gb|AF140579.1| Integration vector mini-CTX-lacZ, complete sequence
          Length = 8875

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 4214 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4170



to top

>gb|AF140577.1| Integration vector mini-CTX2, complete sequence
          Length = 6755

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 949 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 905



to top

>gb|AF140576.1| Integration vector mini-CTX1, complete sequence
          Length = 5610

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 949 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 905



to top

>gb|AY436765.1| Binary vector pAMPAT-MCS, complete sequence
          Length = 5274

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1959 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2003



to top

>gb|L25927.1|YSPSEQA Shuttle vector pJK148, complete sequence
          Length = 5343

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2979 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3023



to top

>gb|DQ452049.1| Binary vector pGPro1, complete sequence
          Length = 8833

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 8823 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 8779



to top

>gb|AY115560.1| Transposon delivery vector pSC189, complete sequence
          Length = 6982

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2746 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2702



to top

>gb|AD001531.1|SYNPGR8V Cloning vector pGR8, complete sequence
          Length = 9655

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 7430 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 7386



to top

>gb|AY301066.1| Transposition vector RescueMu, complete sequence
          Length = 4739

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 760 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 804



to top

>gb|AY291460.1| Shuttle vector pNG168, complete sequence
          Length = 8960

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 4613 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4657



to top

>gb|L25928.3|YSPSEQB Shuttle vector pJK210, complete sequence
          Length = 5032

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2668 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2712



to top

>emb|AJ278283.1|ACL278283 Cloning vector pBRINT-TsKm
          Length = 8310

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1199 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1155



to top

>emb|AJ278282.1|ACL278282 Cloning vector pBRINT-TsGm
          Length = 7922

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1199 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1155



to top

>emb|AJ278281.1|ACL278281 Cloning vector pBRINT-TsCm
          Length = 8094

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1199 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1155



to top

>emb|AJ278280.1|CVE278280 Cloning vector pBRINTs-Kan2
          Length = 8405

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1199 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1155



to top

>emb|AJ278279.1|CVE278279 Cloning vector pBRINTs-Gen4
          Length = 8017

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1199 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1155



to top

>emb|AJ278278.1|CVE278278 Cloning vector pBRINTs-Cat2
          Length = 8201

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1199 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1155



to top

>emb|AJ277653.1|ECO277653 Escherichia coli plasmid pGBG1
          Length = 7620

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 6219 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 6175



to top

>emb|AJ277560.1|LES277560 Lycopersicon esculentum partial mRNA for putative asparaginyl-tRNA
           synthetase (ats1 gene)
          Length = 799

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 326 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 370



to top

>emb|AJ277471.1|OSA277471 Oryza sativa rbbi2-4 gene for putative Bowman Bird trypsin
          inhibitor
          Length = 3036

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 10 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 54



to top

>emb|AJ277206.1|CSI277206 Camellia sinensis gene for s-adenosylmethinonine synthetase
          Length = 1776

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 55 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 99



to top

>emb|AJ237707.1|YLI237707 Yarrowia lipolytica odc gene for ornithine decarboxylase
          Length = 2599

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2538 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2582



to top

>emb|AJ868289.1| Transconjugation plasmid pBMK1
          Length = 8613

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 61  tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 105



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 36/37 (97%)
 Strand = Plus / Minus

                                               
Query: 17 tcgacggcatcgataagcttgatatcgaattcctgca 53
          ||||||| |||||||||||||||||||||||||||||
Sbjct: 37 tcgacggtatcgataagcttgatatcgaattcctgca 1



to top

>gb|AY733072.1| Cloning vector pSW29, complete sequence
          Length = 1723

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 62  tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 106



to top

>gb|AY733070.1| Cloning vector pSW25, complete sequence
          Length = 2175

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 509 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 553



to top

>gb|AY733067.1| Cloning vector pSW24, complete sequence
          Length = 2029

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 509 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 553



to top

>gb|AY733065.1| Cloning vector pSW23, complete sequence
          Length = 1582

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 62  tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 106



to top

>emb|AJ416708.1|PDE416708 Populus deltoides MER locus, genomic DNA, cultivar S9-2
          Length = 95055

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                          
Query: 11    tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
             ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 95002 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 94958



to top

>gb|AF531173.1| Cloning vector pDblet, complete sequence
          Length = 6238

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2676 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2720



to top

>gb|AF504908.1| Cloning vector pBBRT, complete sequence
          Length = 5973

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3306 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3262



to top

>dbj|AB114435.1| Pseudorasbora parva DNA, microsatelite marker PA19
          Length = 371

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 332 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 288



to top

>gb|AF219920.1|F219907S14 Homo sapiens diacylglycerol kinase iota (DGKI) gene, exon 16
          Length = 1060

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1055 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1011



to top

>gb|AF402295.1| pk[BIG-alpha] piggyBac transformation vector, complete sequence
          Length = 7414

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1141 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1097



to top

>gb|DQ236098.1| Himar1-delivery and mutagenesis vector pFNLTP16 H3, complete sequence
          Length = 10027

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3458 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3502



to top

>gb|AF309798.1|AF309798 Clupea pallasi microsatellite Cha134 sequence
          Length = 508

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 462 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 418



to top

>gb|AF309796.1|AF309796 Clupea pallasi microsatellite Cha125 sequence
          Length = 591

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 12 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 56



to top

>gb|AF309795.1|AF309795 Clupea pallasi microsatellite Cha120 sequence
          Length = 656

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 607 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 563



to top

>gb|AF309794.1|AF309794 Clupea pallasi microsatellite Cha115 sequence
          Length = 945

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 900 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 856



to top

>gb|AF309793.1|AF309793 Clupea pallasi microsatellite Cha113 sequence
          Length = 525

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 50 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 94



to top

>gb|AF309792.1|AF309792 Clupea pallasi microsatellite Cha107 sequence
          Length = 404

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 402 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 358



to top

>gb|AF309790.1|AF309790 Clupea pallasi microsatellite Cha100 sequence
          Length = 678

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 623 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 579



to top

>gb|AF519494.1| Shuttle vector pSpcP-lac, complete sequence
          Length = 4570

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 4187 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4143



to top

>gb|AF411123.1|AF411123 Transposon vector phiMycoMarT7, complete sequence
          Length = 2068

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 803 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 759



to top

>gb|AF174133.1|AF174133 Cloning vector pRS4213, complete sequence
          Length = 8182

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 4476 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4520



to top

>gb|AF174132.1|AF174132 Cloning vector pRS4210, complete sequence
          Length = 7168

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3462 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3506



to top

>gb|AF174131.1|AF174131 Cloning vector pRS4110, complete sequence
          Length = 6333

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3455 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3499



to top

>emb|AJ620495.1| Mus musculus partial mRNA for non-selective cation channel TRPV1
            (trpv1 gene)
          Length = 2669

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2644 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2600



to top

>gb|AY237648.1| Cloning vector pHR50, complete sequence
          Length = 11973

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                          
Query: 11    tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
             ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 10244 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 10288



to top

>gb|AY237649.1| Cloning vector pHR3-km, complete sequence
          Length = 6762

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 5033 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 5077



to top

>gb|U56995.1|U56995 Cloning vector pGreenscript A complete sequence
          Length = 3062

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 762 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 806



to top

>gb|AY008370.1| Glossina palpalis palpalis clone Pgp14 microsatellite sequence
          Length = 765

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 29 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 73



to top

>gb|AY008368.1| Glossina palpalis palpalis clone Pgp29 microsatellite sequence
          Length = 1001

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 34 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 78



to top

>gb|AY034154.1| Cloning vector pIDN4, complete sequence
          Length = 2059

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 86  tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 130



to top

>gb|AF517126.1| Cloning vector pSPC-lac, complete sequence
          Length = 2650

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2267 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2223



to top

>gb|DQ023608.1| Yeast expression vector p426GALL, complete sequence
          Length = 6412

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2263 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2307



to top

>emb|AJ626721.1| Acetobacter pasteurianus partial ITS1, strain CCM 3615
          Length = 913

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 46 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 90



to top

>gb|AY785149.1| Cloning vector pFL122, complete sequence
          Length = 8652

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 8246 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 8202



to top

>gb|AY785148.1| Suicide plasmid pEE3, complete sequence
          Length = 6393

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 6070 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 6026



to top

>gb|AY237647.1| Cloning Vector pHRGFPGUS, complete sequence
          Length = 10313

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 8584 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 8628



to top

>gb|AY237646.1| Cloning vector pHRGFPTC, complete sequence
          Length = 9233

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2681 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2637



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 31   aagcttgatatcgaattcctgcag 54
            ||||||||||||||||||||||||
Sbjct: 4182 aagcttgatatcgaattcctgcag 4205



to top

>gb|AF327894.1|AF327894 Cloning vector pExchange 1, complete sequence
          Length = 3602

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 742 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 698



to top

>dbj|AB119275.1| Mus musculus GATA6 gene, exon 1
          Length = 12813

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2218 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2262



to top

>gb|AF309797.1|AF309797 Clupea pallasi microsatellite Cha128 sequence
          Length = 671

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 47 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 91



to top

>gb|AY822461.1| Yeast expression vector pJG515 chloramphenicol resistance protein
            (CmR) and CcdB (ccdB) genes, complete cds
          Length = 1774

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1773 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1729



to top

>gb|AY822460.1| Yeast expression vector pJG514 chloramphenicol resistance protein
            (CmR) and CcdB (ccdB) genes, complete cds
          Length = 1774

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1773 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1729



to top

>gb|AY822459.1| Yeast expression vector pJG483 chloramphenicol resistance protein
            (CmR) and CcdB (ccdB) genes, complete cds
          Length = 1774

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1773 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1729



to top

>gb|AY822458.1| Yeast expression vector pJG482 chloramphenicol resistance protein
            (CmR) and CcdB (ccdB) genes, complete cds
          Length = 1774

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1773 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1729



to top

>gb|AY822457.1| Yeast expression vector pJG518 chloramphenicol resistance protein
            (CmR) and CcdB (ccdB) genes, complete cds
          Length = 2535

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2534 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2490



to top

>gb|AY822456.1| Yeast expression vector pJG516 chloramphenicol resistance protein
            (CmR) and CcdB (ccdB) genes, complete cds
          Length = 2535

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2534 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2490



to top

>gb|AY822455.1| Yeast expression vector pJG484 chloramphenicol resistance protein
            (CmR) and CcdB (ccdB) genes, complete cds
          Length = 2535

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2534 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2490



to top

>gb|AY822454.1| Yeast expression vector pJG485 chloramphenicol resistance protein
            (CmR) and CcdB (ccdB) genes, complete cds
          Length = 2535

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2534 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2490



to top

>gb|U64449.2|CVU64449 Cloning vector pOPRSVIMCS from Lacswitch II System, complete sequence
          Length = 5647

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3115 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3159



to top

>gb|AF298791.1|AF298791 N-terminal GFP fusion vector pUG36, complete sequence
          Length = 6225

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2263 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2307



to top

>gb|AF298787.1|AF298787 C-terminal GFP fusion vector pUG35, complete sequence
          Length = 6231

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2989 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3033



to top

>gb|AF298784.1|AF298784 N-terminal GFP fusion vector pUG34, complete sequence
          Length = 6297

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2335 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2379



to top

>gb|AF298783.1|AF298783 C-terminal GFP fusion vector pUG23, complete sequence
          Length = 6303

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3061 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3105



to top

>gb|AY196822.1| PiggyBac transformation vector pB-MCS w+, complete sequence
          Length = 8137

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 709 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 665



to top

>gb|AY196821.1| PiggyBac helper plasmid pBlu-uTp, complete sequence
          Length = 7085

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 4868 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4824



to top

>gb|AF178453.1|AF178453 Integration vector pCD13PSK aminoglycoside adenyltransferase (aadA)
            and beta-galactosidase alpha peptide (lacZa) genes,
            complete cds
          Length = 4549

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 4054 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4098



to top

>gb|AF178452.1|AF178452 Integration vector pCD13PKS aminoglycoside adenyltransferase (aadA)
            and beta-galactosidase alpha peptide (lacZa) genes,
            complete cds
          Length = 4549

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 4129 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 4085



to top

>gb|AF178450.1|AF178450 Integration vector pCD11PSK chloramphenicol transacetylase (cat) and
            beta-galactosidase alpha peptide (lacZa) genes, complete
            cds
          Length = 3485

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2990 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3034



to top

>gb|AF178449.1|AF178449 Integration vector pCD11PKS chloramphenicol transacetylase (cat) and
            beta-galactosidase alpha peptide (lacZa) genes, complete
            cds
          Length = 3485

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3065 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3021



to top

>gb|AF005420.1|AF005420 Expression vector pRIBOTEX, complete sequence
          Length = 6024

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1524 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1480



to top

>dbj|AB005559.1| Mus musculus DNA for cyclin G, complete cds
          Length = 7846

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 67  tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 111



to top

>gb|AF153422.1|AF153422 Cloning vector pTG8, complete sequence
          Length = 3417

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 753 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 709



to top

>emb|X85744.1|GGMYOGEN Gallus gallus myogenin gene
          Length = 876

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 4  tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 48



to top

>gb|M74016.1|YSCTRAM2 Cloning vector pYADE4 TRP1 and AMPr genes, complete cds
          Length = 6037

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 14 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 58



to top

>gb|L08785.1|SYNBLKSPV BlueScribe KS Plus cloning vector
          Length = 2964

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 744 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 700



to top

>gb|M22848.1|SYNPLKRB Cloning vector pUC129 DNA, polylinker region
          Length = 147

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 49 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 93



to top

>gb|M22847.1|SYNPLKRA Cloning vector pUC128 DNA, polylinker region
          Length = 144

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 112 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 68



to top

>emb|AJ277561.1|LES277561 Lycopersicon esculentum partial mRNA for putative glutamine
           synthase (gts1 gene)
          Length = 905

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 650 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 606



to top

>emb|X79425.1|ATAG4 A.thaliana microsatellite [repeated motif (tc)7]
          Length = 280

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 44 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 88



to top

>gb|AF135243.1|MMFBLN2S06 Mus musculus fibulin-2 (Fbln2) gene, exon 6
          Length = 490

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 62  tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 106



to top

>gb|U46018.1|CVU46018 Cloning vector pCRSCRIPT Cam, complete sequence
          Length = 3399

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 669 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>gb|U46017.1|CVU46017 Cloning vector pCRSCRIPT SK[+], complete sequence
          Length = 2961

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 669 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>gb|AF139061.1|AF139061 Binary vector pCB301, complete sequence
          Length = 3574

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3391 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3347



to top

>gb|AF092842.1|AF092842 Mycobacterium marinum G13 promoter construct
          Length = 766

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 512 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 468



to top

>gb|AF110459.1|AF110459 Cloning vector pBBR1-GFP, complete sequence
          Length = 6640

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2681 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2637



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 31   aagcttgatatcgaattcctgcag 54
            ||||||||||||||||||||||||
Sbjct: 4182 aagcttgatatcgaattcctgcag 4205



to top

>emb|X81813.1|SCCDC1 S.cerevisiae CDC1 gene
          Length = 2664

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 14 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 58



to top

>gb|AY568055.1| Cloning vector pAGRIKOLA, complete sequence
          Length = 10459

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3894 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3938



to top

>gb|AF071266.1|AF071266 Danio rerio homeobox protein (hoxc6b) gene, complete cds
          Length = 1972

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 18 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 62



to top

>dbj|AB064982.1| Mus musculus gene for Bmal1, 5' upstream sequence and exon 1
          Length = 8143

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3  tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 47



to top

>gb|U47947.1|CVU47947 Cloning vector pGreenscript I, complete sequence including green
           fluorescent protein (AGP1) mRNA, partial cds
          Length = 3062

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 762 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 806



to top

>emb|AJ428509.1|MMU428509 Mus musculus partial NID-2 gene for nidogen-2, exon 15
          Length = 1067

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 49 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 93



to top

>emb|AJ428508.1|MMU428508 Mus musculus partial NID-2 gene for nidogen-2, exon 14
          Length = 813

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 771 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 727



to top

>gb|U43955.1|XXU43955 Expression vector pBRz, complete cds
          Length = 2998

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 669 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>dbj|D85525.1|SYNPBEN66 Cloning vector pBEN66 DNA for aminoglycoside 3'-phosphotransferase,
           beta-lactamase, complete cds
          Length = 3306

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 64  tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 108



to top

>emb|Y09374.1|ASPGREEN2 Artificial sequences, plasmid vector pGreen-2
          Length = 3633

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2301 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2257



to top

>gb|AY557620.1| Shuttle vector pELS100, complete sequence
          Length = 7022

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 6534 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 6578



to top

>emb|X52330.1|ARBL2SKM pBluescript II SK(-) vector DNA, phagemid excised from lambda ZAPII
          Length = 2961

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 669 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>emb|X52329.1|ARBL2KSM pBluescript II KS(-) vector DNA, phagemid excised from lambda ZAPII
          Length = 2961

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 744 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 700



to top

>emb|X52328.1|ARBL2SKP pBluescript II SK(+) vector DNA, phagemid excised from lambda ZAPII
          Length = 2961

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 669 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>emb|X52327.1|ARBL2KSP pBluescript II KS(+) vector DNA, phagemid excised from lambda ZAPII
          Length = 2961

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 744 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 700



to top

>emb|X52331.1|ARBLKSP pBluescript KS(+) vector DNA, phagemid excised from lambda ZAP
          Length = 2958

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 744 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 700



to top

>emb|X52326.1|ARBLKSM pBluescript KS(-) vector DNA, phagemid excised from lambda ZAP
          Length = 2958

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 744 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 700



to top

>emb|X52325.1|ARBLSKP pBluescript SK(+) vector DNA, phagemid excised from lambda ZAP
          Length = 2958

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 669 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>emb|X52324.1|ARBLSKM pBluescript SK(-) vector DNA, phagemid excised from lambda ZAP
          Length = 2958

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 669 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>emb|AJ403984.1|CVE403984 Cloning vector pBPSKan2
          Length = 4358

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2064 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2108



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 667 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 711



to top

>emb|AJ403983.1|CVE403983 Cloning vector pBPSGen4
          Length = 3970

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1676 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1720



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 667 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 711



to top

>emb|AJ403982.1|CVE403982 Cloning vector pBPSCat2
          Length = 4154

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1860 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1904



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 667 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 711



to top

>emb|AJ005330.1|ASAJ5330 pGAII(-) SK positive selection cloning vector gltS gene
          Length = 4670

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1863 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1907



to top

>emb|AJ005329.1|ASAJ5329 pGAII(-) KS positive selection cloning vector gltS gene
          Length = 4670

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1938 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1894



to top

>emb|AJ005327.1|ASAJ5327 pGAII(+) SK positive selection cloning vector gltS gene
          Length = 4670

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1518 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1474



to top

>emb|AJ005326.1|ASAJ5326 pGAII(+) KS positive selection cloning vector gltS gene
          Length = 4670

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1443 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1487



to top

>emb|AJ005324.1|ASAJ5324 pCP1(-) SK positive selection cloning vector gltS gene
          Length = 6340

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1052 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1008



to top

>emb|AJ005323.1|ASAJ5323 pCP1(-) KS positive selection cloning vector gltS gene
          Length = 6340

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 977  tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1021



to top

>emb|AJ007829.1|CVE7829 Cloning Vector pGreen
          Length = 3228

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 793 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 837



to top

>emb|X93517.1|ECMSASB3 Equus caballus microsatellite DNA marker (clone ASB3)
          Length = 481

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 50 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 94



to top

>dbj|D88110.1| Homo sapiens DNA, clone:pHGC39
          Length = 1020

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1  tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 45



to top

>emb|AM179852.1| Synthetic construct nptI gene for aminoglycoside
            3'-phosphotransferase and bla gene for beta-lactamase
          Length = 4155

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1938 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1894



to top

>emb|Z29381.1|ECMPZ004 Equus caballus (mpz006) microsatellite DNA
          Length = 344

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 7  tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 51



to top

>gb|DQ232601.1| Receiver Vector p415-CYC1-CRE1a-TR-SSRE-GFP, complete sequence
          Length = 11482

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2080 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2124



to top

>gb|DQ232600.1| Receiver Vector p415-CYC1-CRE1a-SSRE-GFP, complete sequence
          Length = 11442

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2040 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2084



to top

>gb|DQ232593.1| Expression Vector p413-TR-SSRE, complete sequence
          Length = 5943

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2335 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2379



to top

>gb|DQ232592.1| Expression Vector p413-SSRE, complete sequence
          Length = 5903

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2335 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2379



to top

>gb|DQ225752.1| Immobile Ac/T-DNA vector pNU400, complete sequence
          Length = 15970

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 9350 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 9306



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 11   tcgaggtcgacggcatcgataagcttgat 39
            ||||||||||||| |||||||||||||||
Sbjct: 2285 tcgaggtcgacggtatcgataagcttgat 2313



to top

>gb|DQ225751.1| Immobile Ac/T-DNA vector pKU352NA, complete sequence
          Length = 18090

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 9350 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 9306



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 11   tcgaggtcgacggcatcgataagcttgat 39
            ||||||||||||| |||||||||||||||
Sbjct: 2285 tcgaggtcgacggtatcgataagcttgat 2313



to top

>emb|AJ567368.2|VVI567368 Vitis vinifera samdc gene for S-adenosylmethionine decarboxylase
          proenzyme, mRNA
          Length = 1709

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 20 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 64



to top

>gb|U35235.1|XXU35235 Plasmid pBSL167 cloning vector, complete sequence
          Length = 3345

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1923 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1967



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 630 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 674



to top

>gb|U35137.1|XXU35137 Plasmid pBSL99 cloning vector, complete sequence
          Length = 4285

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1993 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2037



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 744 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 700



to top

>gb|U35136.1|XXU35136 Plasmid pBSL97 cloning vector, complete sequence
          Length = 4289

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2072 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2028



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 669 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>gb|U35135.1|XXU35135 Plasmid pBSL193 cloning vector, complete sequence
          Length = 5275

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2983 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3027



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 669 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>gb|U35134.1|XXU35134 Plasmid pBSL190 cloning vector, complete sequence
          Length = 4480

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2188 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2232



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 669 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>gb|U35133.1|XXU35133 Plasmid pBSL175 cloning vector, complete sequence
          Length = 4252

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2830 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2874



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 630 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 674



to top

>gb|U35132.1|XXU35132 Plasmid pBSL168 cloning vector, complete sequence
          Length = 3357

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1921 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1965



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 705 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 661



to top

>gb|U35131.1|XXU35131 Plasmid pBSL159 cloning vector, complete sequence
          Length = 4144

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2783 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2739



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 630 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 674



to top

>gb|U35130.1|XXU35130 Plasmid pBSL142 cloning vector, complete sequence
          Length = 4669

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2377 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2421



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 669 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>gb|U35129.1|XXU35129 Plasmid pBSL141 cloning vector, complete sequence
          Length = 3886

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1594 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1638



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 669 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>gb|U35128.1|XXU35128 Plasmid pBSL130 cloning vector, complete sequence
          Length = 5035

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2743 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2787



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 669 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>gb|U35127.1|XXU35127 Plasmid pBSL128 cloning vector, complete sequence
          Length = 5060

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2768 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2812



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 669 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>gb|U35126.1|XXU35126 Plasmid pBSL121 cloning vector, complete sequence
          Length = 4051

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1759 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1803



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 669 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>gb|U35125.1|XXU35125 Plasmid pBSL119 cloning vector, complete sequence
          Length = 4842

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2550 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2594



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 669 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>emb|AJ621843.1| Acetobacter pasteurianus partial 23S rRNA gene, strain CCM 2374
          Length = 845

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 808 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 764



to top

>gb|AF076312.1|AF076312 Cloning vector pCMVTAG5a, complete sequence
          Length = 4322

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 742 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 698



to top

>gb|AF073000.1|AF073000 Cloning vector pCMVTAG4a, complete sequence
          Length = 4319

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 742 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 698



to top

>gb|AF072999.1|AF072999 Cloning vector pCMVTAG3c, complete sequence
          Length = 4328

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 774 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 730



to top

>gb|AF072998.1|AF072998 Cloning vector pCMVTAG3b, complete sequence
          Length = 4327

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 773 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 729



to top

>gb|AF072997.1|AF072997 Cloning vector pCMVTAG3a, complete sequence
          Length = 4326

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 772 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 728



to top

>gb|AF072540.1|AF072540 Cloning vector pCMVTAG2c, complete sequence
          Length = 4325

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 771 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 727



to top

>gb|AF072539.1|AF072539 Cloning vector pCMVTAG2b, complete sequence
          Length = 4324

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 770 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 726



to top

>gb|AF072538.1|AF072538 Cloning vector pCMVTAG2a, complete sequence
          Length = 4323

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 769 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 725



to top

>gb|AF067646.1|AF067646 Cloning vector pCMV-scriptEX, complete sequence
          Length = 4307

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 742 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 698



to top

>gb|AF028239.1|AF028239 Mammalian expression vector pCMV-Script, complete sequence
          Length = 4278

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 742 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 698



to top

>gb|AF016889.1|AF016889 Cloning vector pWSK29, complete sequence
          Length = 5434

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1801 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1845



to top

>emb|X91477.1|BSPX91477 Uncultured bacterium partial 16S rRNA gene (clone group A54n)
          Length = 338

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 38 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 82



to top

>gb|AF015771.1|AF015771 Magnaporthe grisea putative transcriptional regulator (CON7) gene,
            complete cds
          Length = 3240

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1698 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1742



to top

>gb|U93719.1| Cloning vector pRS422 with 2micron ADE2 marker, complete sequence
          Length = 6868

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3164 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3208



to top

>gb|U93718.1| Cloning vector pRS412 with CEN/ARS ADE2 marker, complete sequence
          Length = 6042

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3164 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3208



to top

>gb|U93717.1| Cloning vector pRS402 with ADE2 marker, complete sequence
          Length = 5528

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3164 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3208



to top

>gb|U93716.1| Cloning vector pRS421 with 2micron MET15 marker, complete sequence
          Length = 6233

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2529 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2573



to top

>gb|U93715.1| Cloning vector pRS411 with CEN/ARS MET15 marker, complete sequence
          Length = 5407

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2529 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2573



to top

>gb|U93714.1| Cloning vector pRS401 with MET15 marker, complete sequence
          Length = 4893

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2529 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2573



to top

>gb|U93713.1| Cloning vector pRS400 with kanMX4 marker, complete sequence
          Length = 4755

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2391 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2435



to top

>gb|U66313.1|U66313 Expression vector pUHS*2Plac/ara-1 MCS1, complete sequence
          Length = 4004

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 537 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 581



to top

>dbj|AB241267.1| Verasper moseri DNA, microsatellite marker Vemos64
          Length = 421

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 391 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 347



to top

>gb|U40860.1|NMU40860 Neisseria meningitidis hemoglobin receptor (hmbR) gene, complete cds
          Length = 2568

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2504 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2460



to top

>gb|U64694.1|SCU64694 Yeast integrating vector pRSQ2-URA3, complete sequence
          Length = 5056

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2839 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2883



to top

>gb|DQ269148.1| Yeast centromeric expression vector p416GPD, complete sequence
          Length = 5778

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3516 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3472



to top

>gb|U34887.1|U34887 Yeast integrating vector pRS306 containing a fragment of lacZ
          Length = 5187

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2084 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2040



to top

>emb|AJ312393.1|CTR312393 Chloroplast transformation vector pRB95
          Length = 7626

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 7557 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 7513



to top

>emb|AJ312392.1|CTR312392 Chloroplast transformation vector pRB94
          Length = 7626

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 7467 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 7511



to top

>emb|X91293.1|BSPX91293 Bacterial sp. partial 16S rRNA gene (clone group G41)
          Length = 322

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 7  tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 51



to top

>gb|U03442.1|PRS316 Yeast centromere vector pRS316 with URA3 marker, complete sequence
          Length = 4887

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2084 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2040



to top

>gb|U03441.1|PRS315 Yeast centromere vector pRS315 with LEU2 marker, complete sequence
          Length = 6018

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3215 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3171



to top

>gb|U03440.1|PRS314 Yeast centromere vector pRS314 with TRP1 marker, complete sequence
          Length = 4783

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1980 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1936



to top

>gb|U03439.1|PRS313 Yeast centromere vector pRS313 with HIS3 marker, complete sequence
          Length = 4967

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2164 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2120



to top

>gb|U03438.1|PRS306 Yeast integrative vector pRS306 with URA3 marker, complete sequence
          Length = 4373

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2084 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2040



to top

>gb|U03437.1|PRS305 Yeast integrative vector pRS305 with LEU2 marker, complete sequence
          Length = 5504

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3215 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3171



to top

>gb|U03436.1|PRS304 Yeast integrative vector pRS304 with TRP1 marker, complete sequence
          Length = 4267

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1978 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1934



to top

>gb|U03435.1|PRS303 Yeast integrative vector pRS303 with HIS3 marker, complete sequence
          Length = 4443

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2164 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2120



to top

>emb|Y13161.1|SSMSAT60 Sus scrofa microsatellite DNA isolate pGC.60
          Length = 1350

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 19 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 63



to top

>gb|U03451.1|PRS426 Yeast episomal vector pRS426 with URA3 marker, complete sequence
          Length = 5726

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2020 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2064



to top

>gb|U03452.1|PRS425 Yeast episomal vector pRS425 with LEU2 marker, complete sequence
          Length = 6849

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3143 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3187



to top

>gb|U03453.1|PRS424 Yeast episomal vector pRS424 with TRP1 marker, complete sequence
          Length = 5616

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1910 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1954



to top

>gb|U03454.1|PRS423 Yeast episomal vector pRS423 with HIS3 marker, complete sequence
          Length = 5797

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2092 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2136



to top

>gb|U03450.1|PRS416 Yeast centromere vector pRS416 with URA3 marker, complete sequence
          Length = 4898

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2020 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2064



to top

>gb|U03449.1|PRS415 Yeast centromere vector pRS415 with LEU2 marker, complete sequence
          Length = 6021

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3143 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3187



to top

>gb|U03448.1|PRS414 Yeast centromere vector pRS414 with TRP1 marker, complete sequence
          Length = 4788

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1910 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1954



to top

>gb|U03447.1|PRS413 Yeast centromere vector pRS413 with HIS3 marker, complete sequence
          Length = 4970

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2092 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2136



to top

>gb|U03446.1|PRS406 Yeast integrative vector pRS406 with URA3 marker, complete sequence
          Length = 4384

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2020 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2064



to top

>gb|U03445.1|PRS405 Yeast integrative vector pRS405 with LEU2 marker, complete sequence
          Length = 5507

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3143 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3187



to top

>gb|U03444.1|PRS404 Yeast integrative vector pRS404 with TRP1 marker, complete sequence
          Length = 4274

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1910 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1954



to top

>gb|U03443.1|PRS403 Yeast integrative vector pRS403 with HIS3 marker, complete sequence
          Length = 4456

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2092 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 2136



to top

>gb|U14125.1|CVU14125 Cloning vector pSG926, HIS4-based plasmid, complete sequence
          Length = 5634

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 758 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 714



to top

>gb|U14122.1|CVU14122 Cloning vector pSG935, HIS4-based plasmid, complete sequence
          Length = 5639

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 700 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 744



to top

>gb|U14120.1|CVU14120 Cloning vector pSG927, HIS4-based plasmid, complete sequence
          Length = 5634

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 683 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 727



to top

>gb|L08874.1|SYNPHSCSKV PhageScript SK cloning vector
          Length = 7372

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 6364 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 6320



to top

>gb|L08786.1|SYNBLSKMV BlueScribe SK Minus cloning vector
          Length = 2964

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 669 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>gb|L08784.1|SYNBLKSMV BlueScribe KS Minus cloning vector
          Length = 2964

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 744 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 700



to top

>gb|L08787.1|SYNBLDKPV BlueScribe SK Plus cloning vector
          Length = 2964

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 669 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 713



to top

>emb|AJ007320.1|HSA7320 Homo sapiens mRNA for immunoglobulin heavy chain variable region,
           clone KC4
          Length = 308

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 288 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 244



to top

>gb|L11060.1|SYNECOYST Cloning vector sequence (E. coli/yeast/phage P1) ADH2 gene,
          promoter; beta-lactamase gene; TRP1 gene; CYC1 gene,
          terminator; and two replication origins
          Length = 6445

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 16 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 60



to top

>dbj|AB069689.1| Aspergillus oryzae vmaC gene for vacuolar membrane ATPase C, complete
            cds
          Length = 1323

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1129 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 1173



to top

>dbj|AB005666.1| Homo sapiens mRNA for GTPase-activating protein, complete cds
          Length = 3885

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3841 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3797



to top

>dbj|AB039884.1| Myxococcus xanthus accB, accA genes for acetyl-CoA carboxylase
            carboxyltransferase, acetyl-CoA carboxylase biotin
            carboxylase subunit, complete cds
          Length = 3526

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
            ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3517 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 3473



to top

>emb|AJ294956.1|CCA294956 Catla catla microsatellite DNA, clone Cc8
          Length = 392

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                       
Query: 11 tcgaggtcgacggcatcgataagcttgatatcgaattcctgcagc 55
          ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 11 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcagc 55



to top

>gb|AY189981.1| Expression vector pBS-35S-YFP, complete sequence
          Length = 4789

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 43/44 (97%)
 Strand = Plus / Plus

                                                       
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 54
           ||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 668 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 711



to top

>gb|AY189980.1| Expression vector pBS-35S-Rluc, complete sequence
          Length = 5005

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 43/44 (97%)
 Strand = Plus / Plus

                                                       
Query: 11  tcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 54
           ||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 668 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 711



to top

>gb|DQ015899.1| Synthetic construct loxP-URA3-loxP disruption cassette, complete
            sequence
          Length = 1720

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 43/44 (97%)
 Strand = Plus / Minus

                                                        
Query: 11   tcgaggtcgacggcatcgataagcttgatatcgaattcctgcag 54
            ||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 1658 tcgaggtcgacggtatcgataagcttgatatcgaattcctgcag 1615


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,866,635
Number of Sequences: 3902068
Number of extensions: 3866635
Number of successful extensions: 63556
Number of sequences better than 10.0: 843
Number of HSP's better than 10.0 without gapping: 840
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 61789
Number of HSP's gapped (non-prelim): 1763
length of query: 631
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 608
effective length of database: 17,143,297,704
effective search space: 10423125004032
effective search space used: 10423125004032
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top