Clone Name | rbart14c11 |
---|---|
Clone Library Name | barley_pub |
>gb|AY157498.1| Synechococcus sp. PCC 7942 cosmid 4G8, complete sequence Length = 31404 Score = 1132 bits (571), Expect = 0.0 Identities = 577/579 (99%) Strand = Plus / Minus Query: 15 ctgcagcagggattgcacctcctcacgactggactcactcagtcgggtattggtaatgac 74 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 21376 ctgcagcagggattgcacctcctcacgactggactcactcagtcgggtattggtaatgac 21317 Query: 75 atccgataaggagatcgcagcgatcgctgtaaaggttgtccccactccaaacaacaggaa 134 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 21316 atccgataaggagatcgcagcgatcgctgtaaaggttgtccccactccaaacaacaggaa 21257 Query: 135 ttggcggcgcagcttcatggcagtcgagggttaggggggcaaccaaggctcgcgacggtg 194 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 21256 ttggcggcgcagcttcatggcagtcgagggttaggggggcaaccaaggctcgcgacggtg 21197 Query: 195 gctctagcgttcgagcaactgagcaattttactgagcaggcgcggcagctcgattggctt 254 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 21196 gctctagcgttcgagcaactgagcaattttactgagcaggcgcggtagctcgattggctt 21137 Query: 255 ggtgtcgtaatcgtcacagcccgcggcgatcgccttttcgcgatcgctagccatggcgtg 314 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 21136 ggtgtcgtagtcgtcacagcccgcggcgatcgccttttcgcgatcgctagccatggcgtg 21077 Query: 315 ggcagtcagtgcaatcaccggcgtctgttgcagttcaggatcggctttgagttggcgcgt 374 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 21076 ggcagtcagtgcaatcaccggcgtctgttgcagttcaggatcggctttgagttggcgcgt 21017 Query: 375 ggcctcccagccatccatcactggcaagctcatatccatcaaaatcagatccggttgctc 434 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 21016 ggcctcccagccatccatcactggcaagctcatatccatcaaaatcagatccggttgctc 20957 Query: 435 gcgccgtgccgtatccacaccggcagctccatcgtgagccaagaccacttcaaaaccctt 494 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 20956 gcgccgtgccgtatccacaccggcagctccatcgtgagccaagaccacttcaaaaccctt 20897 Query: 495 gcgagtcagacggcgcgacaacatatcccaattgtcttcgttgtcttctaccaacaagat 554 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 20896 gcgagtcagacggcgcgacaacatatcccaattgtcttcgttgtcttctaccaacaagat 20837 Query: 555 tttagtcatccctaatcctctcaccccgattgatcacct 593 ||||||||||||||||||||||||||||||||||||||| Sbjct: 20836 tttagtcatccctaatcctctcaccccgattgatcacct 20798
>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome Length = 2696255 Score = 1132 bits (571), Expect = 0.0 Identities = 577/579 (99%) Strand = Plus / Minus Query: 15 ctgcagcagggattgcacctcctcacgactggactcactcagtcgggtattggtaatgac 74 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2425811 ctgcagcagggattgcacctcctcacgactggactcactcagtcgggtattggtaatgac 2425752 Query: 75 atccgataaggagatcgcagcgatcgctgtaaaggttgtccccactccaaacaacaggaa 134 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2425751 atccgataaggagatcgcagcgatcgctgtaaaggttgtccccactccaaacaacaggaa 2425692 Query: 135 ttggcggcgcagcttcatggcagtcgagggttaggggggcaaccaaggctcgcgacggtg 194 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2425691 ttggcggcgcagcttcatggcagtcgagggttaggggggcaaccaaggctcgcgacggtg 2425632 Query: 195 gctctagcgttcgagcaactgagcaattttactgagcaggcgcggcagctcgattggctt 254 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 2425631 gctctagcgttcgagcaactgagcaattttactgagcaggcgcggtagctcgattggctt 2425572 Query: 255 ggtgtcgtaatcgtcacagcccgcggcgatcgccttttcgcgatcgctagccatggcgtg 314 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2425571 ggtgtcgtagtcgtcacagcccgcggcgatcgccttttcgcgatcgctagccatggcgtg 2425512 Query: 315 ggcagtcagtgcaatcaccggcgtctgttgcagttcaggatcggctttgagttggcgcgt 374 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2425511 ggcagtcagtgcaatcaccggcgtctgttgcagttcaggatcggctttgagttggcgcgt 2425452 Query: 375 ggcctcccagccatccatcactggcaagctcatatccatcaaaatcagatccggttgctc 434 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2425451 ggcctcccagccatccatcactggcaagctcatatccatcaaaatcagatccggttgctc 2425392 Query: 435 gcgccgtgccgtatccacaccggcagctccatcgtgagccaagaccacttcaaaaccctt 494 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2425391 gcgccgtgccgtatccacaccggcagctccatcgtgagccaagaccacttcaaaaccctt 2425332 Query: 495 gcgagtcagacggcgcgacaacatatcccaattgtcttcgttgtcttctaccaacaagat 554 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2425331 gcgagtcagacggcgcgacaacatatcccaattgtcttcgttgtcttctaccaacaagat 2425272 Query: 555 tttagtcatccctaatcctctcaccccgattgatcacct 593 ||||||||||||||||||||||||||||||||||||||| Sbjct: 2425271 tttagtcatccctaatcctctcaccccgattgatcacct 2425233
>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome Length = 2695903 Score = 1132 bits (571), Expect = 0.0 Identities = 577/579 (99%) Strand = Plus / Plus Query: 15 ctgcagcagggattgcacctcctcacgactggactcactcagtcgggtattggtaatgac 74 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1891240 ctgcagcagggattgcacctcctcacgactggactcactcagtcgggtattggtaatgac 1891299 Query: 75 atccgataaggagatcgcagcgatcgctgtaaaggttgtccccactccaaacaacaggaa 134 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1891300 atccgataaggagatcgcagcgatcgctgtaaaggttgtccccactccaaacaacaggaa 1891359 Query: 135 ttggcggcgcagcttcatggcagtcgagggttaggggggcaaccaaggctcgcgacggtg 194 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1891360 ttggcggcgcagcttcatggcagtcgagggttaggggggcaaccaaggctcgcgacggtg 1891419 Query: 195 gctctagcgttcgagcaactgagcaattttactgagcaggcgcggcagctcgattggctt 254 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 1891420 gctctagcgttcgagcaactgagcaattttactgagcaggcgcggtagctcgattggctt 1891479 Query: 255 ggtgtcgtaatcgtcacagcccgcggcgatcgccttttcgcgatcgctagccatggcgtg 314 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1891480 ggtgtcgtagtcgtcacagcccgcggcgatcgccttttcgcgatcgctagccatggcgtg 1891539 Query: 315 ggcagtcagtgcaatcaccggcgtctgttgcagttcaggatcggctttgagttggcgcgt 374 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1891540 ggcagtcagtgcaatcaccggcgtctgttgcagttcaggatcggctttgagttggcgcgt 1891599 Query: 375 ggcctcccagccatccatcactggcaagctcatatccatcaaaatcagatccggttgctc 434 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1891600 ggcctcccagccatccatcactggcaagctcatatccatcaaaatcagatccggttgctc 1891659 Query: 435 gcgccgtgccgtatccacaccggcagctccatcgtgagccaagaccacttcaaaaccctt 494 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1891660 gcgccgtgccgtatccacaccggcagctccatcgtgagccaagaccacttcaaaaccctt 1891719 Query: 495 gcgagtcagacggcgcgacaacatatcccaattgtcttcgttgtcttctaccaacaagat 554 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1891720 gcgagtcagacggcgcgacaacatatcccaattgtcttcgttgtcttctaccaacaagat 1891779 Query: 555 tttagtcatccctaatcctctcaccccgattgatcacct 593 ||||||||||||||||||||||||||||||||||||||| Sbjct: 1891780 tttagtcatccctaatcctctcaccccgattgatcacct 1891818
>dbj|BA000022.2| Synechocystis sp. PCC 6803 DNA, complete genome Length = 3573470 Score = 63.9 bits (32), Expect = 6e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 250 ggcttggtgtcgtaatcgtcacagcccgcggcgatcgccttttcgcgatcgctagccatg 309 |||||||| ||||| |||||||| || |||||||||||| |||| || || || |||||| Sbjct: 1811452 ggcttggtatcgtagtcgtcacaaccggcggcgatcgccctttctcggtcactggccatg 1811393 Query: 310 gcgtgggcagtcagtgcaat 329 || ||||| ||||| ||||| Sbjct: 1811392 gcatgggcggtcagggcaat 1811373
>gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome Length = 3179300 Score = 60.0 bits (30), Expect = 9e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 368 ggcgcgtggcctcccagccatccatcactggcaagctcatatccatcaaaatcagatccg 427 ||||||| |||||||| ||||||| || |||| |||||||||||||| |||||||||| Sbjct: 2811243 ggcgcgttgcctcccacccatccaggaccggcaggctcatatccatcaggatcagatccg 2811184 Query: 428 gt 429 || Sbjct: 2811183 gt 2811182
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome Length = 4967148 Score = 58.0 bits (29), Expect = 3e-05 Identities = 74/89 (83%) Strand = Plus / Minus Query: 241 agctcgattggcttggtgtcgtaatcgtcacagcccgcggcgatcgccttttcgcgatcg 300 |||||||| |||||||| ||||| | || |||||||| || | ||||| ||||| ||| Sbjct: 1190846 agctcgatgggcttggtttcgtagccatcgcagcccgccgccagcgcctgctcgcggtcg 1190787 Query: 301 ctagccatggcgtgggcagtcagtgcaat 329 || |||||||||||||| ||||| ||||| Sbjct: 1190786 ctggccatggcgtgggcggtcagggcaat 1190758
>emb|AJ312391.1|CTR312391 Chloroplast transformation vector pRB70 Length = 7454 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagcagg 24 |||||||||||||||||||||||| Sbjct: 4784 ttgatatcgaattcctgcagcagg 4807
>emb|AL591985.1|RME591985 Sinorhizobium meliloti 1021 complete pSymB Length = 1683333 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Minus Query: 379 tcccagccatccatcactggcaagctcatatccat 413 |||||||| |||||||| |||| |||||||||||| Sbjct: 367622 tcccagccgtccatcaccggcaggctcatatccat 367588
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 46.1 bits (23), Expect = 0.13 Identities = 50/59 (84%) Strand = Plus / Minus Query: 367 tggcgcgtggcctcccagccatccatcactggcaagctcatatccatcaaaatcagatc 425 |||||||| |||||||| || || ||||| || | |||||| ||||||||||| ||||| Sbjct: 2473829 tggcgcgtcgcctcccaaccgtcgatcaccggtaggctcatgtccatcaaaatgagatc 2473771 Score = 42.1 bits (21), Expect = 2.0 Identities = 33/37 (89%) Strand = Plus / Minus Query: 239 gcagctcgattggcttggtgtcgtaatcgtcacagcc 275 |||||||||| || || |||||||| ||||||||||| Sbjct: 2473957 gcagctcgatcggttttgtgtcgtagtcgtcacagcc 2473921
>ref|NM_001035273.1| Bos taurus single stranded DNA binding protein 4 (SSBP4), mRNA Length = 1714 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Minus Query: 366 ttggcgcgtggcctcccagccatcca 391 |||||||| ||||||||||||||||| Sbjct: 1498 ttggcgcggggcctcccagccatcca 1473
>gb|BC107552.1| Bos taurus single stranded DNA binding protein 4, mRNA (cDNA clone MGC:128808 IMAGE:7989741), complete cds Length = 1714 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Minus Query: 366 ttggcgcgtggcctcccagccatcca 391 |||||||| ||||||||||||||||| Sbjct: 1498 ttggcgcggggcctcccagccatcca 1473
>gb|L29300.1|LEIRIBPP Leishmania chagasi (clone C1) ribosomal protein P0 gene, complete cds Length = 1373 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagca 22 |||||||||||||||||||||| Sbjct: 1351 ttgatatcgaattcctgcagca 1330
>gb|U25061.1|XXU25061 Cloning vector pBBR1MCS-5 REP, LacZ alpha peptide (lacZ alpha), and gentamicin-3-acetyltransferase genes, complete cds Length = 4768 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3282 ttgatatcgaattcctgcagc 3262
>gb|U25060.1|XXU25060 Cloning vector pBBR1MCS-4 REP, LacZ alpha peptide (lacZ alpha), and beta-lactamase genes, complete cds Length = 4950 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3282 ttgatatcgaattcctgcagc 3262
>gb|U25059.1|XXU25059 Cloning vector pBBR1MCS-3 REP and LacZ alpha peptide (lacZ alpha) genes, complete cds; and unknown gene Length = 5228 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3282 ttgatatcgaattcctgcagc 3262
>gb|U23751.1|CVU23751 Cloning vector pBBR1MCS-2 plasmid pBBR1MCS-2, complete sequence Length = 5144 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3282 ttgatatcgaattcctgcagc 3262
>gb|U02374.1|XXU02374 Cloning vector pBBR1MCS plasmid pBBR1MCS, complete sequence Length = 4707 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3282 ttgatatcgaattcctgcagc 3262
>gb|AY827555.1| Shuttle vector pNAK1, complete sequence Length = 5223 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 105 ttgatatcgaattcctgcagc 85
>gb|DQ019862.2| Saccharomyces cerevisiae expression vector p423GALL, complete sequence Length = 6483 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 4125 ttgatatcgaattcctgcagc 4105
>gb|DQ228131.1| Moss transformation vector pMBL6, complete sequence Length = 4295 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3314 ttgatatcgaattcctgcagc 3294 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 983 ttgatatcgaattcctgcagc 1003
>gb|DQ228130.1| Moss transformation vector pMBL5, complete sequence Length = 4296 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2248 ttgatatcgaattcctgcagc 2228
>gb|DQ230324.1| Shuttle vector pMQ61, complete sequence Length = 7978 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 4007 ttgatatcgaattcctgcagc 4027
>gb|DQ230323.1| Shuttle vector pMQ52, complete sequence Length = 7277 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 4007 ttgatatcgaattcctgcagc 4027
>gb|DQ230322.1| Shuttle vector pMQ51, complete sequence Length = 8105 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 4007 ttgatatcgaattcctgcagc 4027
>gb|AY445093.2| Drosophila lummei heat shock protein Hsp70c pseudogene, complete sequence Length = 2745 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2728 ttgatatcgaattcctgcagc 2708
>gb|AF060907.2| Helicella itala clone B2 microsatellite Length = 189 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3 ttgatatcgaattcctgcagc 23
>gb|AY456904.1| Binary vector pRE1, complete sequence Length = 9769 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 35 ttgatatcgaattcctgcagc 55
>gb|U82676.1|AUU82676 Aphelocoma ultramarina AAAG/CTTT repeat region, locus MJG6 Length = 799 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 41 ttgatatcgaattcctgcagc 61
>gb|AY672109.3| Bursa aurealis delivery vector pBursa, complete sequence Length = 7383 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 5828 ttgatatcgaattcctgcagc 5848
>gb|AY753306.1| Leucoagaricus meleagris pyranose dehydrogenase (pdh1) gene, complete cds Length = 3089 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 112 ttgatatcgaattcctgcagc 92
>gb|AY618909.1| Phage display vector pTScDisp, complete sequence Length = 5483 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1764 ttgatatcgaattcctgcagc 1744
>gb|DQ490965.1| Mutant Zea mays clone pGR25C22 disrupted DOF1 (Dof1) gene, promoter region and complete cds Length = 12502 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 8063 ttgatatcgaattcctgcagc 8043
>gb|DQ019861.2| Saccharomyces cerevisiae expression vector p426GPD, complete sequence Length = 6606 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 4320 ttgatatcgaattcctgcagc 4300
>gb|AY423865.1| Cloning vector pMK2017, complete sequence Length = 4252 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 837 ttgatatcgaattcctgcagc 817
>gb|AY557621.1| Shuttle vector pELS200, complete sequence Length = 7828 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 7364 ttgatatcgaattcctgcagc 7384
>gb|M32616.1|SYNDROCL Cloning vector pHS85 heat-shock protein 82/neomycin phosphotransferase fusion protein (hsp82-neo fusion) gene, complete cds Length = 3727 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3689 ttgatatcgaattcctgcagc 3669
>gb|AY150810.1| Cloning vector pRS327, complete sequence Length = 9560 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 5906 ttgatatcgaattcctgcagc 5886
>gb|AY150809.1| Cloning vector pRS317, complete sequence Length = 8601 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 5757 ttgatatcgaattcctgcagc 5737
>gb|AY150808.1| Cloning vector pRS307, complete sequence Length = 8219 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 5906 ttgatatcgaattcctgcagc 5886
>gb|AY303672.1| Broad host range expression vector pMHE6, complete sequence Length = 5945 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 246 ttgatatcgaattcctgcagc 266
>gb|AY303671.1| Broad host range expression vector pMHE7Tc, complete sequence Length = 6014 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 376 ttgatatcgaattcctgcagc 396
>gb|AY303670.1| Broad host range expression vector pMHE6Tc, complete sequence Length = 6039 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 246 ttgatatcgaattcctgcagc 266
>gb|AY303669.1| Broad host range expression vector pMHE7, complete sequence Length = 5920 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 382 ttgatatcgaattcctgcagc 402
>gb|AY299697.1| Broad host range expression vector pMHE5Tc, complete sequence Length = 6032 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 332 ttgatatcgaattcctgcagc 352
>gb|AY299696.1| Broad host range expression vector pMHE5, complete sequence Length = 5938 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 338 ttgatatcgaattcctgcagc 358
>gb|AY299693.1| Broad host range expression vector pMHE2, complete sequence Length = 5878 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 352 ttgatatcgaattcctgcagc 372
>ref|XM_756932.1| Ustilago maydis 521 hypothetical protein (UM05878.1) partial mRNA Length = 1446 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 292 tcgcgatcgctagccatggcg 312 ||||||||||||||||||||| Sbjct: 1135 tcgcgatcgctagccatggcg 1155
>emb|AJ508373.1|FHE508373 Fasciola hepatica microsatellite DNA, clone FH25 Length = 749 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 709 ttgatatcgaattcctgcagc 689
>emb|AJ417488.2|SIN417488 Shuttle integration vector pPL1 Length = 6094 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 77 ttgatatcgaattcctgcagc 97
>gb|AC146851.1| Human Herpesvirus 5 Towne-BAC isolate, complete sequence Length = 229483 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2484 ttgatatcgaattcctgcagc 2464
>emb|AJ417449.2|SIN417449 Shuttle integration vector pPL2 Length = 6116 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 76 ttgatatcgaattcctgcagc 96
>gb|AY315197.1| Human herpesvirus 5 strain Towne, complete genome Length = 231236 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 203567 ttgatatcgaattcctgcagc 203547
>emb|AJ575747.1|LJA575747 Lotus japonicus partial mRNA for arginine decarboxylase (adc gene) Length = 2003 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 16 ttgatatcgaattcctgcagc 36
>gb|AF251497.1| Cloning vector HKBS1, complete sequence Length = 12538 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 7853 ttgatatcgaattcctgcagc 7833
>gb|AF187996.1| Promoter probe vector pPR9TT, complete sequence Length = 9388 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 8890 ttgatatcgaattcctgcagc 8870
>gb|AF140579.1| Integration vector mini-CTX-lacZ, complete sequence Length = 8875 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 4190 ttgatatcgaattcctgcagc 4170
>gb|AF140577.1| Integration vector mini-CTX2, complete sequence Length = 6755 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 925 ttgatatcgaattcctgcagc 905
>gb|AF140576.1| Integration vector mini-CTX1, complete sequence Length = 5610 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 925 ttgatatcgaattcctgcagc 905
>gb|AY436765.1| Binary vector pAMPAT-MCS, complete sequence Length = 5274 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1983 ttgatatcgaattcctgcagc 2003
>gb|AC122834.2| Mus musculus BAC clone RP23-183H9 from 15, complete sequence Length = 191019 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 543 taccaacaagattttagtcat 563 ||||||||||||||||||||| Sbjct: 17371 taccaacaagattttagtcat 17391
>gb|L25927.1|YSPSEQA Shuttle vector pJK148, complete sequence Length = 5343 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3003 ttgatatcgaattcctgcagc 3023
>gb|AY336796.1| Transformation vector pICon, complete sequence Length = 23250 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 10239 ttgatatcgaattcctgcagc 10219
>gb|DQ452049.1| Binary vector pGPro1, complete sequence Length = 8833 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 8799 ttgatatcgaattcctgcagc 8779
>gb|AY115560.1| Transposon delivery vector pSC189, complete sequence Length = 6982 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2722 ttgatatcgaattcctgcagc 2702
>gb|AD001531.1|SYNPGR8V Cloning vector pGR8, complete sequence Length = 9655 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 7406 ttgatatcgaattcctgcagc 7386
>gb|AY301066.1| Transposition vector RescueMu, complete sequence Length = 4739 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 784 ttgatatcgaattcctgcagc 804
>gb|AY291460.1| Shuttle vector pNG168, complete sequence Length = 8960 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 4637 ttgatatcgaattcctgcagc 4657
>emb|Y14981.1|BOY14981 Brassica oleracea fae1 gene Length = 1468 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1424 ttgatatcgaattcctgcagc 1404
>emb|X94368.1|GGLRPP40G G.gallus gene 37LRP/p40 Length = 6209 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 26 ttgatatcgaattcctgcagc 46
>emb|X83865.1|FR5HT1D F.rubripes 5HT1D gene Length = 2259 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 327 ttgatatcgaattcctgcagc 307
>emb|X75648.1|SPDNAPD S.pombe pyruvate dehydrogenase like gene Length = 4906 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 4860 ttgatatcgaattcctgcagc 4880
>emb|X61451.1|MMF41RNA M.musculus mRNA for F41 clone Length = 1040 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 25 ttgatatcgaattcctgcagc 45
>emb|BX294141.1| Pirellula sp. strain 1 complete genome; segment 9/24 Length = 299350 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 277 gcggcgatcgccttttcgcgatcgc 301 |||||||| |||||||||||||||| Sbjct: 26602 gcggcgattgccttttcgcgatcgc 26578
>gb|L25928.3|YSPSEQB Shuttle vector pJK210, complete sequence Length = 5032 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2692 ttgatatcgaattcctgcagc 2712
>emb|AJ410311.1|ECH410311 Erwinia chrysanthemi pir gene Length = 907 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 905 ttgatatcgaattcctgcagc 885
>emb|AJ278266.2|RNO278266 Rattus norvegicus mRNA for SH3-domain binding protein 4 (SH3BP4 gene) Length = 3520 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3456 ttgatatcgaattcctgcagc 3476
>emb|AJ278283.1|ACL278283 Cloning vector pBRINT-TsKm Length = 8310 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1175 ttgatatcgaattcctgcagc 1155
>emb|AJ278282.1|ACL278282 Cloning vector pBRINT-TsGm Length = 7922 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1175 ttgatatcgaattcctgcagc 1155
>emb|AJ278281.1|ACL278281 Cloning vector pBRINT-TsCm Length = 8094 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1175 ttgatatcgaattcctgcagc 1155
>emb|AJ278280.1|CVE278280 Cloning vector pBRINTs-Kan2 Length = 8405 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1175 ttgatatcgaattcctgcagc 1155
>emb|AJ278279.1|CVE278279 Cloning vector pBRINTs-Gen4 Length = 8017 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1175 ttgatatcgaattcctgcagc 1155
>emb|AJ278278.1|CVE278278 Cloning vector pBRINTs-Cat2 Length = 8201 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1175 ttgatatcgaattcctgcagc 1155
>emb|AJ277653.1|ECO277653 Escherichia coli plasmid pGBG1 Length = 7620 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 6195 ttgatatcgaattcctgcagc 6175
>emb|AJ277560.1|LES277560 Lycopersicon esculentum partial mRNA for putative asparaginyl-tRNA synthetase (ats1 gene) Length = 799 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 350 ttgatatcgaattcctgcagc 370
>emb|AJ277472.1|OSA277472 Oryza sativa rbbi2-5 gene for putative Bowman Birk tryspin inhibitor Length = 2378 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2311 ttgatatcgaattcctgcagc 2331
>emb|AJ277471.1|OSA277471 Oryza sativa rbbi2-4 gene for putative Bowman Bird trypsin inhibitor Length = 3036 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 34 ttgatatcgaattcctgcagc 54
>emb|AJ277206.1|CSI277206 Camellia sinensis gene for s-adenosylmethinonine synthetase Length = 1776 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 79 ttgatatcgaattcctgcagc 99
>emb|AJ243692.1|MHO243692 Mycoplasma hominis gap gene encoding glyceraldehyde 3-phosphate dehydrogenase, strain PG21 Length = 1498 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1485 ttgatatcgaattcctgcagc 1465
>emb|AJ237707.1|YLI237707 Yarrowia lipolytica odc gene for ornithine decarboxylase Length = 2599 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2562 ttgatatcgaattcctgcagc 2582
>emb|AJ868289.1| Transconjugation plasmid pBMK1 Length = 8613 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 85 ttgatatcgaattcctgcagc 105
>gb|AY733073.1| Cloning vector pSW29T, complete sequence Length = 1958 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 321 ttgatatcgaattcctgcagc 341
>gb|AY733072.1| Cloning vector pSW29, complete sequence Length = 1723 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 86 ttgatatcgaattcctgcagc 106
>gb|AY733071.1| Cloning vector pSW25T, complete sequence Length = 1963 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 321 ttgatatcgaattcctgcagc 341
>gb|AY733070.1| Cloning vector pSW25, complete sequence Length = 2175 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 533 ttgatatcgaattcctgcagc 553
>gb|AY733067.1| Cloning vector pSW24, complete sequence Length = 2029 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 533 ttgatatcgaattcctgcagc 553
>gb|AY733066.1| Cloning vector pSW23T, complete sequence Length = 1817 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 321 ttgatatcgaattcctgcagc 341
>gb|AY733065.1| Cloning vector pSW23, complete sequence Length = 1582 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 86 ttgatatcgaattcctgcagc 106
>emb|AJ416708.1|PDE416708 Populus deltoides MER locus, genomic DNA, cultivar S9-2 Length = 95055 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 94978 ttgatatcgaattcctgcagc 94958
>ref|NM_022693.2| Rattus norvegicus SH3-domain binding protein 4 (Sh3bp4), mRNA Length = 3520 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3456 ttgatatcgaattcctgcagc 3476
>gb|AF531173.1| Cloning vector pDblet, complete sequence Length = 6238 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2700 ttgatatcgaattcctgcagc 2720
>emb|X92518.1|HSHMGICP H.sapiens mRNA for HMGI-C protein Length = 4633 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 169 ttgatatcgaattcctgcagc 189
>gb|AF504908.1| Cloning vector pBBRT, complete sequence Length = 5973 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3282 ttgatatcgaattcctgcagc 3262
>gb|U89686.1|SCU89686 Saccharomyces cerevisiae synthetic green fluorescent protein (cox3::GFPm-3) gene, mitochondrial gene construct, complete cds Length = 1486 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1388 ttgatatcgaattcctgcagc 1368
>gb|U89685.1|SCU89685 Saccharomyces cerevisiae synthetic green fluorescent protein (cox3::GFPm) gene, mitochondrial gene construct, complete cds Length = 1486 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1388 ttgatatcgaattcctgcagc 1368
>gb|AF435436.1| Cloning vector pAM434, complete sequence Length = 3410 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1622 ttgatatcgaattcctgcagc 1602
>dbj|AB114435.1| Pseudorasbora parva DNA, microsatelite marker PA19 Length = 371 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 308 ttgatatcgaattcctgcagc 288
>dbj|AB060172.1| Misgurnus anguillicaudatus DNA, microsatellite Mac2 Length = 243 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 191 ttgatatcgaattcctgcagc 171
>gb|AF219920.1|F219907S14 Homo sapiens diacylglycerol kinase iota (DGKI) gene, exon 16 Length = 1060 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1031 ttgatatcgaattcctgcagc 1011
>gb|AF402295.1| pk[BIG-alpha] piggyBac transformation vector, complete sequence Length = 7414 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1117 ttgatatcgaattcctgcagc 1097
>gb|AF298789.1| Recombinase expression vector pSH63, complete sequence Length = 6869 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3572 ttgatatcgaattcctgcagc 3592
>gb|AF298785.1| Recombinase expression vector pSH62, complete sequence Length = 7051 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3754 ttgatatcgaattcctgcagc 3774
>gb|AF298782.1| Recombinase expression vector pSH47, complete sequence Length = 6979 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3744 ttgatatcgaattcctgcagc 3764
>gb|AF298780.1| Recombinase expression vector pSH65, partial sequence Length = 6979 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1674 ttgatatcgaattcctgcagc 1694
>gb|DQ236098.1| Himar1-delivery and mutagenesis vector pFNLTP16 H3, complete sequence Length = 10027 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3482 ttgatatcgaattcctgcagc 3502
>gb|AF190176.2|HHP3255S2 Homo sapiens/human papillomavirus type 16 strain 3255 3' junction sequence Length = 128 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 5 ttgatatcgaattcctgcagc 25
>gb|AF309798.1|AF309798 Clupea pallasi microsatellite Cha134 sequence Length = 508 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 438 ttgatatcgaattcctgcagc 418
>gb|AF309796.1|AF309796 Clupea pallasi microsatellite Cha125 sequence Length = 591 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 36 ttgatatcgaattcctgcagc 56
>gb|AF309795.1|AF309795 Clupea pallasi microsatellite Cha120 sequence Length = 656 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 583 ttgatatcgaattcctgcagc 563
>gb|AF309794.1|AF309794 Clupea pallasi microsatellite Cha115 sequence Length = 945 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 876 ttgatatcgaattcctgcagc 856
>gb|AF309793.1|AF309793 Clupea pallasi microsatellite Cha113 sequence Length = 525 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 74 ttgatatcgaattcctgcagc 94
>gb|AF309792.1|AF309792 Clupea pallasi microsatellite Cha107 sequence Length = 404 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 378 ttgatatcgaattcctgcagc 358
>gb|AF309790.1|AF309790 Clupea pallasi microsatellite Cha100 sequence Length = 678 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 599 ttgatatcgaattcctgcagc 579
>gb|AY640628.1| SiRNA vector pSUPER-hSyn-DsRed2N1-CytB-AS, complete sequence Length = 4829 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 708 ttgatatcgaattcctgcagc 728
>gb|AY640627.1| SiRNA vector pSUPER-CMV-EGFP-CytB-AS-ohneBgl, complete sequence Length = 4944 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 708 ttgatatcgaattcctgcagc 728
>gb|AY640626.1| SiRNA vector pSUPER-CMV-EGFP-CytB-AS, complete sequence Length = 4962 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 708 ttgatatcgaattcctgcagc 728
>gb|AY640625.1| SiRNA vector pSUPER-CMV-DsRed2N1-CytB-AS, complete sequence Length = 4906 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 708 ttgatatcgaattcctgcagc 728
>gb|AF519494.1| Shuttle vector pSpcP-lac, complete sequence Length = 4570 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 4163 ttgatatcgaattcctgcagc 4143
>gb|AF433043.1|AF433043 Cloning vector pWS32, complete sequence Length = 6928 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1884 ttgatatcgaattcctgcagc 1864
>gb|AF433042.1|AF433042 Cloning vector pWS31, complete sequence Length = 6875 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1884 ttgatatcgaattcctgcagc 1864
>gb|AF411123.1|AF411123 Transposon vector phiMycoMarT7, complete sequence Length = 2068 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 779 ttgatatcgaattcctgcagc 759
>gb|AF055567.1|AF055567 Wallabia bicolor isolate W88 retroposon CORE-SINE sequence Length = 547 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 6 ttgatatcgaattcctgcagc 26
>gb|AF174133.1|AF174133 Cloning vector pRS4213, complete sequence Length = 8182 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 4500 ttgatatcgaattcctgcagc 4520
>gb|AF174132.1|AF174132 Cloning vector pRS4210, complete sequence Length = 7168 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3486 ttgatatcgaattcctgcagc 3506
>gb|AF174131.1|AF174131 Cloning vector pRS4110, complete sequence Length = 6333 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3479 ttgatatcgaattcctgcagc 3499
>gb|S71745.1| influenza virus hemagglutinin 5' epitope tag=fusion protein {frame 3, multiple cloning site} [Saccharomyces cerevisiae=yeast, cloning vector YCpIF15,16,17, Other Plasmid Synthetic Partial, 169 nt] Length = 169 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 92 ttgatatcgaattcctgcagc 112
>gb|S71742.1| influenza virus hemagglutinin 5' epitope tag=fusion protein {frame 2, multiple cloning site} [Saccharomyces cerevisiae=yeast, cloning vector YCpIF15,16,17, Other Plasmid Synthetic Partial, 151 nt] Length = 151 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 74 ttgatatcgaattcctgcagc 94
>gb|S71730.1| influenza virus hemagglutinin 5' epitope tag=fusion protein {frame 1, multiple cloning site} [Saccharomyces cerevisiae=yeast, cloning vector YCpIF15,16,17, Other Plasmid Synthetic Partial, 135 nt] Length = 135 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 58 ttgatatcgaattcctgcagc 78
>gb|S71728.1| truncated protein {frame 1, multiple cloning site} [Saccharomyces cerevisiae=yeast, cloning vector YCpIF1-12, Other Plasmid Synthetic Partial, 99 nt] Length = 99 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 22 ttgatatcgaattcctgcagc 42
>emb|AJ620495.1| Mus musculus partial mRNA for non-selective cation channel TRPV1 (trpv1 gene) Length = 2669 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2620 ttgatatcgaattcctgcagc 2600
>gb|AY237648.1| Cloning vector pHR50, complete sequence Length = 11973 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 10268 ttgatatcgaattcctgcagc 10288
>gb|AY237649.1| Cloning vector pHR3-km, complete sequence Length = 6762 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 5057 ttgatatcgaattcctgcagc 5077
>gb|U56995.1|U56995 Cloning vector pGreenscript A complete sequence Length = 3062 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 786 ttgatatcgaattcctgcagc 806
>gb|AY008370.1| Glossina palpalis palpalis clone Pgp14 microsatellite sequence Length = 765 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 53 ttgatatcgaattcctgcagc 73
>gb|AY008368.1| Glossina palpalis palpalis clone Pgp29 microsatellite sequence Length = 1001 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 58 ttgatatcgaattcctgcagc 78
>gb|AY008367.1| Glossina palpalis palpalis clone Pgp28 microsatellite sequence Length = 638 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 227 ttgatatcgaattcctgcagc 207
>gb|AY034154.1| Cloning vector pIDN4, complete sequence Length = 2059 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 110 ttgatatcgaattcctgcagc 130
>gb|AF517126.1| Cloning vector pSPC-lac, complete sequence Length = 2650 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2243 ttgatatcgaattcctgcagc 2223
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 9875688 ttgatatcgaattcctgcagc 9875708
>gb|DQ023608.1| Yeast expression vector p426GALL, complete sequence Length = 6412 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2287 ttgatatcgaattcctgcagc 2307
>emb|BX890594.1|OSJN00301 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0062N22, complete sequence Length = 181586 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 116620 ttgatatcgaattcctgcagc 116640
>emb|AJ626721.1| Acetobacter pasteurianus partial ITS1, strain CCM 3615 Length = 913 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 70 ttgatatcgaattcctgcagc 90
>emb|AJ626720.1| Acetobacter pasteurianus partial ITS1, strain CCM 2374 Length = 832 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 763 ttgatatcgaattcctgcagc 743
>gb|AY785149.1| Cloning vector pFL122, complete sequence Length = 8652 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 8222 ttgatatcgaattcctgcagc 8202
>gb|AY785148.1| Suicide plasmid pEE3, complete sequence Length = 6393 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 6046 ttgatatcgaattcctgcagc 6026
>gb|AY237647.1| Cloning Vector pHRGFPGUS, complete sequence Length = 10313 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 8608 ttgatatcgaattcctgcagc 8628
>gb|AY237646.1| Cloning vector pHRGFPTC, complete sequence Length = 9233 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2657 ttgatatcgaattcctgcagc 2637 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcag 20 |||||||||||||||||||| Sbjct: 4186 ttgatatcgaattcctgcag 4205
>gb|AF327894.1|AF327894 Cloning vector pExchange 1, complete sequence Length = 3602 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 718 ttgatatcgaattcctgcagc 698
>dbj|AB161364.1| Cavia porcellus gene for trappin-12, complete cds Length = 10783 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3498 ttgatatcgaattcctgcagc 3478
>dbj|D34625.2| Homo sapiens TBXAS1 gene for thromboxane synthase, complete cds Length = 16886 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 12946 ttgatatcgaattcctgcagc 12926
>dbj|AB119275.1| Mus musculus GATA6 gene, exon 1 Length = 12813 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2242 ttgatatcgaattcctgcagc 2262
>gb|AF309797.1|AF309797 Clupea pallasi microsatellite Cha128 sequence Length = 671 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 71 ttgatatcgaattcctgcagc 91
>gb|AY822461.1| Yeast expression vector pJG515 chloramphenicol resistance protein (CmR) and CcdB (ccdB) genes, complete cds Length = 1774 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1749 ttgatatcgaattcctgcagc 1729
>gb|AY822460.1| Yeast expression vector pJG514 chloramphenicol resistance protein (CmR) and CcdB (ccdB) genes, complete cds Length = 1774 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1749 ttgatatcgaattcctgcagc 1729
>gb|AY822459.1| Yeast expression vector pJG483 chloramphenicol resistance protein (CmR) and CcdB (ccdB) genes, complete cds Length = 1774 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1749 ttgatatcgaattcctgcagc 1729
>gb|AY822458.1| Yeast expression vector pJG482 chloramphenicol resistance protein (CmR) and CcdB (ccdB) genes, complete cds Length = 1774 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1749 ttgatatcgaattcctgcagc 1729
>gb|AY822457.1| Yeast expression vector pJG518 chloramphenicol resistance protein (CmR) and CcdB (ccdB) genes, complete cds Length = 2535 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2510 ttgatatcgaattcctgcagc 2490
>gb|AY822456.1| Yeast expression vector pJG516 chloramphenicol resistance protein (CmR) and CcdB (ccdB) genes, complete cds Length = 2535 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2510 ttgatatcgaattcctgcagc 2490
>gb|AY822455.1| Yeast expression vector pJG484 chloramphenicol resistance protein (CmR) and CcdB (ccdB) genes, complete cds Length = 2535 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2510 ttgatatcgaattcctgcagc 2490
>gb|AY822454.1| Yeast expression vector pJG485 chloramphenicol resistance protein (CmR) and CcdB (ccdB) genes, complete cds Length = 2535 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2510 ttgatatcgaattcctgcagc 2490
>gb|U64449.2|CVU64449 Cloning vector pOPRSVIMCS from Lacswitch II System, complete sequence Length = 5647 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3139 ttgatatcgaattcctgcagc 3159
>gb|AF298791.1|AF298791 N-terminal GFP fusion vector pUG36, complete sequence Length = 6225 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2287 ttgatatcgaattcctgcagc 2307
>gb|AF298787.1|AF298787 C-terminal GFP fusion vector pUG35, complete sequence Length = 6231 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3013 ttgatatcgaattcctgcagc 3033
>gb|AF298784.1|AF298784 N-terminal GFP fusion vector pUG34, complete sequence Length = 6297 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2359 ttgatatcgaattcctgcagc 2379
>gb|AF298783.1|AF298783 C-terminal GFP fusion vector pUG23, complete sequence Length = 6303 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3085 ttgatatcgaattcctgcagc 3105
>gb|AF298781.1|AF298781 PCR template vector pUG30, complete sequence Length = 5785 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 664 ttgatatcgaattcctgcagc 644
>gb|AY196825.1| PiggyBac transformation vector pB-UGIR w+, complete sequence Length = 12677 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3072 ttgatatcgaattcctgcagc 3052
>gb|AY196824.1| PiggyBac transformation vector pB-UGateway w+, complete sequence Length = 11005 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3072 ttgatatcgaattcctgcagc 3052
>gb|AY196823.1| PiggyBac transformation vector pB-UAS w+, complete sequence Length = 8936 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1048 ttgatatcgaattcctgcagc 1028
>gb|AY196822.1| PiggyBac transformation vector pB-MCS w+, complete sequence Length = 8137 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 685 ttgatatcgaattcctgcagc 665
>gb|AY196821.1| PiggyBac helper plasmid pBlu-uTp, complete sequence Length = 7085 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 4844 ttgatatcgaattcctgcagc 4824
>gb|AF178453.1|AF178453 Integration vector pCD13PSK aminoglycoside adenyltransferase (aadA) and beta-galactosidase alpha peptide (lacZa) genes, complete cds Length = 4549 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 4078 ttgatatcgaattcctgcagc 4098
>gb|AF178452.1|AF178452 Integration vector pCD13PKS aminoglycoside adenyltransferase (aadA) and beta-galactosidase alpha peptide (lacZa) genes, complete cds Length = 4549 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 4105 ttgatatcgaattcctgcagc 4085
>gb|AF178450.1|AF178450 Integration vector pCD11PSK chloramphenicol transacetylase (cat) and beta-galactosidase alpha peptide (lacZa) genes, complete cds Length = 3485 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3014 ttgatatcgaattcctgcagc 3034
>gb|AF178449.1|AF178449 Integration vector pCD11PKS chloramphenicol transacetylase (cat) and beta-galactosidase alpha peptide (lacZa) genes, complete cds Length = 3485 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3041 ttgatatcgaattcctgcagc 3021
>gb|AF005420.1|AF005420 Expression vector pRIBOTEX, complete sequence Length = 6024 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1500 ttgatatcgaattcctgcagc 1480
>dbj|AB005559.1| Mus musculus DNA for cyclin G, complete cds Length = 7846 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 91 ttgatatcgaattcctgcagc 111
>emb|AJ571721.1|SCO571721 Cloning vector pBSL2A3 polylinker region Length = 168 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 70 ttgatatcgaattcctgcagc 50
>gb|AF153422.1|AF153422 Cloning vector pTG8, complete sequence Length = 3417 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 729 ttgatatcgaattcctgcagc 709
>emb|X85744.1|GGMYOGEN Gallus gallus myogenin gene Length = 876 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 28 ttgatatcgaattcctgcagc 48
>gb|M74016.1|YSCTRAM2 Cloning vector pYADE4 TRP1 and AMPr genes, complete cds Length = 6037 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 38 ttgatatcgaattcctgcagc 58
>gb|L08785.1|SYNBLKSPV BlueScribe KS Plus cloning vector Length = 2964 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 720 ttgatatcgaattcctgcagc 700
>gb|M22848.1|SYNPLKRB Cloning vector pUC129 DNA, polylinker region Length = 147 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 73 ttgatatcgaattcctgcagc 93
>gb|M22847.1|SYNPLKRA Cloning vector pUC128 DNA, polylinker region Length = 144 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 88 ttgatatcgaattcctgcagc 68
>emb|AJ228587.1|CVAJ8587 cotton leaf curl virus DNA fragment, isolate CLCuV-16.CP Length = 811 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 795 ttgatatcgaattcctgcagc 775
>emb|AJ228585.1|CVAJ8585 cotton leaf curl virus DNA fragment, isolate CLCuV-1.CP Length = 811 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 795 ttgatatcgaattcctgcagc 775
>gb|AF120715.1|AF120715 Saccharomyces kluyveri cytochrome c oxidase subunit II (COX2) gene, mitochondrial gene encoding mitochondrial protein, complete cds Length = 1321 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1321 ttgatatcgaattcctgcagc 1301
>emb|X63407.1|ECCYR E.coli cyr gene Length = 308 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 292 ttgatatcgaattcctgcagc 272
>emb|Z54211.1|ECSHET2B S.flexneri senA gene (isolate 2457T) Length = 2940 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 82 ttgatatcgaattcctgcagc 62
>emb|Z54194.1|ECSHET2A E.coli senA gene (isolate EI-34) Length = 2940 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 82 ttgatatcgaattcctgcagc 62
>emb|Z48742.1|HPNIXAGN H.pylori nixA gene Length = 2580 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 121 ttgatatcgaattcctgcagc 101
>gb|U31093.1|XXU31093 Synthetic construct of S. cerevisiae acetylornithine aminotransferase (cox3::ARG8m) gene, complete cds Length = 2042 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1944 ttgatatcgaattcctgcagc 1924
>emb|AJ132233.1|EGE132233 Enterobacter gergoviae glgC (partial) and glgA (partial) genes, strain 57-7 Length = 1536 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 22 ttgatatcgaattcctgcagc 42
>emb|X96758.1|ZMCCAP Z.mays mRNA for clathrin coat assembly protein Length = 887 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 873 ttgatatcgaattcctgcagc 853
>emb|Y17969.1|ATH17969 Arabidopsis thaliana erg gene Length = 2471 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1145 ttgatatcgaattcctgcagc 1165
>emb|AJ277561.1|LES277561 Lycopersicon esculentum partial mRNA for putative glutamine synthase (gts1 gene) Length = 905 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 626 ttgatatcgaattcctgcagc 606
>emb|X80830.1|NTSTR246N N.tabacum str246N gene Length = 4367 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 32 ttgatatcgaattcctgcagc 12
>emb|X79716.1|ATMS1 A.thaliana minisatellite sequence 1, chromosome 5 Length = 902 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2 ttgatatcgaattcctgcagc 22
>emb|AJ286353.1|ATH286353 Arabidopsis thaliana partial mRNA for hypothetical protein (DiDi 9C-7 gene) Length = 298 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 291 ttgatatcgaattcctgcagc 271
>emb|X79425.1|ATAG4 A.thaliana microsatellite [repeated motif (tc)7] Length = 280 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 68 ttgatatcgaattcctgcagc 88
>gb|AF179625.1|AF179625 Shuttle vector pCS513, complete sequence Length = 18271 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2659 ttgatatcgaattcctgcagc 2679
>gb|AF184978.1|AF184978 Binary vector pCLD04541, complete sequence Length = 27608 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 27600 ttgatatcgaattcctgcagc 27580
>gb|AF179626.1|AF179626 Expression vector pGP100, complete sequence Length = 19012 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2659 ttgatatcgaattcctgcagc 2679
>gb|AF178582.1|AF178582 Expression vector pCS316 complete sequence Length = 17205 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2659 ttgatatcgaattcctgcagc 2679
>gb|AF135243.1|MMFBLN2S06 Mus musculus fibulin-2 (Fbln2) gene, exon 6 Length = 490 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 86 ttgatatcgaattcctgcagc 106
>gb|U46018.1|CVU46018 Cloning vector pCRSCRIPT Cam, complete sequence Length = 3399 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 693 ttgatatcgaattcctgcagc 713
>gb|U46017.1|CVU46017 Cloning vector pCRSCRIPT SK[+], complete sequence Length = 2961 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 693 ttgatatcgaattcctgcagc 713
>gb|AF139061.1|AF139061 Binary vector pCB301, complete sequence Length = 3574 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3367 ttgatatcgaattcctgcagc 3347
>gb|AF092842.1|AF092842 Mycobacterium marinum G13 promoter construct Length = 766 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 488 ttgatatcgaattcctgcagc 468
>gb|AF110459.1|AF110459 Cloning vector pBBR1-GFP, complete sequence Length = 6640 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2657 ttgatatcgaattcctgcagc 2637 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcag 20 |||||||||||||||||||| Sbjct: 4186 ttgatatcgaattcctgcag 4205
>emb|X81813.1|SCCDC1 S.cerevisiae CDC1 gene Length = 2664 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 38 ttgatatcgaattcctgcagc 58
>gb|AY568055.1| Cloning vector pAGRIKOLA, complete sequence Length = 10459 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 3918 ttgatatcgaattcctgcagc 3938
>emb|AJ000347.1|RN325SAL3 Rattus norvegicus mRNA for 3'(2'),5'-bisphosphate nucleotidase Length = 2002 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1996 ttgatatcgaattcctgcagc 1976
>gb|AF071266.1|AF071266 Danio rerio homeobox protein (hoxc6b) gene, complete cds Length = 1972 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 42 ttgatatcgaattcctgcagc 62
>dbj|AB064982.1| Mus musculus gene for Bmal1, 5' upstream sequence and exon 1 Length = 8143 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 27 ttgatatcgaattcctgcagc 47
>gb|U47947.1|CVU47947 Cloning vector pGreenscript I, complete sequence including green fluorescent protein (AGP1) mRNA, partial cds Length = 3062 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 786 ttgatatcgaattcctgcagc 806
>emb|AJ428509.1|MMU428509 Mus musculus partial NID-2 gene for nidogen-2, exon 15 Length = 1067 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 73 ttgatatcgaattcctgcagc 93
>emb|AJ428508.1|MMU428508 Mus musculus partial NID-2 gene for nidogen-2, exon 14 Length = 813 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 747 ttgatatcgaattcctgcagc 727
>gb|U43955.1|XXU43955 Expression vector pBRz, complete cds Length = 2998 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 693 ttgatatcgaattcctgcagc 713
>emb|X16918.1|HSPFK10 Human PFKL gene for liver-type 6-phosphofructokinase (EC 2.7.1.11) exon 10 Length = 583 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 46 ttgatatcgaattcctgcagc 26
>emb|X54650.1|DMFRIZZ3 D. melanogaster frizzled gene exons 3 and 4 Length = 1047 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 928 ttgatatcgaattcctgcagc 948
>dbj|AB078779.1| Cloning vector pSTH1-GFP DNA, complete sequence Length = 7784 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 4272 ttgatatcgaattcctgcagc 4252
>dbj|D85525.1|SYNPBEN66 Cloning vector pBEN66 DNA for aminoglycoside 3'-phosphotransferase, beta-lactamase, complete cds Length = 3306 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 88 ttgatatcgaattcctgcagc 108
>dbj|AB055064.1| Synthetic transposable element dAc-I-RS DNA, complete sequence Length = 7635 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 4733 ttgatatcgaattcctgcagc 4713 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1939 ttgatatcgaattcctgcagc 1919
>emb|Y09374.1|ASPGREEN2 Artificial sequences, plasmid vector pGreen-2 Length = 3633 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2277 ttgatatcgaattcctgcagc 2257
>emb|X98363.1|PVPIJ2581 Cloning vector pIJ2581 glkA gene for glucose kinase and tsr gene for thiostrepton resistance protein Length = 5192 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2927 ttgatatcgaattcctgcagc 2947
>gb|AY557620.1| Shuttle vector pELS100, complete sequence Length = 7022 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 6558 ttgatatcgaattcctgcagc 6578
>emb|X52330.1|ARBL2SKM pBluescript II SK(-) vector DNA, phagemid excised from lambda ZAPII Length = 2961 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 693 ttgatatcgaattcctgcagc 713
>emb|X52329.1|ARBL2KSM pBluescript II KS(-) vector DNA, phagemid excised from lambda ZAPII Length = 2961 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 720 ttgatatcgaattcctgcagc 700
>emb|X52328.1|ARBL2SKP pBluescript II SK(+) vector DNA, phagemid excised from lambda ZAPII Length = 2961 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 693 ttgatatcgaattcctgcagc 713
>emb|X52327.1|ARBL2KSP pBluescript II KS(+) vector DNA, phagemid excised from lambda ZAPII Length = 2961 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 720 ttgatatcgaattcctgcagc 700
>emb|X52331.1|ARBLKSP pBluescript KS(+) vector DNA, phagemid excised from lambda ZAP Length = 2958 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 720 ttgatatcgaattcctgcagc 700
>emb|X52326.1|ARBLKSM pBluescript KS(-) vector DNA, phagemid excised from lambda ZAP Length = 2958 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 720 ttgatatcgaattcctgcagc 700
>emb|X52325.1|ARBLSKP pBluescript SK(+) vector DNA, phagemid excised from lambda ZAP Length = 2958 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 693 ttgatatcgaattcctgcagc 713
>emb|X52324.1|ARBLSKM pBluescript SK(-) vector DNA, phagemid excised from lambda ZAP Length = 2958 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 693 ttgatatcgaattcctgcagc 713
>emb|AJ403984.1|CVE403984 Cloning vector pBPSKan2 Length = 4358 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 2088 ttgatatcgaattcctgcagc 2108 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 691 ttgatatcgaattcctgcagc 711
>emb|AJ403983.1|CVE403983 Cloning vector pBPSGen4 Length = 3970 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1700 ttgatatcgaattcctgcagc 1720 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 691 ttgatatcgaattcctgcagc 711
>emb|AJ403982.1|CVE403982 Cloning vector pBPSCat2 Length = 4154 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1884 ttgatatcgaattcctgcagc 1904 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 691 ttgatatcgaattcctgcagc 711
>emb|AJ005330.1|ASAJ5330 pGAII(-) SK positive selection cloning vector gltS gene Length = 4670 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1887 ttgatatcgaattcctgcagc 1907
>emb|AJ005329.1|ASAJ5329 pGAII(-) KS positive selection cloning vector gltS gene Length = 4670 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1914 ttgatatcgaattcctgcagc 1894
>emb|AJ005327.1|ASAJ5327 pGAII(+) SK positive selection cloning vector gltS gene Length = 4670 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 ttgatatcgaattcctgcagc 21 ||||||||||||||||||||| Sbjct: 1494 ttgatatcgaattcctgcagc 1474 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,763,652 Number of Sequences: 3902068 Number of extensions: 3763652 Number of successful extensions: 61076 Number of sequences better than 10.0: 440 Number of HSP's better than 10.0 without gapping: 440 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 59834 Number of HSP's gapped (non-prelim): 1242 length of query: 593 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 570 effective length of database: 17,143,297,704 effective search space: 9771679691280 effective search space used: 9771679691280 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)