ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart14b11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY430222.1| Regalecus glesne recombination activating protein... 40 0.85
2gb|AY380535.1| Salvelinus malma recombination-activating protein... 40 0.85
3gb|AY552034.1| Hypancistrus sp. CAC-2004 RAG1 gene, exon 3 and p... 40 0.85
4gb|AY308790.1| Rhinecanthus aculeatus recombinase activating gen... 38 3.4
5gb|AY308783.1| Mugil curema recombinase activating gene-1 (RAG1)... 38 3.4
6gb|AY308771.1| Scomberesox saurus recombinase activating gene-1 ... 38 3.4
7gb|AY359225.1| Gymnotus cf. maculosus specimen-voucher STRI-1470... 38 3.4
8gb|AF043698.2| Caenorhabditis elegans cosmid C54G6, complete seq... 38 3.4
9ref|XM_694775.1| PREDICTED: Danio rerio similar to Kinetochore-a... 38 3.4
10gb|AY700320.1| Balistoides viridescens isolate BA16 recombinase ... 38 3.4
11gb|AY700318.1| Abalistes stellatus isolate BA14 recombinase acti... 38 3.4
12gb|AY700316.1| Xanthichthys auromarginatus isolate BA12 recombin... 38 3.4
13gb|AY700315.1| Rhinecanthus assasi isolate BA11 recombinase acti... 38 3.4
14gb|AY700314.1| Pseudobalistes fuscus isolate BA09 recombinase ac... 38 3.4
15gb|AY700313.1| Melichthys niger isolate BA07 recombinase activat... 38 3.4
16gb|AY700312.1| Canthidermis maculatus isolate BA06 recombinase a... 38 3.4
17gb|AY700311.1| Balistoides conspicillum isolate BA05 recombinase... 38 3.4
18gb|AY700310.1| Balistes vetula isolate BA03 recombinase activati... 38 3.4
19gb|AY700309.1| Balistes polylepis isolate BA02 recombinase activ... 38 3.4
20gb|AY700308.1| Balistes capriscus isolate BA01 recombinase activ... 38 3.4 
>gb|AY430222.1| Regalecus glesne recombination activating protein 1 (RAG1) gene,
           partial cds
          Length = 1469

 Score = 40.1 bits (20), Expect = 0.85
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 52  tgacatcccccatgccatcg 71
           ||||||||||||||||||||
Sbjct: 333 tgacatcccccatgccatcg 314
to top
>gb|AY380535.1| Salvelinus malma recombination-activating protein 1 (RAG1) gene,
           partial cds
          Length = 1556

 Score = 40.1 bits (20), Expect = 0.85
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 52  tgacatcccccatgccatcg 71
           ||||||||||||||||||||
Sbjct: 366 tgacatcccccatgccatcg 347
to top
>gb|AY552034.1| Hypancistrus sp. CAC-2004 RAG1 gene, exon 3 and partial cds
          Length = 938

 Score = 40.1 bits (20), Expect = 0.85
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 52  tgacatcccccatgccatcg 71
           ||||||||||||||||||||
Sbjct: 366 tgacatcccccatgccatcg 347
to top
>gb|AY308790.1| Rhinecanthus aculeatus recombinase activating gene-1 (RAG1) gene,
           partial cds
          Length = 1447

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 52  tgacatcccccatgccatc 70
           |||||||||||||||||||
Sbjct: 316 tgacatcccccatgccatc 298
to top
>gb|AY308783.1| Mugil curema recombinase activating gene-1 (RAG1) gene, partial cds
          Length = 1455

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 52  tgacatcccccatgccatc 70
           |||||||||||||||||||
Sbjct: 316 tgacatcccccatgccatc 298
to top
>gb|AY308771.1| Scomberesox saurus recombinase activating gene-1 (RAG1) gene,
           partial cds
          Length = 1455

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 52  tgacatcccccatgccatc 70
           |||||||||||||||||||
Sbjct: 316 tgacatcccccatgccatc 298
to top
>gb|AY359225.1| Gymnotus cf. maculosus specimen-voucher STRI-1470 RAG-1 (RAG-1)
           gene, partial cds
          Length = 1171

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 52  tgacatcccccatgccatc 70
           |||||||||||||||||||
Sbjct: 346 tgacatcccccatgccatc 328
to top
>gb|AF043698.2| Caenorhabditis elegans cosmid C54G6, complete sequence
          Length = 27396

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 20    tcatttttccccgagcaac 38
             |||||||||||||||||||
Sbjct: 16595 tcatttttccccgagcaac 16577
to top
>ref|XM_694775.1| PREDICTED: Danio rerio similar to Kinetochore-associated protein 1
           (Rough deal homolog) (hRod) (HsROD) (Rod) (LOC571206),
           partial mRNA
          Length = 606

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 2   ctctagctaacactcgctt 20
           |||||||||||||||||||
Sbjct: 479 ctctagctaacactcgctt 497
to top
>gb|AY700320.1| Balistoides viridescens isolate BA16 recombinase activating gene 1
           (RAG1) gene, partial cds
          Length = 1392

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 52  tgacatcccccatgccatc 70
           |||||||||||||||||||
Sbjct: 289 tgacatcccccatgccatc 271
to top
>gb|AY700318.1| Abalistes stellatus isolate BA14 recombinase activating gene 1
           (RAG1) gene, partial cds
          Length = 1392

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 52  tgacatcccccatgccatc 70
           |||||||||||||||||||
Sbjct: 289 tgacatcccccatgccatc 271
to top
>gb|AY700316.1| Xanthichthys auromarginatus isolate BA12 recombinase activating
           gene 1 (RAG1) gene, partial cds
          Length = 1379

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 52  tgacatcccccatgccatc 70
           |||||||||||||||||||
Sbjct: 276 tgacatcccccatgccatc 258
to top
>gb|AY700315.1| Rhinecanthus assasi isolate BA11 recombinase activating gene 1
           (RAG1) gene, partial cds
          Length = 1392

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 52  tgacatcccccatgccatc 70
           |||||||||||||||||||
Sbjct: 289 tgacatcccccatgccatc 271
to top
>gb|AY700314.1| Pseudobalistes fuscus isolate BA09 recombinase activating gene 1
           (RAG1) gene, partial cds
          Length = 1392

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 52  tgacatcccccatgccatc 70
           |||||||||||||||||||
Sbjct: 289 tgacatcccccatgccatc 271
to top
>gb|AY700313.1| Melichthys niger isolate BA07 recombinase activating gene 1 (RAG1)
           gene, partial cds
          Length = 1392

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 52  tgacatcccccatgccatc 70
           |||||||||||||||||||
Sbjct: 289 tgacatcccccatgccatc 271
to top
>gb|AY700312.1| Canthidermis maculatus isolate BA06 recombinase activating gene 1
           (RAG1) gene, partial cds
          Length = 1377

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 52  tgacatcccccatgccatc 70
           |||||||||||||||||||
Sbjct: 289 tgacatcccccatgccatc 271
to top
>gb|AY700311.1| Balistoides conspicillum isolate BA05 recombinase activating gene 1
           (RAG1) gene, partial cds
          Length = 1392

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 52  tgacatcccccatgccatc 70
           |||||||||||||||||||
Sbjct: 289 tgacatcccccatgccatc 271
to top
>gb|AY700310.1| Balistes vetula isolate BA03 recombinase activating gene 1 (RAG1)
           gene, partial cds
          Length = 1392

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 52  tgacatcccccatgccatc 70
           |||||||||||||||||||
Sbjct: 289 tgacatcccccatgccatc 271
to top
>gb|AY700309.1| Balistes polylepis isolate BA02 recombinase activating gene 1
           (RAG1) gene, partial cds
          Length = 1392

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 52  tgacatcccccatgccatc 70
           |||||||||||||||||||
Sbjct: 289 tgacatcccccatgccatc 271
to top
>gb|AY700308.1| Balistes capriscus isolate BA01 recombinase activating gene 1
           (RAG1) gene, partial cds
          Length = 1392

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 52  tgacatcccccatgccatc 70
           |||||||||||||||||||
Sbjct: 289 tgacatcccccatgccatc 271


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 481,524
Number of Sequences: 3902068
Number of extensions: 481524
Number of successful extensions: 27921
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27901
Number of HSP's gapped (non-prelim): 20
length of query: 81
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 60
effective length of database: 17,151,101,840
effective search space: 1029066110400
effective search space used: 1029066110400
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top