>gb|AY157498.1| Synechococcus sp. PCC 7942 cosmid 4G8, complete sequence
          Length = 31404

 Score = 56.0 bits (28), Expect = 2e-06
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 1     gtcgggtattggtaatgacatccgataa 28
             ||||||||||||||||||||||||||||
Sbjct: 21335 gtcgggtattggtaatgacatccgataa 21308

>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 56.0 bits (28), Expect = 2e-06
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                           
Query: 1       gtcgggtattggtaatgacatccgataa 28
               ||||||||||||||||||||||||||||
Sbjct: 2425770 gtcgggtattggtaatgacatccgataa 2425743

>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome
          Length = 2695903

 Score = 56.0 bits (28), Expect = 2e-06
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                           
Query: 1       gtcgggtattggtaatgacatccgataa 28
               ||||||||||||||||||||||||||||
Sbjct: 1891281 gtcgggtattggtaatgacatccgataa 1891308

>gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Philadelphia 1, complete
               genome
          Length = 3397754

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                                
Query: 6       gtattggtaatgacatc 22
               |||||||||||||||||
Sbjct: 1708690 gtattggtaatgacatc 1708706

>emb|CR381619.9| Zebrafish DNA sequence from clone DKEY-1O2 in linkage group 5, complete
              sequence
          Length = 266753

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                               
Query: 11     ggtaatgacatccgata 27
              |||||||||||||||||
Sbjct: 252339 ggtaatgacatccgata 252355

>emb|CR628337.1| Legionella pneumophila str. Lens complete genome
          Length = 3345687

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                                
Query: 6       gtattggtaatgacatc 22
               |||||||||||||||||
Sbjct: 1651278 gtattggtaatgacatc 1651262

>emb|CR628336.1| Legionella pneumophila str. Paris complete genome
          Length = 3503610

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                                
Query: 6       gtattggtaatgacatc 22
               |||||||||||||||||
Sbjct: 1674628 gtattggtaatgacatc 1674644

>emb|BX649384.6| Zebrafish DNA sequence from clone CH211-199G17 in linkage group 19,
             complete sequence
          Length = 190998

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                              
Query: 14    aatgacatccgataaag 30
             |||||||||||||||||
Sbjct: 28296 aatgacatccgataaag 28312

>emb|AM050637.1| Blattella germanica mRNA for vitellogenin receptor (vgR gene)
          Length = 5768

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 13   taatgacatccgataaa 29
            |||||||||||||||||
Sbjct: 4318 taatgacatccgataaa 4302


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 92,701
Number of Sequences: 3902068
Number of extensions: 92701
Number of successful extensions: 21739
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 21671
Number of HSP's gapped (non-prelim): 68
length of query: 30
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 10
effective length of database: 17,155,003,908
effective search space: 171550039080
effective search space used: 171550039080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)