>gb|AC025571.20| Homo sapiens 3 BAC RP11-515C21 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 159902

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 190   actcacatgcatgcacagacac 211
             ||||||||||||||||||||||
Sbjct: 66966 actcacatgcatgcacagacac 66987

>gb|AC011424.4| Homo sapiens chromosome 5 clone P1_1242F12, complete sequence
          Length = 84991

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 10    aataaattaataattcatgctcca 33
             |||| |||||||||||||||||||
Sbjct: 49447 aatagattaataattcatgctcca 49424

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 153    gggaaaacggcgatccatgg 172
              ||||||||||||||||||||
Sbjct: 410640 gggaaaacggcgatccatgg 410659

>emb|BX663521.10| Zebrafish DNA sequence from clone DKEYP-50F5 in linkage group 14,
              complete sequence
          Length = 179663

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     cggttttacaggttcaatcc 77
              ||||||||||||||||||||
Sbjct: 113082 cggttttacaggttcaatcc 113101

>emb|CR847890.19| Zebrafish DNA sequence from clone DKEYP-70H9 in linkage group 14,
             complete sequence
          Length = 217550

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 8     acaataaattaataattcat 27
             ||||||||||||||||||||
Sbjct: 64381 acaataaattaataattcat 64400

>emb|CT030247.6| Mouse DNA sequence from clone RP23-340G24 on chromosome 9, complete
              sequence
          Length = 218753

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 5      cacacaataaattaataatt 24
              ||||||||||||||||||||
Sbjct: 208348 cacacaataaattaataatt 208329

>gb|AC002209.1|AC002209 Homo sapiens (subclone 2_e10 from P1 H31) DNA sequence, complete
            sequence
          Length = 4858

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 10   aataaattaataattcatgctcca 33
            |||| |||||||||||||||||||
Sbjct: 4251 aatagattaataattcatgctcca 4274

>emb|AL928882.10| Mouse DNA sequence from clone RP23-281I20 on chromosome 2, complete
             sequence
          Length = 147002

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 6     acacaataaattaataattc 25
             ||||||||||||||||||||
Sbjct: 83233 acacaataaattaataattc 83214

>emb|AL591544.30| Mouse DNA sequence from clone RP23-386D6 on chromosome 11, complete
             sequence
          Length = 201673

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 192   tcacatgcatgcacagacac 211
             ||||||||||||||||||||
Sbjct: 42516 tcacatgcatgcacagacac 42535


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,051,534
Number of Sequences: 3902068
Number of extensions: 2051534
Number of successful extensions: 174761
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 174715
Number of HSP's gapped (non-prelim): 46
length of query: 211
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 189
effective length of database: 17,147,199,772
effective search space: 3240820756908
effective search space used: 3240820756908
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)