Clone Name | rbart13e06 |
---|---|
Clone Library Name | barley_pub |
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 184 bits (93), Expect = 2e-43 Identities = 186/217 (85%) Strand = Plus / Minus Query: 245 ggcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcga 304 |||||||||||| || |||||| ||||| ||| | |||||| ||||| | ||| |||| Sbjct: 187235 ggcaggtgaagtcggaggggcaggtcttgtggcagtagttgagaaggagagagagatcga 187176 Query: 305 tggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacgg 364 ||||| ||||| ||||||||||||||||||||| ||||||||||||||||||| |||| Sbjct: 187175 cggggatgttgagattgatgccgaggatgttggccttgatggcggtgcagaggcagacgg 187116 Query: 365 cggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgctcgttggccggcacgc 424 |||||||||||||| |||| || ||||| | ||||||||||||||| | ||||||||| Sbjct: 187115 cggcgtcgaggtcgacgaggccacccagcaacgggcagcactgctcgctctccggcacgc 187056 Query: 425 caatcttaagcttcagcaggttcagcacgttgccgca 461 | ||||| |||||||||||||| ||||||||| |||| Sbjct: 187055 cgatcttcagcttcagcaggttgagcacgttggcgca 187019 Score = 167 bits (84), Expect = 4e-38 Identities = 156/180 (86%) Strand = Plus / Minus Query: 282 gttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggccct 341 |||||| |||||| |||||||| |||||| |||| ||||||||||||| ||||||| | Sbjct: 189902 gttgaggaggaggacgaggtcgacggggacgttgatgttgatgccgaggacgttggcctt 189843 Query: 342 gatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggca 401 |||||||||||||||||| |||||||||||||||||| ||||||| ||||| || ||||| Sbjct: 189842 gatggcggtgcagaggcagacggcggcgtcgaggtcgacgagcccccccagcagcgggca 189783 Query: 402 gcactgctcgttggccggcacgccaatcttaagcttcagcaggttcagcacgttgccgca 461 ||||| |||| | |||||||| || | ||| ||||| |||||||| ||||||||| |||| Sbjct: 189782 gcactcctcgctcgccggcacccccaccttgagcttgagcaggttgagcacgttggcgca 189723 Score = 101 bits (51), Expect = 2e-18 Identities = 84/95 (88%) Strand = Plus / Minus Query: 289 aggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggccctgatggcg 348 |||||| |||||| |||||||| ||||| |||||||| ||||||||||| | || |||| Sbjct: 198916 aggaggctgaggttgatggggaggttgaggttgatgccaaggatgttggcgcggagggcg 198857 Query: 349 gtgcagaggcacacggcggcgtcgaggtcggcgag 383 |||||||||||||||||||| || ||||||||||| Sbjct: 198856 gtgcagaggcacacggcggcctcaaggtcggcgag 198822 Score = 65.9 bits (33), Expect = 1e-07 Identities = 87/105 (82%) Strand = Plus / Minus Query: 339 cctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgg 398 ||||||||||| |||||||||| | ||||||||||||| |||| | ||||| || || Sbjct: 28817161 cctgatggcggcgcagaggcacgccgcggcgtcgaggttcacgaggctccccagcagcgg 28817102 Query: 399 gcagcactgctcgttggccggcacgccaatcttaagcttcagcag 443 ||||||||||| | | ||||||||| ||||| ||||||||||| Sbjct: 28817101 gcagcactgctggctcgccggcacgttgatcttcagcttcagcag 28817057 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Plus Query: 348 ggtgcagaggcacacggcggcgtcgaggtcggcgag 383 |||||||||||| ||| |||||||||||||| |||| Sbjct: 33114069 ggtgcagaggcagacgacggcgtcgaggtcgacgag 33114104
>gb|AY466108.1| Oryza sativa (japonica cultivar-group) lipid transfer protein-like protein (LTP1) mRNA, complete cds Length = 772 Score = 184 bits (93), Expect = 2e-43 Identities = 186/217 (85%) Strand = Plus / Minus Query: 245 ggcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcga 304 |||||||||||| || |||||| ||||| ||| | |||||| ||||| | ||| |||| Sbjct: 529 ggcaggtgaagtcggaggggcaggtcttgtggcagtagttgagaaggagagagagatcga 470 Query: 305 tggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacgg 364 ||||| ||||| ||||||||||||||||||||| ||||||||||||||||||| |||| Sbjct: 469 cggggatgttgagattgatgccgaggatgttggccttgatggcggtgcagaggcagacgg 410 Query: 365 cggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgctcgttggccggcacgc 424 |||||||||||||| |||| || ||||| | ||||||||||||||| | ||||||||| Sbjct: 409 cggcgtcgaggtcgacgaggccacccagcaacgggcagcactgctcgctctccggcacgc 350 Query: 425 caatcttaagcttcagcaggttcagcacgttgccgca 461 | ||||| |||||||||||||| ||||||||| |||| Sbjct: 349 cgatcttcagcttcagcaggttgagcacgttggcgca 313
>gb|AC118673.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBb0080O10, from chromosome 3, complete sequence Length = 127917 Score = 184 bits (93), Expect = 2e-43 Identities = 186/217 (85%) Strand = Plus / Minus Query: 245 ggcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcga 304 |||||||||||| || |||||| ||||| ||| | |||||| ||||| | ||| |||| Sbjct: 24302 ggcaggtgaagtcggaggggcaggtcttgtggcagtagttgagaaggagagagagatcga 24243 Query: 305 tggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacgg 364 ||||| ||||| ||||||||||||||||||||| ||||||||||||||||||| |||| Sbjct: 24242 cggggatgttgagattgatgccgaggatgttggccttgatggcggtgcagaggcagacgg 24183 Query: 365 cggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgctcgttggccggcacgc 424 |||||||||||||| |||| || ||||| | ||||||||||||||| | ||||||||| Sbjct: 24182 cggcgtcgaggtcgacgaggccacccagcaacgggcagcactgctcgctctccggcacgc 24123 Query: 425 caatcttaagcttcagcaggttcagcacgttgccgca 461 | ||||| |||||||||||||| ||||||||| |||| Sbjct: 24122 cgatcttcagcttcagcaggttgagcacgttggcgca 24086 Score = 167 bits (84), Expect = 4e-38 Identities = 156/180 (86%) Strand = Plus / Minus Query: 282 gttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggccct 341 |||||| |||||| |||||||| |||||| |||| ||||||||||||| ||||||| | Sbjct: 26969 gttgaggaggaggacgaggtcgacggggacgttgatgttgatgccgaggacgttggcctt 26910 Query: 342 gatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggca 401 |||||||||||||||||| |||||||||||||||||| ||||||| ||||| || ||||| Sbjct: 26909 gatggcggtgcagaggcagacggcggcgtcgaggtcgacgagcccccccagcagcgggca 26850 Query: 402 gcactgctcgttggccggcacgccaatcttaagcttcagcaggttcagcacgttgccgca 461 ||||| |||| | |||||||| || | ||| ||||| |||||||| ||||||||| |||| Sbjct: 26849 gcactcctcgctcgccggcacccccaccttgagcttgagcaggttgagcacgttggcgca 26790 Score = 101 bits (51), Expect = 2e-18 Identities = 84/95 (88%) Strand = Plus / Minus Query: 289 aggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggccctgatggcg 348 |||||| |||||| |||||||| ||||| |||||||| ||||||||||| | || |||| Sbjct: 35983 aggaggctgaggttgatggggaggttgaggttgatgccaaggatgttggcgcggagggcg 35924 Query: 349 gtgcagaggcacacggcggcgtcgaggtcggcgag 383 |||||||||||||||||||| || ||||||||||| Sbjct: 35923 gtgcagaggcacacggcggcctcaaggtcggcgag 35889
>gb|AC125411.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNAb0079B22, from chromosome 3, complete sequence Length = 156933 Score = 184 bits (93), Expect = 2e-43 Identities = 186/217 (85%) Strand = Plus / Minus Query: 245 ggcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcga 304 |||||||||||| || |||||| ||||| ||| | |||||| ||||| | ||| |||| Sbjct: 121235 ggcaggtgaagtcggaggggcaggtcttgtggcagtagttgagaaggagagagagatcga 121176 Query: 305 tggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacgg 364 ||||| ||||| ||||||||||||||||||||| ||||||||||||||||||| |||| Sbjct: 121175 cggggatgttgagattgatgccgaggatgttggccttgatggcggtgcagaggcagacgg 121116 Query: 365 cggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgctcgttggccggcacgc 424 |||||||||||||| |||| || ||||| | ||||||||||||||| | ||||||||| Sbjct: 121115 cggcgtcgaggtcgacgaggccacccagcaacgggcagcactgctcgctctccggcacgc 121056 Query: 425 caatcttaagcttcagcaggttcagcacgttgccgca 461 | ||||| |||||||||||||| ||||||||| |||| Sbjct: 121055 cgatcttcagcttcagcaggttgagcacgttggcgca 121019 Score = 167 bits (84), Expect = 4e-38 Identities = 156/180 (86%) Strand = Plus / Minus Query: 282 gttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggccct 341 |||||| |||||| |||||||| |||||| |||| ||||||||||||| ||||||| | Sbjct: 123902 gttgaggaggaggacgaggtcgacggggacgttgatgttgatgccgaggacgttggcctt 123843 Query: 342 gatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggca 401 |||||||||||||||||| |||||||||||||||||| ||||||| ||||| || ||||| Sbjct: 123842 gatggcggtgcagaggcagacggcggcgtcgaggtcgacgagcccccccagcagcgggca 123783 Query: 402 gcactgctcgttggccggcacgccaatcttaagcttcagcaggttcagcacgttgccgca 461 ||||| |||| | |||||||| || | ||| ||||| |||||||| ||||||||| |||| Sbjct: 123782 gcactcctcgctcgccggcacccccaccttgagcttgagcaggttgagcacgttggcgca 123723 Score = 101 bits (51), Expect = 2e-18 Identities = 84/95 (88%) Strand = Plus / Minus Query: 289 aggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggccctgatggcg 348 |||||| |||||| |||||||| ||||| |||||||| ||||||||||| | || |||| Sbjct: 132916 aggaggctgaggttgatggggaggttgaggttgatgccaaggatgttggcgcggagggcg 132857 Query: 349 gtgcagaggcacacggcggcgtcgaggtcggcgag 383 |||||||||||||||||||| || ||||||||||| Sbjct: 132856 gtgcagaggcacacggcggcctcaaggtcggcgag 132822
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 184 bits (93), Expect = 2e-43 Identities = 186/217 (85%) Strand = Plus / Minus Query: 245 ggcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcga 304 |||||||||||| || |||||| ||||| ||| | |||||| ||||| | ||| |||| Sbjct: 187235 ggcaggtgaagtcggaggggcaggtcttgtggcagtagttgagaaggagagagagatcga 187176 Query: 305 tggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacgg 364 ||||| ||||| ||||||||||||||||||||| ||||||||||||||||||| |||| Sbjct: 187175 cggggatgttgagattgatgccgaggatgttggccttgatggcggtgcagaggcagacgg 187116 Query: 365 cggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgctcgttggccggcacgc 424 |||||||||||||| |||| || ||||| | ||||||||||||||| | ||||||||| Sbjct: 187115 cggcgtcgaggtcgacgaggccacccagcaacgggcagcactgctcgctctccggcacgc 187056 Query: 425 caatcttaagcttcagcaggttcagcacgttgccgca 461 | ||||| |||||||||||||| ||||||||| |||| Sbjct: 187055 cgatcttcagcttcagcaggttgagcacgttggcgca 187019 Score = 167 bits (84), Expect = 4e-38 Identities = 156/180 (86%) Strand = Plus / Minus Query: 282 gttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggccct 341 |||||| |||||| |||||||| |||||| |||| ||||||||||||| ||||||| | Sbjct: 189902 gttgaggaggaggacgaggtcgacggggacgttgatgttgatgccgaggacgttggcctt 189843 Query: 342 gatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggca 401 |||||||||||||||||| |||||||||||||||||| ||||||| ||||| || ||||| Sbjct: 189842 gatggcggtgcagaggcagacggcggcgtcgaggtcgacgagcccccccagcagcgggca 189783 Query: 402 gcactgctcgttggccggcacgccaatcttaagcttcagcaggttcagcacgttgccgca 461 ||||| |||| | |||||||| || | ||| ||||| |||||||| ||||||||| |||| Sbjct: 189782 gcactcctcgctcgccggcacccccaccttgagcttgagcaggttgagcacgttggcgca 189723 Score = 101 bits (51), Expect = 2e-18 Identities = 84/95 (88%) Strand = Plus / Minus Query: 289 aggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggccctgatggcg 348 |||||| |||||| |||||||| ||||| |||||||| ||||||||||| | || |||| Sbjct: 198916 aggaggctgaggttgatggggaggttgaggttgatgccaaggatgttggcgcggagggcg 198857 Query: 349 gtgcagaggcacacggcggcgtcgaggtcggcgag 383 |||||||||||||||||||| || ||||||||||| Sbjct: 198856 gtgcagaggcacacggcggcctcaaggtcggcgag 198822 Score = 65.9 bits (33), Expect = 1e-07 Identities = 87/105 (82%) Strand = Plus / Minus Query: 339 cctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgg 398 ||||||||||| |||||||||| | ||||||||||||| |||| | ||||| || || Sbjct: 28908485 cctgatggcggcgcagaggcacgccgcggcgtcgaggttcacgaggctccccagcagcgg 28908426 Query: 399 gcagcactgctcgttggccggcacgccaatcttaagcttcagcag 443 ||||||||||| | | ||||||||| ||||| ||||||||||| Sbjct: 28908425 gcagcactgctggctcgccggcacgttgatcttcagcttcagcag 28908381 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Plus Query: 348 ggtgcagaggcacacggcggcgtcgaggtcggcgag 383 |||||||||||| ||| |||||||||||||| |||| Sbjct: 33204579 ggtgcagaggcagacgacggcgtcgaggtcgacgag 33204614
>gb|AF485811.1| Oryza sativa BAC OSJNa0049F05, complete sequence Length = 162241 Score = 184 bits (93), Expect = 2e-43 Identities = 186/217 (85%) Strand = Plus / Plus Query: 245 ggcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcga 304 |||||||||||| || |||||| ||||| ||| | |||||| ||||| | ||| |||| Sbjct: 75419 ggcaggtgaagtcggaggggcaggtcttgtggcagtagttgagaaggagagagagatcga 75478 Query: 305 tggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacgg 364 ||||| ||||| ||||||||||||||||||||| ||||||||||||||||||| |||| Sbjct: 75479 cggggatgttgagattgatgccgaggatgttggccttgatggcggtgcagaggcagacgg 75538 Query: 365 cggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgctcgttggccggcacgc 424 |||||||||||||| |||| || ||||| | ||||||||||||||| | ||||||||| Sbjct: 75539 cggcgtcgaggtcgacgaggccacccagcaacgggcagcactgctcgctctccggcacgc 75598 Query: 425 caatcttaagcttcagcaggttcagcacgttgccgca 461 | ||||| |||||||||||||| ||||||||| |||| Sbjct: 75599 cgatcttcagcttcagcaggttgagcacgttggcgca 75635 Score = 167 bits (84), Expect = 4e-38 Identities = 156/180 (86%) Strand = Plus / Plus Query: 282 gttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggccct 341 |||||| |||||| |||||||| |||||| |||| ||||||||||||| ||||||| | Sbjct: 72752 gttgaggaggaggacgaggtcgacggggacgttgatgttgatgccgaggacgttggcctt 72811 Query: 342 gatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggca 401 |||||||||||||||||| |||||||||||||||||| ||||||| ||||| || ||||| Sbjct: 72812 gatggcggtgcagaggcagacggcggcgtcgaggtcgacgagcccccccagcagcgggca 72871 Query: 402 gcactgctcgttggccggcacgccaatcttaagcttcagcaggttcagcacgttgccgca 461 ||||| |||| | |||||||| || | ||| ||||| |||||||| ||||||||| |||| Sbjct: 72872 gcactcctcgctcgccggcacccccaccttgagcttgagcaggttgagcacgttggcgca 72931 Score = 101 bits (51), Expect = 2e-18 Identities = 84/95 (88%) Strand = Plus / Plus Query: 289 aggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggccctgatggcg 348 |||||| |||||| |||||||| ||||| |||||||| ||||||||||| | || |||| Sbjct: 63740 aggaggctgaggttgatggggaggttgaggttgatgccaaggatgttggcgcggagggcg 63799 Query: 349 gtgcagaggcacacggcggcgtcgaggtcggcgag 383 |||||||||||||||||||| || ||||||||||| Sbjct: 63800 gtgcagaggcacacggcggcctcaaggtcggcgag 63834
>dbj|AK103618.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033133L09, full insert sequence Length = 780 Score = 184 bits (93), Expect = 2e-43 Identities = 186/217 (85%) Strand = Plus / Minus Query: 245 ggcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcga 304 |||||||||||| || |||||| ||||| ||| | |||||| ||||| | ||| |||| Sbjct: 550 ggcaggtgaagtcggaggggcaggtcttgtggcagtagttgagaaggagagagagatcga 491 Query: 305 tggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacgg 364 ||||| ||||| ||||||||||||||||||||| ||||||||||||||||||| |||| Sbjct: 490 cggggatgttgagattgatgccgaggatgttggccttgatggcggtgcagaggcagacgg 431 Query: 365 cggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgctcgttggccggcacgc 424 |||||||||||||| |||| || ||||| | ||||||||||||||| | ||||||||| Sbjct: 430 cggcgtcgaggtcgacgaggccacccagcaacgggcagcactgctcgctctccggcacgc 371 Query: 425 caatcttaagcttcagcaggttcagcacgttgccgca 461 | ||||| |||||||||||||| ||||||||| |||| Sbjct: 370 cgatcttcagcttcagcaggttgagcacgttggcgca 334
>dbj|AK062654.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-105-E10, full insert sequence Length = 736 Score = 167 bits (84), Expect = 4e-38 Identities = 156/180 (86%) Strand = Plus / Minus Query: 282 gttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggccct 341 |||||| |||||| |||||||| |||||| |||| ||||||||||||| ||||||| | Sbjct: 474 gttgaggaggaggacgaggtcgacggggacgttgatgttgatgccgaggacgttggcctt 415 Query: 342 gatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggca 401 |||||||||||||||||| |||||||||||||||||| ||||||| ||||| || ||||| Sbjct: 414 gatggcggtgcagaggcagacggcggcgtcgaggtcgacgagcccccccagcagcgggca 355 Query: 402 gcactgctcgttggccggcacgccaatcttaagcttcagcaggttcagcacgttgccgca 461 ||||| |||| | |||||||| || | ||| ||||| |||||||| ||||||||| |||| Sbjct: 354 gcactcctcgctcgccggcacccccaccttgagcttgagcaggttgagcacgttggcgca 295
>gb|AY108363.1| Zea mays PCO069442 mRNA sequence Length = 837 Score = 135 bits (68), Expect = 1e-28 Identities = 131/152 (86%) Strand = Plus / Minus Query: 261 ggggcacttcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagctt 320 |||||| ||||||||||| | |||||| | |||| ||||||||||||||| || || || Sbjct: 448 ggggcagttcttgccgcagttgttgaggatgaggctgaggtcgatggggaggttaaggtt 389 Query: 321 gatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 380 ||||||||||||||||||| ||| ||||||||||||||| |||||||| || |||||| | Sbjct: 388 gatgccgaggatgttggccttgacggcggtgcagaggcagacggcggcctccaggtcgac 329 Query: 381 gagcccgcccaggagtgggcagcactgctcgt 412 ||||||| |||| || | ||||||| |||||| Sbjct: 328 gagcccgtccagcagcgagcagcacggctcgt 297
>ref|NM_197681.1| Oryza sativa (japonica cultivar-group) putative lipid transfer protein (OSJNBa0015J15.6), mRNA Length = 399 Score = 125 bits (63), Expect = 1e-25 Identities = 102/115 (88%) Strand = Plus / Minus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| | |||||| | |||| ||||||||||||||| |||||||||||||| | Sbjct: 367 tcttgccgcagttgttgaggatgaggctgaggtcgatggggaggttgagcttgatgccca 308 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383 | | ||||||| ||||||||||||||||||| |||||||||||||||||| |||| Sbjct: 307 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 253
>gb|AC026758.8| Oryza sativa chromosome 10 BAC OSJNBa0015J15 genomic sequence, complete sequence Length = 144798 Score = 125 bits (63), Expect = 1e-25 Identities = 102/115 (88%) Strand = Plus / Minus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| | |||||| | |||| ||||||||||||||| |||||||||||||| | Sbjct: 27538 tcttgccgcagttgttgaggatgaggctgaggtcgatggggaggttgagcttgatgccca 27479 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383 | | ||||||| ||||||||||||||||||| |||||||||||||||||| |||| Sbjct: 27478 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 27424 Score = 117 bits (59), Expect = 3e-23 Identities = 101/115 (87%) Strand = Plus / Minus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| | |||||| | |||| ||||||||||||||| ||||| |||| ||||| Sbjct: 34252 tcttgccgcagttgttgaggatgaggctgaggtcgatggggatgttgaggttgaggccga 34193 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383 | | ||||||| ||||||||||||||||||| |||||||||||||||||| |||| Sbjct: 34192 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 34138 Score = 115 bits (58), Expect = 1e-22 Identities = 121/142 (85%) Strand = Plus / Minus Query: 246 gcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcgat 305 ||||||||||| || |||||| |||||||||||| |||||| | |||| | || |||| Sbjct: 50006 gcaggtgaagtcggaggggcagatcttgccgcacttgttgaggatgaggcttagatcgac 49947 Query: 306 ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 365 || || ||||| || |||||||| | ||||||| ||| ||||||||||||||| ||||| Sbjct: 49946 ggcgaggttgagtttcatgccgagcacgttggccttgacggcggtgcagaggcagacggc 49887 Query: 366 ggcgtcgaggtcggcgagcccg 387 |||||||||||||||||||||| Sbjct: 49886 ggcgtcgaggtcggcgagcccg 49865 Score = 109 bits (55), Expect = 8e-21 Identities = 100/115 (86%) Strand = Plus / Minus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| | |||||| | |||| ||||||||| ||||| | |||||||||||||| Sbjct: 30806 tcttgccgcagttgttgaggatgaggctgaggtcgacggggaggtcgagcttgatgccga 30747 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383 | | ||||||| ||| ||||||||||||||| |||||||||||||||||| |||| Sbjct: 30746 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcgacgag 30692 Score = 101 bits (51), Expect = 2e-18 Identities = 132/159 (83%) Strand = Plus / Minus Query: 246 gcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcgat 305 ||||||||||| || |||||| |||||||||||| |||||| | ||| |||| |||| Sbjct: 66530 gcaggtgaagtcggaggggcaggtcttgccgcacttgttgaggatgagcttgagctcgac 66471 Query: 306 ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 365 |||||| ||||| |||| |||||| | ||||||| | | ||||||||||||||| ||||| Sbjct: 66470 ggggacgttgaggttgacgccgagcacgttggccttcacggcggtgcagaggcagacggc 66411 Query: 366 ggcgtcgaggtcggcgagcccgcccaggagtgggcagca 404 ||||||| ||||||||| ||| | || || |||||||| Sbjct: 66410 ggcgtcggcgtcggcgaggccggcgagcagcgggcagca 66372 Score = 91.7 bits (46), Expect = 2e-15 Identities = 97/114 (85%) Strand = Plus / Minus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||| ||||| |||||| | |||| | || |||| ||||| ||| || |||||||| | Sbjct: 54098 tcttgctgcacttgttgaggatgaggctcagatcgacggggagattcaggttgatgccca 54039 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382 | | ||||||| ||| ||||||||||||||| |||||||||||||||||||||| Sbjct: 54038 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 53985 Score = 81.8 bits (41), Expect = 2e-12 Identities = 97/115 (84%), Gaps = 3/115 (2%) Strand = Plus / Minus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatg---c 325 |||||||||| | |||||| | |||| |||| |||| ||||| ||||| |||||| | Sbjct: 62140 tcttgccgcagttgttgaggatgaggctgagatcgacggggatgttgaggttgatgatcc 62081 Query: 326 cgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 380 | || | ||||||| ||||||||||||||||||| |||||||||||||||||||| Sbjct: 62080 caagaacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcggc 62026 Score = 77.8 bits (39), Expect = 3e-11 Identities = 90/107 (84%) Strand = Plus / Minus Query: 276 gcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggatgtt 335 ||||| |||||| | |||| | || |||| ||||| ||||| |||||||| || | || Sbjct: 57384 gcacttgttgaggatgaggctcagatcgacggggaggttgaggttgatgcccagcacatt 57325 Query: 336 ggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382 |||| ||| ||||||||||||||| |||||||||||||||||||||| Sbjct: 57324 ggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 57278 Score = 61.9 bits (31), Expect = 2e-06 Identities = 55/63 (87%) Strand = Plus / Minus Query: 349 gtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgc 408 ||||||||||||||||||||||| | ||||||||| ||| | ||||| |||||||||| Sbjct: 69079 gtgcagaggcacacggcggcgtccacgtcggcgaggccggcgaggagcccgcagcactgc 69020 Query: 409 tcg 411 ||| Sbjct: 69019 tcg 69017
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 125 bits (63), Expect = 1e-25 Identities = 102/115 (88%) Strand = Plus / Plus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| | |||||| | |||| ||||||||||||||| |||||||||||||| | Sbjct: 21178168 tcttgccgcagttgttgaggatgaggctgaggtcgatggggaggttgagcttgatgccca 21178227 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383 | | ||||||| ||||||||||||||||||| |||||||||||||||||| |||| Sbjct: 21178228 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 21178282 Score = 117 bits (59), Expect = 3e-23 Identities = 101/115 (87%) Strand = Plus / Plus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| | |||||| | |||| ||||||||||||||| ||||| |||| ||||| Sbjct: 21171454 tcttgccgcagttgttgaggatgaggctgaggtcgatggggatgttgaggttgaggccga 21171513 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383 | | ||||||| ||||||||||||||||||| |||||||||||||||||| |||| Sbjct: 21171514 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 21171568 Score = 115 bits (58), Expect = 1e-22 Identities = 121/142 (85%) Strand = Plus / Plus Query: 246 gcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcgat 305 ||||||||||| || |||||| |||||||||||| |||||| | |||| | || |||| Sbjct: 21155700 gcaggtgaagtcggaggggcagatcttgccgcacttgttgaggatgaggcttagatcgac 21155759 Query: 306 ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 365 || || ||||| || |||||||| | ||||||| ||| ||||||||||||||| ||||| Sbjct: 21155760 ggcgaggttgagtttcatgccgagcacgttggccttgacggcggtgcagaggcagacggc 21155819 Query: 366 ggcgtcgaggtcggcgagcccg 387 |||||||||||||||||||||| Sbjct: 21155820 ggcgtcgaggtcggcgagcccg 21155841 Score = 109 bits (55), Expect = 8e-21 Identities = 100/115 (86%) Strand = Plus / Plus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| | |||||| | |||| ||||||||| ||||| | |||||||||||||| Sbjct: 21174900 tcttgccgcagttgttgaggatgaggctgaggtcgacggggaggtcgagcttgatgccga 21174959 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383 | | ||||||| ||| ||||||||||||||| |||||||||||||||||| |||| Sbjct: 21174960 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcgacgag 21175014 Score = 101 bits (51), Expect = 2e-18 Identities = 132/159 (83%) Strand = Plus / Plus Query: 246 gcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcgat 305 ||||||||||| || |||||| |||||||||||| |||||| | ||| |||| |||| Sbjct: 21139176 gcaggtgaagtcggaggggcaggtcttgccgcacttgttgaggatgagcttgagctcgac 21139235 Query: 306 ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 365 |||||| ||||| |||| |||||| | ||||||| | | ||||||||||||||| ||||| Sbjct: 21139236 ggggacgttgaggttgacgccgagcacgttggccttcacggcggtgcagaggcagacggc 21139295 Query: 366 ggcgtcgaggtcggcgagcccgcccaggagtgggcagca 404 ||||||| ||||||||| ||| | || || |||||||| Sbjct: 21139296 ggcgtcggcgtcggcgaggccggcgagcagcgggcagca 21139334 Score = 91.7 bits (46), Expect = 2e-15 Identities = 97/114 (85%) Strand = Plus / Plus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||| ||||| |||||| | |||| | || |||| ||||| ||| || |||||||| | Sbjct: 21151608 tcttgctgcacttgttgaggatgaggctcagatcgacggggagattcaggttgatgccca 21151667 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382 | | ||||||| ||| ||||||||||||||| |||||||||||||||||||||| Sbjct: 21151668 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 21151721 Score = 81.8 bits (41), Expect = 2e-12 Identities = 97/115 (84%), Gaps = 3/115 (2%) Strand = Plus / Plus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatg---c 325 |||||||||| | |||||| | |||| |||| |||| ||||| ||||| |||||| | Sbjct: 21143566 tcttgccgcagttgttgaggatgaggctgagatcgacggggatgttgaggttgatgatcc 21143625 Query: 326 cgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 380 | || | ||||||| ||||||||||||||||||| |||||||||||||||||||| Sbjct: 21143626 caagaacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcggc 21143680 Score = 77.8 bits (39), Expect = 3e-11 Identities = 90/107 (84%) Strand = Plus / Plus Query: 276 gcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggatgtt 335 ||||| |||||| | |||| | || |||| ||||| ||||| |||||||| || | || Sbjct: 21148322 gcacttgttgaggatgaggctcagatcgacggggaggttgaggttgatgcccagcacatt 21148381 Query: 336 ggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382 |||| ||| ||||||||||||||| |||||||||||||||||||||| Sbjct: 21148382 ggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 21148428 Score = 69.9 bits (35), Expect = 7e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 346 gcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggcagca 404 |||||||||||||| |||||||||||||||||||||| ||| |||| || |||||||| Sbjct: 10072332 gcggtgcagaggcagacggcggcgtcgaggtcggcgataccggccagcagcgggcagca 10072390 Score = 61.9 bits (31), Expect = 2e-06 Identities = 55/63 (87%) Strand = Plus / Plus Query: 349 gtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgc 408 ||||||||||||||||||||||| | ||||||||| ||| | ||||| |||||||||| Sbjct: 21136627 gtgcagaggcacacggcggcgtccacgtcggcgaggccggcgaggagcccgcagcactgc 21136686 Query: 409 tcg 411 ||| Sbjct: 21136687 tcg 21136689 Score = 50.1 bits (25), Expect = 0.006 Identities = 52/61 (85%) Strand = Plus / Plus Query: 322 atgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcg 381 ||||| |||| ||||||| | | ||| ||||||||||| |||||||| ||||| |||||| Sbjct: 10051276 atgccaaggacgttggccttcacggcagtgcagaggcagacggcggcatcgagatcggcg 10051335 Query: 382 a 382 | Sbjct: 10051336 a 10051336 Score = 44.1 bits (22), Expect = 0.40 Identities = 34/38 (89%) Strand = Plus / Plus Query: 345 ggcggtgcagaggcacacggcggcgtcgaggtcggcga 382 ||||||||||||||| ||||| ||||||| ||||||| Sbjct: 10063375 ggcggtgcagaggcagacggcagcgtcgatatcggcga 10063412 Score = 44.1 bits (22), Expect = 0.40 Identities = 31/34 (91%) Strand = Plus / Plus Query: 349 gtgcagaggcacacggcggcgtcgaggtcggcga 382 ||||||||||| ||||| |||||||| ||||||| Sbjct: 10048162 gtgcagaggcagacggcagcgtcgagatcggcga 10048195
>dbj|AK062381.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-102-B09, full insert sequence Length = 702 Score = 125 bits (63), Expect = 1e-25 Identities = 102/115 (88%) Strand = Plus / Minus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| | |||||| | |||| ||||||||||||||| |||||||||||||| | Sbjct: 436 tcttgccgcagttgttgaggatgaggctgaggtcgatggggaggttgagcttgatgccca 377 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383 | | ||||||| ||||||||||||||||||| |||||||||||||||||| |||| Sbjct: 376 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 322
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 125 bits (63), Expect = 1e-25 Identities = 102/115 (88%) Strand = Plus / Plus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| | |||||| | |||| ||||||||||||||| |||||||||||||| | Sbjct: 21189432 tcttgccgcagttgttgaggatgaggctgaggtcgatggggaggttgagcttgatgccca 21189491 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383 | | ||||||| ||||||||||||||||||| |||||||||||||||||| |||| Sbjct: 21189492 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 21189546 Score = 117 bits (59), Expect = 3e-23 Identities = 101/115 (87%) Strand = Plus / Plus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| | |||||| | |||| ||||||||||||||| ||||| |||| ||||| Sbjct: 21182718 tcttgccgcagttgttgaggatgaggctgaggtcgatggggatgttgaggttgaggccga 21182777 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383 | | ||||||| ||||||||||||||||||| |||||||||||||||||| |||| Sbjct: 21182778 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 21182832 Score = 115 bits (58), Expect = 1e-22 Identities = 121/142 (85%) Strand = Plus / Plus Query: 246 gcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcgat 305 ||||||||||| || |||||| |||||||||||| |||||| | |||| | || |||| Sbjct: 21166964 gcaggtgaagtcggaggggcagatcttgccgcacttgttgaggatgaggcttagatcgac 21167023 Query: 306 ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 365 || || ||||| || |||||||| | ||||||| ||| ||||||||||||||| ||||| Sbjct: 21167024 ggcgaggttgagtttcatgccgagcacgttggccttgacggcggtgcagaggcagacggc 21167083 Query: 366 ggcgtcgaggtcggcgagcccg 387 |||||||||||||||||||||| Sbjct: 21167084 ggcgtcgaggtcggcgagcccg 21167105 Score = 109 bits (55), Expect = 8e-21 Identities = 100/115 (86%) Strand = Plus / Plus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| | |||||| | |||| ||||||||| ||||| | |||||||||||||| Sbjct: 21186164 tcttgccgcagttgttgaggatgaggctgaggtcgacggggaggtcgagcttgatgccga 21186223 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383 | | ||||||| ||| ||||||||||||||| |||||||||||||||||| |||| Sbjct: 21186224 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcgacgag 21186278 Score = 101 bits (51), Expect = 2e-18 Identities = 132/159 (83%) Strand = Plus / Plus Query: 246 gcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcgat 305 ||||||||||| || |||||| |||||||||||| |||||| | ||| |||| |||| Sbjct: 21150440 gcaggtgaagtcggaggggcaggtcttgccgcacttgttgaggatgagcttgagctcgac 21150499 Query: 306 ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 365 |||||| ||||| |||| |||||| | ||||||| | | ||||||||||||||| ||||| Sbjct: 21150500 ggggacgttgaggttgacgccgagcacgttggccttcacggcggtgcagaggcagacggc 21150559 Query: 366 ggcgtcgaggtcggcgagcccgcccaggagtgggcagca 404 ||||||| ||||||||| ||| | || || |||||||| Sbjct: 21150560 ggcgtcggcgtcggcgaggccggcgagcagcgggcagca 21150598 Score = 91.7 bits (46), Expect = 2e-15 Identities = 97/114 (85%) Strand = Plus / Plus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||| ||||| |||||| | |||| | || |||| ||||| ||| || |||||||| | Sbjct: 21162872 tcttgctgcacttgttgaggatgaggctcagatcgacggggagattcaggttgatgccca 21162931 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382 | | ||||||| ||| ||||||||||||||| |||||||||||||||||||||| Sbjct: 21162932 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 21162985 Score = 81.8 bits (41), Expect = 2e-12 Identities = 97/115 (84%), Gaps = 3/115 (2%) Strand = Plus / Plus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatg---c 325 |||||||||| | |||||| | |||| |||| |||| ||||| ||||| |||||| | Sbjct: 21154830 tcttgccgcagttgttgaggatgaggctgagatcgacggggatgttgaggttgatgatcc 21154889 Query: 326 cgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 380 | || | ||||||| ||||||||||||||||||| |||||||||||||||||||| Sbjct: 21154890 caagaacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcggc 21154944 Score = 77.8 bits (39), Expect = 3e-11 Identities = 90/107 (84%) Strand = Plus / Plus Query: 276 gcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggatgtt 335 ||||| |||||| | |||| | || |||| ||||| ||||| |||||||| || | || Sbjct: 21159586 gcacttgttgaggatgaggctcagatcgacggggaggttgaggttgatgcccagcacatt 21159645 Query: 336 ggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382 |||| ||| ||||||||||||||| |||||||||||||||||||||| Sbjct: 21159646 ggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 21159692 Score = 69.9 bits (35), Expect = 7e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 346 gcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggcagca 404 |||||||||||||| |||||||||||||||||||||| ||| |||| || |||||||| Sbjct: 10078371 gcggtgcagaggcagacggcggcgtcgaggtcggcgataccggccagcagcgggcagca 10078429 Score = 61.9 bits (31), Expect = 2e-06 Identities = 55/63 (87%) Strand = Plus / Plus Query: 349 gtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgc 408 ||||||||||||||||||||||| | ||||||||| ||| | ||||| |||||||||| Sbjct: 21147891 gtgcagaggcacacggcggcgtccacgtcggcgaggccggcgaggagcccgcagcactgc 21147950 Query: 409 tcg 411 ||| Sbjct: 21147951 tcg 21147953 Score = 50.1 bits (25), Expect = 0.006 Identities = 52/61 (85%) Strand = Plus / Plus Query: 322 atgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcg 381 ||||| |||| ||||||| | | ||| ||||||||||| |||||||| ||||| |||||| Sbjct: 10057315 atgccaaggacgttggccttcacggcagtgcagaggcagacggcggcatcgagatcggcg 10057374 Query: 382 a 382 | Sbjct: 10057375 a 10057375 Score = 44.1 bits (22), Expect = 0.40 Identities = 34/38 (89%) Strand = Plus / Plus Query: 345 ggcggtgcagaggcacacggcggcgtcgaggtcggcga 382 ||||||||||||||| ||||| ||||||| ||||||| Sbjct: 10069414 ggcggtgcagaggcagacggcagcgtcgatatcggcga 10069451 Score = 44.1 bits (22), Expect = 0.40 Identities = 31/34 (91%) Strand = Plus / Plus Query: 349 gtgcagaggcacacggcggcgtcgaggtcggcga 382 ||||||||||| ||||| |||||||| ||||||| Sbjct: 10054201 gtgcagaggcagacggcagcgtcgagatcggcga 10054234
>ref|XM_467170.1| Oryza sativa (japonica cultivar-group), mRNA Length = 833 Score = 123 bits (62), Expect = 5e-25 Identities = 122/142 (85%) Strand = Plus / Minus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| | |||||| | |||| ||||||||||||||| ||||| ||||| |||| Sbjct: 475 tcttgccgcagtagttgaggatgaggctgaggtcgatggggaggttgaggttgattccga 416 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 388 |||||||| |||||||||| |||||||||||||| || || ||||||||| ||||||| Sbjct: 415 ggatgttgcccctgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccct 356 Query: 389 ccaggagtgggcagcactgctc 410 |||| || ||||||||| |||| Sbjct: 355 ccagcagcgggcagcacggctc 334
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 123 bits (62), Expect = 5e-25 Identities = 122/142 (85%) Strand = Plus / Minus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| | |||||| | |||| ||||||||||||||| ||||| ||||| |||| Sbjct: 26823955 tcttgccgcagtagttgaggatgaggctgaggtcgatggggaggttgaggttgattccga 26823896 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 388 |||||||| |||||||||| |||||||||||||| || || ||||||||| ||||||| Sbjct: 26823895 ggatgttgcccctgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccct 26823836 Query: 389 ccaggagtgggcagcactgctc 410 |||| || ||||||||| |||| Sbjct: 26823835 ccagcagcgggcagcacggctc 26823814 Score = 77.8 bits (39), Expect = 3e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 320 tgatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcgg 379 |||||||||| | ||||||| |||||||||||||||| || |||||||| || ||||||| Sbjct: 26833519 tgatgccgagcacgttggccttgatggcggtgcagagacagacggcggcctcaaggtcgg 26833460 Query: 380 cgagcccgcccagga 394 |||| ||||| |||| Sbjct: 26833459 cgaggccgccgagga 26833445
>dbj|AP004037.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1001_D02 Length = 129081 Score = 123 bits (62), Expect = 5e-25 Identities = 122/142 (85%) Strand = Plus / Minus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| | |||||| | |||| ||||||||||||||| ||||| ||||| |||| Sbjct: 2498 tcttgccgcagtagttgaggatgaggctgaggtcgatggggaggttgaggttgattccga 2439 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 388 |||||||| |||||||||| |||||||||||||| || || ||||||||| ||||||| Sbjct: 2438 ggatgttgcccctgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccct 2379 Query: 389 ccaggagtgggcagcactgctc 410 |||| || ||||||||| |||| Sbjct: 2378 ccagcagcgggcagcacggctc 2357 Score = 77.8 bits (39), Expect = 3e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 320 tgatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcgg 379 |||||||||| | ||||||| |||||||||||||||| || |||||||| || ||||||| Sbjct: 12062 tgatgccgagcacgttggccttgatggcggtgcagagacagacggcggcctcaaggtcgg 12003 Query: 380 cgagcccgcccagga 394 |||| ||||| |||| Sbjct: 12002 cgaggccgccgagga 11988
>dbj|AP004883.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0516F12 Length = 146364 Score = 123 bits (62), Expect = 5e-25 Identities = 122/142 (85%) Strand = Plus / Minus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| | |||||| | |||| ||||||||||||||| ||||| ||||| |||| Sbjct: 90008 tcttgccgcagtagttgaggatgaggctgaggtcgatggggaggttgaggttgattccga 89949 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 388 |||||||| |||||||||| |||||||||||||| || || ||||||||| ||||||| Sbjct: 89948 ggatgttgcccctgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccct 89889 Query: 389 ccaggagtgggcagcactgctc 410 |||| || ||||||||| |||| Sbjct: 89888 ccagcagcgggcagcacggctc 89867 Score = 77.8 bits (39), Expect = 3e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 320 tgatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcgg 379 |||||||||| | ||||||| |||||||||||||||| || |||||||| || ||||||| Sbjct: 99572 tgatgccgagcacgttggccttgatggcggtgcagagacagacggcggcctcaaggtcgg 99513 Query: 380 cgagcccgcccagga 394 |||| ||||| |||| Sbjct: 99512 cgaggccgccgagga 99498
>dbj|AK109149.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-155-F07, full insert sequence Length = 833 Score = 123 bits (62), Expect = 5e-25 Identities = 122/142 (85%) Strand = Plus / Minus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| | |||||| | |||| ||||||||||||||| ||||| ||||| |||| Sbjct: 475 tcttgccgcagtagttgaggatgaggctgaggtcgatggggaggttgaggttgattccga 416 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 388 |||||||| |||||||||| |||||||||||||| || || ||||||||| ||||||| Sbjct: 415 ggatgttgcccctgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccct 356 Query: 389 ccaggagtgggcagcactgctc 410 |||| || ||||||||| |||| Sbjct: 355 ccagcagcgggcagcacggctc 334
>gb|L27208.1|RICRCC3 Oryza sativa root-specific RCc3 mRNA, complete cds Length = 715 Score = 123 bits (62), Expect = 5e-25 Identities = 122/142 (85%) Strand = Plus / Minus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| | |||||| | |||| ||||||||||||||| ||||| ||||| |||| Sbjct: 400 tcttgccgcagtagttgaggatgaggctgaggtcgatggggaggttgaggttgattccga 341 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 388 |||||||| |||||||||| |||||||||||||| || || ||||||||| ||||||| Sbjct: 340 ggatgttgcccctgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccct 281 Query: 389 ccaggagtgggcagcactgctc 410 |||| || ||||||||| |||| Sbjct: 280 ccagcagcgggcagcacggctc 259
>ref|NM_197679.1| Oryza sativa (japonica cultivar-group) putative lipid transfer protein (OSJNBa0015J15.8), mRNA Length = 402 Score = 117 bits (59), Expect = 3e-23 Identities = 101/115 (87%) Strand = Plus / Minus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| | |||||| | |||| ||||||||||||||| ||||| |||| ||||| Sbjct: 373 tcttgccgcagttgttgaggatgaggctgaggtcgatggggatgttgaggttgaggccga 314 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383 | | ||||||| ||||||||||||||||||| |||||||||||||||||| |||| Sbjct: 313 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 259
>dbj|AK062911.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-108-G07, full insert sequence Length = 757 Score = 117 bits (59), Expect = 3e-23 Identities = 101/115 (87%) Strand = Plus / Minus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| | |||||| | |||| ||||||||||||||| ||||| |||| ||||| Sbjct: 460 tcttgccgcagttgttgaggatgaggctgaggtcgatggggatgttgaggttgaggccga 401 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383 | | ||||||| ||||||||||||||||||| |||||||||||||||||| |||| Sbjct: 400 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 346
>ref|NM_197676.1| Oryza sativa (japonica cultivar-group) putative lipid transfer protein (OSJNBa0015J15.11), mRNA Length = 411 Score = 115 bits (58), Expect = 1e-22 Identities = 121/142 (85%) Strand = Plus / Minus Query: 246 gcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcgat 305 ||||||||||| || |||||| |||||||||||| |||||| | |||| | || |||| Sbjct: 408 gcaggtgaagtcggaggggcagatcttgccgcacttgttgaggatgaggcttagatcgac 349 Query: 306 ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 365 || || ||||| || |||||||| | ||||||| ||| ||||||||||||||| ||||| Sbjct: 348 ggcgaggttgagtttcatgccgagcacgttggccttgacggcggtgcagaggcagacggc 289 Query: 366 ggcgtcgaggtcggcgagcccg 387 |||||||||||||||||||||| Sbjct: 288 ggcgtcgaggtcggcgagcccg 267
>gb|AY108411.1| Zea mays PCO134698 mRNA sequence Length = 667 Score = 113 bits (57), Expect = 5e-22 Identities = 117/137 (85%) Strand = Plus / Minus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| | |||||| || |||||||| | || |||||| | ||| |||||||||| Sbjct: 483 tcttgccgcagtagttgaggagcagggtgagcttgacggggacgtcgaggttgatgccga 424 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 388 | | ||||||| ||| |||||||||||||| |||||||| || ||||||||||||||| Sbjct: 423 gcacgttggccttgagcgcggtgcagaggcagacggcggcctctaggtcggcgagcccgt 364 Query: 389 ccaggagtgggcagcac 405 |||| |||||||||||| Sbjct: 363 ccagcagtgggcagcac 347
>ref|NM_197680.1| Oryza sativa (japonica cultivar-group) putative lipid transfer protein (OSJNBa0015J15.7), mRNA Length = 375 Score = 109 bits (55), Expect = 8e-21 Identities = 100/115 (86%) Strand = Plus / Minus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| | |||||| | |||| ||||||||| ||||| | |||||||||||||| Sbjct: 343 tcttgccgcagttgttgaggatgaggctgaggtcgacggggaggtcgagcttgatgccga 284 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383 | | ||||||| ||| ||||||||||||||| |||||||||||||||||| |||| Sbjct: 283 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcgacgag 229
>dbj|AK063090.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-111-A12, full insert sequence Length = 627 Score = 109 bits (55), Expect = 8e-21 Identities = 100/115 (86%) Strand = Plus / Minus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| | |||||| | |||| ||||||||| ||||| | |||||||||||||| Sbjct: 428 tcttgccgcagttgttgaggatgaggctgaggtcgacggggaggtcgagcttgatgccga 369 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383 | | ||||||| ||| ||||||||||||||| |||||||||||||||||| |||| Sbjct: 368 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcgacgag 314
>ref|XM_473448.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 393 Score = 105 bits (53), Expect = 1e-19 Identities = 119/141 (84%) Strand = Plus / Minus Query: 270 cttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgag 329 ||||||||| | |||||| | |||| ||||||||| ||||| ||||| ||||||||||| Sbjct: 366 cttgccgcagtagttgaggatgaggctgaggtcgacggggaggttgaggttgatgccgag 307 Query: 330 gatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcc 389 ||||||| | |||||||| ||||||||||| || || || ||||||||| ||||||| | Sbjct: 306 gatgttgcctctgatggccgtgcagaggcataccgccgcctcgaggtcgacgagcccctc 247 Query: 390 caggagtgggcagcactgctc 410 ||| || ||||||||| |||| Sbjct: 246 cagcagcgggcagcacggctc 226
>gb|AY466109.1| Oryza sativa (japonica cultivar-group) lipid transfer protein-like protein (LTP2) mRNA, complete cds Length = 758 Score = 105 bits (53), Expect = 1e-19 Identities = 119/141 (84%) Strand = Plus / Minus Query: 270 cttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgag 329 ||||||||| | |||||| | |||| ||||||||| ||||| ||||| ||||||||||| Sbjct: 441 cttgccgcagtagttgaggatgaggctgaggtcgacggggaggttgaggttgatgccgag 382 Query: 330 gatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcc 389 ||||||| | |||||||| ||||||||||| || || || ||||||||| ||||||| | Sbjct: 381 gatgttgcctctgatggccgtgcagaggcataccgccgcctcgaggtcgacgagcccctc 322 Query: 390 caggagtgggcagcactgctc 410 ||| || ||||||||| |||| Sbjct: 321 cagcagcgggcagcacggctc 301
>emb|AL606633.3|OSJN00060 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0010H02, complete sequence Length = 173522 Score = 105 bits (53), Expect = 1e-19 Identities = 119/141 (84%) Strand = Plus / Minus Query: 270 cttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgag 329 ||||||||| | |||||| | |||| ||||||||| ||||| ||||| ||||||||||| Sbjct: 144413 cttgccgcagtagttgaggatgaggctgaggtcgacggggaggttgaggttgatgccgag 144354 Query: 330 gatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcc 389 ||||||| | |||||||| ||||||||||| || || || ||||||||| ||||||| | Sbjct: 144353 gatgttgcctctgatggccgtgcagaggcataccgccgcctcgaggtcgacgagcccctc 144294 Query: 390 caggagtgggcagcactgctc 410 ||| || ||||||||| |||| Sbjct: 144293 cagcagcgggcagcacggctc 144273 Score = 97.6 bits (49), Expect = 3e-17 Identities = 118/141 (83%) Strand = Plus / Minus Query: 270 cttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgag 329 ||||||||| | |||||| | |||| ||||||||| ||||| || || ||||||||||| Sbjct: 147613 cttgccgcagtagttgaggatgaggctgaggtcgacggggaggttaaggttgatgccgag 147554 Query: 330 gatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcc 389 |||||| || ||||||| |||||||||||||| || || ||||||||| ||||||| | Sbjct: 147553 aatgttgcccttgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccctc 147494 Query: 390 caggagtgggcagcactgctc 410 ||| || ||||||||| |||| Sbjct: 147493 cagcagcgggcagcacggctc 147473 Score = 73.8 bits (37), Expect = 4e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 324 gccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383 |||||| | ||||||| ||||||| ||||||||||| |||||||| |||||||||||||| Sbjct: 157691 gccgagcacgttggccttgatggccgtgcagaggcagacggcggcctcgaggtcggcgag 157632 Query: 384 cccgc 388 |||| Sbjct: 157631 gccgc 157627
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 105 bits (53), Expect = 1e-19 Identities = 119/141 (84%) Strand = Plus / Minus Query: 270 cttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgag 329 ||||||||| | |||||| | |||| ||||||||| ||||| ||||| ||||||||||| Sbjct: 27713787 cttgccgcagtagttgaggatgaggctgaggtcgacggggaggttgaggttgatgccgag 27713728 Query: 330 gatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcc 389 ||||||| | |||||||| ||||||||||| || || || ||||||||| ||||||| | Sbjct: 27713727 gatgttgcctctgatggccgtgcagaggcataccgccgcctcgaggtcgacgagcccctc 27713668 Query: 390 caggagtgggcagcactgctc 410 ||| || ||||||||| |||| Sbjct: 27713667 cagcagcgggcagcacggctc 27713647 Score = 97.6 bits (49), Expect = 3e-17 Identities = 118/141 (83%) Strand = Plus / Minus Query: 270 cttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgag 329 ||||||||| | |||||| | |||| ||||||||| ||||| || || ||||||||||| Sbjct: 27716987 cttgccgcagtagttgaggatgaggctgaggtcgacggggaggttaaggttgatgccgag 27716928 Query: 330 gatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcc 389 |||||| || ||||||| |||||||||||||| || || ||||||||| ||||||| | Sbjct: 27716927 aatgttgcccttgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccctc 27716868 Query: 390 caggagtgggcagcactgctc 410 ||| || ||||||||| |||| Sbjct: 27716867 cagcagcgggcagcacggctc 27716847 Score = 73.8 bits (37), Expect = 4e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 324 gccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383 |||||| | ||||||| ||||||| ||||||||||| |||||||| |||||||||||||| Sbjct: 27727065 gccgagcacgttggccttgatggccgtgcagaggcagacggcggcctcgaggtcggcgag 27727006 Query: 384 cccgc 388 |||| Sbjct: 27727005 gccgc 27727001 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 334 ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382 |||||| ||||||||||||||||||| | ||||||||||||||||||| Sbjct: 31096018 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 31095970 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 334 ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382 |||||| ||||||||||||||||||| | ||||||||||||||||||| Sbjct: 31085599 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 31085551 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Plus Query: 334 ttggccctgatggcggtgcagaggcacacggcggcg 369 |||||| ||||||||||||||||||| |||||||| Sbjct: 32827227 ttggccttgatggcggtgcagaggcaggcggcggcg 32827262
>ref|NM_197671.1| Oryza sativa (japonica cultivar-group) putative lipid transfer protein (OSJNBa0015J15.16), mRNA Length = 441 Score = 101 bits (51), Expect = 2e-18 Identities = 132/159 (83%) Strand = Plus / Minus Query: 246 gcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcgat 305 ||||||||||| || |||||| |||||||||||| |||||| | ||| |||| |||| Sbjct: 438 gcaggtgaagtcggaggggcaggtcttgccgcacttgttgaggatgagcttgagctcgac 379 Query: 306 ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 365 |||||| ||||| |||| |||||| | ||||||| | | ||||||||||||||| ||||| Sbjct: 378 ggggacgttgaggttgacgccgagcacgttggccttcacggcggtgcagaggcagacggc 319 Query: 366 ggcgtcgaggtcggcgagcccgcccaggagtgggcagca 404 ||||||| ||||||||| ||| | || || |||||||| Sbjct: 318 ggcgtcggcgtcggcgaggccggcgagcagcgggcagca 280
>gb|L27210.1|RICRCG2 Oryza sativa root-specific protein (RCg2) gene, complete cds Length = 2252 Score = 101 bits (51), Expect = 2e-18 Identities = 132/159 (83%) Strand = Plus / Minus Query: 246 gcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcgat 305 ||||||||||| || |||||| |||||||||||| |||||| | ||| |||| |||| Sbjct: 2094 gcaggtgaagtcggaggggcaggtcttgccgcacttgttgaggatgagcttgagctcgac 2035 Query: 306 ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 365 |||||| ||||| |||| |||||| | ||||||| | | ||||||||||||||| ||||| Sbjct: 2034 ggggacgttgaggttgacgccgagcacgttggccttcacggcggtgcagaggcagacggc 1975 Query: 366 ggcgtcgaggtcggcgagcccgcccaggagtgggcagca 404 ||||||| ||||||||| ||| | || || |||||||| Sbjct: 1974 ggcgtcggcgtcggcgaggccggcgagcagcgggcagca 1936
>gb|L27209.1|RICRCC2 Oryza sativa root-specific RCc2 mRNA, complete cds Length = 654 Score = 101 bits (51), Expect = 2e-18 Identities = 132/159 (83%) Strand = Plus / Minus Query: 246 gcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcgat 305 ||||||||||| || |||||| |||||||||||| |||||| | ||| |||| |||| Sbjct: 482 gcaggtgaagtcggaggggcaggtcttgccgcacttgttgaggatgagcttgagctcgac 423 Query: 306 ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 365 |||||| ||||| |||| |||||| | ||||||| | | ||||||||||||||| ||||| Sbjct: 422 ggggacgttgaggttgacgccgagcacgttggccttcacggcggtgcagaggcagacggc 363 Query: 366 ggcgtcgaggtcggcgagcccgcccaggagtgggcagca 404 ||||||| ||||||||| ||| | || || |||||||| Sbjct: 362 ggcgtcggcgtcggcgaggccggcgagcagcgggcagca 324
>ref|XM_473449.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 396 Score = 97.6 bits (49), Expect = 3e-17 Identities = 118/141 (83%) Strand = Plus / Minus Query: 270 cttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgag 329 ||||||||| | |||||| | |||| ||||||||| ||||| || || ||||||||||| Sbjct: 366 cttgccgcagtagttgaggatgaggctgaggtcgacggggaggttaaggttgatgccgag 307 Query: 330 gatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcc 389 |||||| || ||||||| |||||||||||||| || || ||||||||| ||||||| | Sbjct: 306 aatgttgcccttgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccctc 247 Query: 390 caggagtgggcagcactgctc 410 ||| || ||||||||| |||| Sbjct: 246 cagcagcgggcagcacggctc 226
>gb|AY105972.1| Zea mays PCO122221 mRNA sequence Length = 768 Score = 93.7 bits (47), Expect = 5e-16 Identities = 98/115 (85%) Strand = Plus / Minus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||||||| |||||||| | |||| ||||||||| ||| | ||||||||||| |||| Sbjct: 445 tcttgccgcagtggttgaggatgaggctgaggtcgacgggcaggttgagcttgattccga 386 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383 ||| | || |||||||||||||||||||||||||||| ||||||||| |||| Sbjct: 385 ggacctctcccttgatggcggtgcagaggcacacggcggcctcgaggtcgacgag 331
>ref|NM_197675.1| Oryza sativa (japonica cultivar-group) putative lipid transfer protein (OSJNBa0015J15.12), mRNA Length = 396 Score = 91.7 bits (46), Expect = 2e-15 Identities = 97/114 (85%) Strand = Plus / Minus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328 |||||| ||||| |||||| | |||| | || |||| ||||| ||| || |||||||| | Sbjct: 370 tcttgctgcacttgttgaggatgaggctcagatcgacggggagattcaggttgatgccca 311 Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382 | | ||||||| ||| ||||||||||||||| |||||||||||||||||||||| Sbjct: 310 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 257
>ref|NM_197672.1| Oryza sativa (japonica cultivar-group) putative lipid transfer protein (OSJNBa0015J15.15), mRNA Length = 429 Score = 81.8 bits (41), Expect = 2e-12 Identities = 97/115 (84%), Gaps = 3/115 (2%) Strand = Plus / Minus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatg---c 325 |||||||||| | |||||| | |||| |||| |||| ||||| ||||| |||||| | Sbjct: 403 tcttgccgcagttgttgaggatgaggctgagatcgacggggatgttgaggttgatgatcc 344 Query: 326 cgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 380 | || | ||||||| ||||||||||||||||||| |||||||||||||||||||| Sbjct: 343 caagaacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcggc 289
>emb|Z12103.1|ZMDELINM Z.mays mRNA that delineates a novel subset of cortical cells Length = 594 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 321 gatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtc 377 ||||||||||| ||||||| ||||||||||||||||||||| |||||||||||||| Sbjct: 326 gatgccgaggacgttggccttgatggcggtgcagaggcacaatgcggcgtcgaggtc 270
>dbj|AK102086.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033082M21, full insert sequence Length = 769 Score = 81.8 bits (41), Expect = 2e-12 Identities = 97/115 (84%), Gaps = 3/115 (2%) Strand = Plus / Minus Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatg---c 325 |||||||||| | |||||| | |||| |||| |||| ||||| ||||| |||||| | Sbjct: 482 tcttgccgcagttgttgaggatgaggctgagatcgacggggatgttgaggttgatgatcc 423 Query: 326 cgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 380 | || | ||||||| ||||||||||||||||||| |||||||||||||||||||| Sbjct: 422 caagaacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcggc 368
>gb|AY104687.1| Zea mays PCO121733 mRNA sequence Length = 680 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 321 gatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtc 377 ||||||||||| ||||||| ||||||||||||||||||||| |||||||||||||| Sbjct: 388 gatgccgaggacgttggccttgatggcggtgcagaggcacaatgcggcgtcgaggtc 332
>gb|AY105236.1| Zea mays PCO121732 mRNA sequence Length = 763 Score = 81.8 bits (41), Expect = 2e-12 Identities = 86/101 (85%) Strand = Plus / Minus Query: 312 attgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtc 371 |||||| | ||||||||||| ||||||| ||||||||||||||||||||| ||| | || Sbjct: 403 attgaggtggatgccgaggacgttggccttgatggcggtgcagaggcacagtgcgacatc 344 Query: 372 gaggtcggcgagcccgcccaggagtgggcagcactgctcgt 412 |||||| | ||||| |||| ||||||||||| ||||||| Sbjct: 343 gaggtccaccagcccctccagcagtgggcagcattgctcgt 303
>gb|AF001634.1|AF001634 Zea mays physical impedance induced protein (IIG1) mRNA, complete cds Length = 677 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 321 gatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtc 377 ||||||||||| ||||||| ||||||||||||||||||||| |||||||||||||| Sbjct: 401 gatgccgaggacgttggccttgatggcggtgcagaggcacaatgcggcgtcgaggtc 345
>ref|XM_467171.1| Oryza sativa (japonica cultivar-group), mRNA Length = 757 Score = 77.8 bits (39), Expect = 3e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 320 tgatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcgg 379 |||||||||| | ||||||| |||||||||||||||| || |||||||| || ||||||| Sbjct: 390 tgatgccgagcacgttggccttgatggcggtgcagagacagacggcggcctcaaggtcgg 331 Query: 380 cgagcccgcccagga 394 |||| ||||| |||| Sbjct: 330 cgaggccgccgagga 316
>ref|NM_197674.1| Oryza sativa (japonica cultivar-group) putative lipid transfer protein (OSJNBa0015J15.13), mRNA Length = 396 Score = 77.8 bits (39), Expect = 3e-11 Identities = 90/107 (84%) Strand = Plus / Minus Query: 276 gcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggatgtt 335 ||||| |||||| | |||| | || |||| ||||| ||||| |||||||| || | || Sbjct: 363 gcacttgttgaggatgaggctcagatcgacggggaggttgaggttgatgcccagcacatt 304 Query: 336 ggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382 |||| ||| ||||||||||||||| |||||||||||||||||||||| Sbjct: 303 ggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 257
>dbj|AK058218.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-010-F04, full insert sequence Length = 757 Score = 77.8 bits (39), Expect = 3e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 320 tgatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcgg 379 |||||||||| | ||||||| |||||||||||||||| || |||||||| || ||||||| Sbjct: 390 tgatgccgagcacgttggccttgatggcggtgcagagacagacggcggcctcaaggtcgg 331 Query: 380 cgagcccgcccagga 394 |||| ||||| |||| Sbjct: 330 cgaggccgccgagga 316
>ref|XM_473450.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 414 Score = 73.8 bits (37), Expect = 4e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 324 gccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383 |||||| | ||||||| ||||||| ||||||||||| |||||||| |||||||||||||| Sbjct: 330 gccgagcacgttggccttgatggccgtgcagaggcagacggcggcctcgaggtcggcgag 271 Query: 384 cccgc 388 |||| Sbjct: 270 gccgc 266
>ref|NM_185320.1| Oryza sativa (japonica cultivar-group), mRNA Length = 903 Score = 71.9 bits (36), Expect = 2e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 273 gccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggat 332 |||||| | |||||| ||||||| |||||||| |||||| | ||| |||| |||||| | Sbjct: 318 gccgcagtagttgaggaggagggagaggtcgacggggacgtcgaggttgaggccgagaag 259 Query: 333 gttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 380 |||||| |||||||| ||||| ||| ||||||||||| |||||||| Sbjct: 258 gttggcgttgatggcgaggcagacgcagacggcggcgtccaggtcggc 211
>gb|AF149815.1| Oryza sativa unknown gene Length = 1293 Score = 71.9 bits (36), Expect = 2e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 273 gccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggat 332 |||||| | |||||| ||||||| |||||||| |||||| | ||| |||| |||||| | Sbjct: 160 gccgcagtagttgaggaggagggagaggtcgacggggacgtcgaggttgaggccgagaag 101 Query: 333 gttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 380 |||||| |||||||| ||||| ||| ||||||||||| |||||||| Sbjct: 100 gttggcgttgatggcgaggcagacgcagacggcggcgtccaggtcggc 53
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 71.9 bits (36), Expect = 2e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 273 gccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggat 332 |||||| | |||||| ||||||| |||||||| |||||| | ||| |||| |||||| | Sbjct: 343474 gccgcagtagttgaggaggagggagaggtcgacggggacgtcgaggttgaggccgagaag 343415 Query: 333 gttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 380 |||||| |||||||| ||||| ||| ||||||||||| |||||||| Sbjct: 343414 gttggcgttgatggcgaggcagacgcagacggcggcgtccaggtcggc 343367 Score = 56.0 bits (28), Expect = 1e-04 Identities = 58/68 (85%) Strand = Plus / Minus Query: 339 cctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgg 398 |||||||| ||||||||||||||||||||| || || || ||||||| |||| || || Sbjct: 25844215 cctgatggtggtgcagaggcacacggcggcctccagctccacgagcccctccagcagcgg 25844156 Query: 399 gcagcact 406 |||||||| Sbjct: 25844155 gcagcact 25844148
>dbj|AP001129.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0644B06 Length = 194509 Score = 71.9 bits (36), Expect = 2e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 273 gccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggat 332 |||||| | |||||| ||||||| |||||||| |||||| | ||| |||| |||||| | Sbjct: 53427 gccgcagtagttgaggaggagggagaggtcgacggggacgtcgaggttgaggccgagaag 53368 Query: 333 gttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 380 |||||| |||||||| ||||| ||| ||||||||||| |||||||| Sbjct: 53367 gttggcgttgatggcgaggcagacgcagacggcggcgtccaggtcggc 53320
>ref|NM_195931.1| Oryza sativa (japonica cultivar-group) putative lipid tranfer protein (OSJNAb0078C13.15), mRNA Length = 381 Score = 69.9 bits (35), Expect = 7e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 346 gcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggcagca 404 |||||||||||||| |||||||||||||||||||||| ||| |||| || |||||||| Sbjct: 275 gcggtgcagaggcagacggcggcgtcgaggtcggcgataccggccagcagcgggcagca 217
>gb|AC123594.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNAb0078C13, complete sequence Length = 146538 Score = 69.9 bits (35), Expect = 7e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 346 gcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggcagca 404 |||||||||||||| |||||||||||||||||||||| ||| |||| || |||||||| Sbjct: 89091 gcggtgcagaggcagacggcggcgtcgaggtcggcgataccggccagcagcgggcagca 89149 Score = 50.1 bits (25), Expect = 0.006 Identities = 52/61 (85%) Strand = Plus / Plus Query: 322 atgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcg 381 ||||| |||| ||||||| | | ||| ||||||||||| |||||||| ||||| |||||| Sbjct: 68035 atgccaaggacgttggccttcacggcagtgcagaggcagacggcggcatcgagatcggcg 68094 Query: 382 a 382 | Sbjct: 68095 a 68095 Score = 44.1 bits (22), Expect = 0.40 Identities = 34/38 (89%) Strand = Plus / Plus Query: 345 ggcggtgcagaggcacacggcggcgtcgaggtcggcga 382 ||||||||||||||| ||||| ||||||| ||||||| Sbjct: 80134 ggcggtgcagaggcagacggcagcgtcgatatcggcga 80171 Score = 44.1 bits (22), Expect = 0.40 Identities = 31/34 (91%) Strand = Plus / Plus Query: 349 gtgcagaggcacacggcggcgtcgaggtcggcga 382 ||||||||||| ||||| |||||||| ||||||| Sbjct: 64921 gtgcagaggcagacggcagcgtcgagatcggcga 64954
>dbj|AK062848.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-107-H12, full insert sequence Length = 662 Score = 69.9 bits (35), Expect = 7e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 346 gcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggcagca 404 |||||||||||||| |||||||||||||||||||||| ||| |||| || |||||||| Sbjct: 337 gcggtgcagaggcagacggcggcgtcgaggtcggcgataccggccagcagcgggcagca 279
>gb|AY106116.1| Zea mays PCO091367 mRNA sequence Length = 842 Score = 69.9 bits (35), Expect = 7e-09 Identities = 77/91 (84%) Strand = Plus / Minus Query: 272 tgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgagga 331 ||||||| | ||||| |||||| |||||| |||||| | ||||| |||||||| |||| Sbjct: 539 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 480 Query: 332 tgttggccctgatggcggtgcagaggcacac 362 ||||||||||| | |||||||||||||||| Sbjct: 479 cgttggccctgaggacggtgcagaggcacac 449
>ref|XM_469576.1| Oryza sativa (japonica cultivar-group), mRNA Length = 445 Score = 65.9 bits (33), Expect = 1e-07 Identities = 87/105 (82%) Strand = Plus / Minus Query: 339 cctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgg 398 ||||||||||| |||||||||| | ||||||||||||| |||| | ||||| || || Sbjct: 343 cctgatggcggcgcagaggcacgccgcggcgtcgaggttcacgaggctccccagcagcgg 284 Query: 399 gcagcactgctcgttggccggcacgccaatcttaagcttcagcag 443 ||||||||||| | | ||||||||| ||||| ||||||||||| Sbjct: 283 gcagcactgctggctcgccggcacgttgatcttcagcttcagcag 239
>ref|XM_473863.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 465 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 334 ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382 |||||| ||||||||||||||||||| | ||||||||||||||||||| Sbjct: 368 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 320
>ref|XM_473862.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 609 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 334 ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382 |||||| ||||||||||||||||||| | ||||||||||||||||||| Sbjct: 494 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 446
>gb|AC147426.2| Oryza sativa chromosome 3 B1377B10 genomic sequence, complete sequence Length = 184366 Score = 65.9 bits (33), Expect = 1e-07 Identities = 87/105 (82%) Strand = Plus / Minus Query: 339 cctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgg 398 ||||||||||| |||||||||| | ||||||||||||| |||| | ||||| || || Sbjct: 456 cctgatggcggcgcagaggcacgccgcggcgtcgaggttcacgaggctccccagcagcgg 397 Query: 399 gcagcactgctcgttggccggcacgccaatcttaagcttcagcag 443 ||||||||||| | | ||||||||| ||||| ||||||||||| Sbjct: 396 gcagcactgctggctcgccggcacgttgatcttcagcttcagcag 352
>emb|AL731610.4|OSJN00255 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0070C17, complete sequence Length = 160484 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 334 ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382 |||||| ||||||||||||||||||| | ||||||||||||||||||| Sbjct: 78099 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 78051 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 334 ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382 |||||| ||||||||||||||||||| | ||||||||||||||||||| Sbjct: 67680 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 67632
>gb|AC091532.13| Oryza sativa chromosome 3 BAC OSJNBa0078A17 genomic sequence, complete sequence Length = 147344 Score = 65.9 bits (33), Expect = 1e-07 Identities = 87/105 (82%) Strand = Plus / Minus Query: 339 cctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgg 398 ||||||||||| |||||||||| | ||||||||||||| |||| | ||||| || || Sbjct: 124142 cctgatggcggcgcagaggcacgccgcggcgtcgaggttcacgaggctccccagcagcgg 124083 Query: 399 gcagcactgctcgttggccggcacgccaatcttaagcttcagcag 443 ||||||||||| | | ||||||||| ||||| ||||||||||| Sbjct: 124082 gcagcactgctggctcgccggcacgttgatcttcagcttcagcag 124038
>dbj|AK062781.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-107-B03, full insert sequence Length = 713 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 334 ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382 |||||| ||||||||||||||||||| | ||||||||||||||||||| Sbjct: 228 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 180
>dbj|AK062295.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-100-F05, full insert sequence Length = 570 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 334 ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382 |||||| ||||||||||||||||||| | ||||||||||||||||||| Sbjct: 144 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 96
>ref|NM_197670.1| Oryza sativa (japonica cultivar-group) putative lipid transfer protein (OSJNBa0015J15.17), mRNA Length = 489 Score = 61.9 bits (31), Expect = 2e-06 Identities = 55/63 (87%) Strand = Plus / Minus Query: 349 gtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgc 408 ||||||||||||||||||||||| | ||||||||| ||| | ||||| |||||||||| Sbjct: 371 gtgcagaggcacacggcggcgtccacgtcggcgaggccggcgaggagcccgcagcactgc 312 Query: 409 tcg 411 ||| Sbjct: 311 tcg 309
>dbj|AK107851.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-134-A09, full insert sequence Length = 764 Score = 61.9 bits (31), Expect = 2e-06 Identities = 55/63 (87%) Strand = Plus / Minus Query: 349 gtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgc 408 ||||||||||||||||||||||| | ||||||||| ||| | ||||| |||||||||| Sbjct: 450 gtgcagaggcacacggcggcgtccacgtcggcgaggccggcgaggagcccgcagcactgc 391 Query: 409 tcg 411 ||| Sbjct: 390 tcg 388
>gb|AY105149.1| Zea mays PCO087109 mRNA sequence Length = 966 Score = 60.0 bits (30), Expect = 7e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 324 gccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcga 373 |||||||| ||||||| ||||||| ||||||||||| |||||||| |||| Sbjct: 494 gccgaggacgttggccttgatggccgtgcagaggcagacggcggcctcga 445
>dbj|AP003523.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0416A11 Length = 171519 Score = 56.0 bits (28), Expect = 1e-04 Identities = 58/68 (85%) Strand = Plus / Minus Query: 339 cctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgg 398 |||||||| ||||||||||||||||||||| || || || ||||||| |||| || || Sbjct: 126419 cctgatggtggtgcagaggcacacggcggcctccagctccacgagcccctccagcagcgg 126360 Query: 399 gcagcact 406 |||||||| Sbjct: 126359 gcagcact 126352
>dbj|AK103715.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033137N14, full insert sequence Length = 1338 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 339 cctgatggcggtgcagaggcacacggcggc 368 |||||||| ||||||||||||||||||||| Sbjct: 760 cctgatggtggtgcagaggcacacggcggc 731
>dbj|AK063037.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-110-D01, full insert sequence Length = 498 Score = 52.0 bits (26), Expect = 0.002 Identities = 50/58 (86%) Strand = Plus / Minus Query: 282 gttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggcc 339 |||||| |||||| |||||||| |||||| |||| ||||||||||||| ||||||| Sbjct: 236 gttgaggaggaggacgaggtcgacggggacgttgatgttgatgccgaggacgttggcc 179
>gb|AF026382.1| Fragaria x ananassa HyPRP mRNA, complete cds Length = 798 Score = 52.0 bits (26), Expect = 0.002 Identities = 53/62 (85%) Strand = Plus / Minus Query: 319 ttgatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcg 378 ||||||||||| ||| |||| |||||||| ||||||||||| || || || ||||| ||| Sbjct: 463 ttgatgccgagaatgctggctctgatggcagtgcagaggcatacagcagcttcgagatcg 404 Query: 379 gc 380 || Sbjct: 403 gc 402
>gb|AY530533.1| Fragaria x ananassa cultivar Chandler HyPRP gene, complete cds Length = 2071 Score = 52.0 bits (26), Expect = 0.002 Identities = 53/62 (85%) Strand = Plus / Minus Query: 319 ttgatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcg 378 ||||||||||| ||| |||| |||||||| ||||||||||| || || || ||||| ||| Sbjct: 1294 ttgatgccgagaatgctggctctgatggcagtgcagaggcatacagcagcttcgagatcg 1235 Query: 379 gc 380 || Sbjct: 1234 gc 1233
>dbj|AB018588.1| Zea mays ZmGR1b mRNA, complete cds Length = 813 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 324 gccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcga 373 |||||| | ||||||| ||||||| ||||||||||| |||||||| |||| Sbjct: 361 gccgagcacgttggccttgatggccgtgcagaggcagacggcggcctcga 312
>dbj|AB018587.1| Zea mays ZmGR1a mRNA, complete cds Length = 833 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 324 gccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcga 373 |||||| | ||||||| ||||||| ||||||||||| |||||||| |||| Sbjct: 364 gccgagcacgttggccttgatggccgtgcagaggcagacggcggcctcga 315
>ref|NM_195927.1| Oryza sativa (japonica cultivar-group) putative lipid tranfer protein (OSJNAb0078C13.11), mRNA Length = 414 Score = 50.1 bits (25), Expect = 0.006 Identities = 52/61 (85%) Strand = Plus / Minus Query: 322 atgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcg 381 ||||| |||| ||||||| | | ||| ||||||||||| |||||||| ||||| |||||| Sbjct: 335 atgccaaggacgttggccttcacggcagtgcagaggcagacggcggcatcgagatcggcg 276 Query: 382 a 382 | Sbjct: 275 a 275
>ref|XM_474092.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 783 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 334 ttggccctgatggcggtgcagaggcacacggcggcg 369 |||||| ||||||||||||||||||| |||||||| Sbjct: 692 ttggccttgatggcggtgcagaggcaggcggcggcg 657
>ref|NM_185028.1| Oryza sativa (japonica cultivar-group), mRNA Length = 459 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 348 ggtgcagaggcacacggcggcgtcgaggtcggcgag 383 |||||||||||| ||| |||||||||||||| |||| Sbjct: 225 ggtgcagaggcagacgacggcgtcgaggtcgacgag 190
>gb|AC108906.9| Oryza sativa chromosome 3 BAC OSJNBa0087C10 genomic sequence, complete sequence Length = 144487 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 348 ggtgcagaggcacacggcggcgtcgaggtcggcgag 383 |||||||||||| ||| |||||||||||||| |||| Sbjct: 130486 ggtgcagaggcagacgacggcgtcgaggtcgacgag 130451
>gb|AC104321.7| Oryza sativa chromosome 3 BAC OSJNBa0052F07 genomic sequence, complete sequence Length = 139823 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 348 ggtgcagaggcacacggcggcgtcgaggtcggcgag 383 |||||||||||| ||| |||||||||||||| |||| Sbjct: 9239 ggtgcagaggcagacgacggcgtcgaggtcgacgag 9204
>dbj|AK105903.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-F11, full insert sequence Length = 1255 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 334 ttggccctgatggcggtgcagaggcacacggcggcg 369 |||||| ||||||||||||||||||| |||||||| Sbjct: 842 ttggccttgatggcggtgcagaggcaggcggcggcg 807
>dbj|AK105778.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-202-F10, full insert sequence Length = 1242 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 334 ttggccctgatggcggtgcagaggcacacggcggcg 369 |||||| ||||||||||||||||||| |||||||| Sbjct: 842 ttggccttgatggcggtgcagaggcaggcggcggcg 807
>dbj|AK104623.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-H11, full insert sequence Length = 1251 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 334 ttggccctgatggcggtgcagaggcacacggcggcg 369 |||||| ||||||||||||||||||| |||||||| Sbjct: 838 ttggccttgatggcggtgcagaggcaggcggcggcg 803
>dbj|AK071989.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094H13, full insert sequence Length = 1272 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 334 ttggccctgatggcggtgcagaggcacacggcggcg 369 |||||| ||||||||||||||||||| |||||||| Sbjct: 846 ttggccttgatggcggtgcagaggcaggcggcggcg 811
>dbj|AK061322.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-F03, full insert sequence Length = 1257 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 334 ttggccctgatggcggtgcagaggcacacggcggcg 369 |||||| ||||||||||||||||||| |||||||| Sbjct: 844 ttggccttgatggcggtgcagaggcaggcggcggcg 809
>emb|AL732331.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0413E07, complete sequence Length = 76546 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Plus Query: 334 ttggccctgatggcggtgcagaggcacacggcggcg 369 |||||| ||||||||||||||||||| |||||||| Sbjct: 22462 ttggccttgatggcggtgcagaggcaggcggcggcg 22497
>emb|AL606454.3|OSJN00009 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0033G05, complete sequence Length = 142556 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Plus Query: 334 ttggccctgatggcggtgcagaggcacacggcggcg 369 |||||| ||||||||||||||||||| |||||||| Sbjct: 89513 ttggccttgatggcggtgcagaggcaggcggcggcg 89548
>ref|NM_195930.1| Oryza sativa (japonica cultivar-group) putative lipid tranfer protein (OSJNAb0078C13.14), mRNA Length = 393 Score = 44.1 bits (22), Expect = 0.40 Identities = 34/38 (89%) Strand = Plus / Minus Query: 345 ggcggtgcagaggcacacggcggcgtcgaggtcggcga 382 ||||||||||||||| ||||| ||||||| ||||||| Sbjct: 291 ggcggtgcagaggcagacggcagcgtcgatatcggcga 254
>ref|NM_195926.1| Oryza sativa (japonica cultivar-group) putative lipid transfer protein (OSJNAb0078C13.10), mRNA Length = 414 Score = 44.1 bits (22), Expect = 0.40 Identities = 31/34 (91%) Strand = Plus / Minus Query: 349 gtgcagaggcacacggcggcgtcgaggtcggcga 382 ||||||||||| ||||| |||||||| ||||||| Sbjct: 308 gtgcagaggcagacggcagcgtcgagatcggcga 275
>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome Length = 3402093 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 362 cggcggcgtcgaggtcggcgag 383 |||||||||||||||||||||| Sbjct: 2864055 cggcggcgtcgaggtcggcgag 2864034
>gb|AC073903.8| Homo sapiens BAC clone RP11-564F5 from 7, complete sequence Length = 80531 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 55 ttttacaatatgcaaatcatgc 76 |||||||||||||||||||||| Sbjct: 23023 ttttacaatatgcaaatcatgc 23044
>gb|AC146161.2| Pan troglodytes BAC clone RP43-1G6 from 7, complete sequence Length = 205885 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 55 ttttacaatatgcaaatcatgc 76 |||||||||||||||||||||| Sbjct: 154858 ttttacaatatgcaaatcatgc 154837
>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome Length = 4406967 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 362 cggcggcgtcgaggtcggcgag 383 |||||||||||||||||||||| Sbjct: 3593634 cggcggcgtcgaggtcggcgag 3593613
>emb|BX537260.8| Zebrafish DNA sequence from clone DKEY-234J21 in linkage group 1, complete sequence Length = 150038 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 119 aagcttataaagcatgcatgca 140 |||||||||||||||||||||| Sbjct: 36511 aagcttataaagcatgcatgca 36490
>gb|AE004524.1| Pseudomonas aeruginosa PAO1, section 85 of 529 of the complete genome Length = 11749 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 361 acggcggcgtcgaggtcggcga 382 |||||||||||||||||||||| Sbjct: 4416 acggcggcgtcgaggtcggcga 4395
>emb|Z93108.1|MAZ93108 M.acuminata mRNA; clone pBAN UU70 Length = 785 Score = 44.1 bits (22), Expect = 0.40 Identities = 41/48 (85%) Strand = Plus / Minus Query: 336 ggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383 |||| |||| || | ||| |||||||||||||| ||||||||| |||| Sbjct: 398 ggccntgatagcagngcaaaggcacacggcggcctcgaggtcgacgag 351
>dbj|AK108560.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-145-A10, full insert sequence Length = 719 Score = 44.1 bits (22), Expect = 0.40 Identities = 31/34 (91%) Strand = Plus / Minus Query: 349 gtgcagaggcacacggcggcgtcgaggtcggcga 382 ||||||||||| ||||| |||||||| ||||||| Sbjct: 389 gtgcagaggcagacggcagcgtcgagatcggcga 356
>gb|AF011922.1|AF011922 Pseudomonas aeruginosa aru gene cluster, ArgR regulatory protein (argR), succinylornithine aminotransferase (aruC), arginine/ornithine succinyltransferase AI subunit (aruF), arginine/ornithine succinyltransferase AII subunit (aruG), succinylglutamate 5-semialdehyde dehydrogenase (aruD), succinylarginine dihydrolase (aruB), succinylglutamate desuccinylase (aruE) genes, complete cds; and alanine tRNA synthetase (alaS) gene, partial cds Length = 12949 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 361 acggcggcgtcgaggtcggcga 382 |||||||||||||||||||||| Sbjct: 7794 acggcggcgtcgaggtcggcga 7773
>gb|AC120159.9| Mus musculus chromosome 19, clone RP24-408B13, complete sequence Length = 178918 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 43 gtatgtatatccttttacaat 63 ||||||||||||||||||||| Sbjct: 23709 gtatgtatatccttttacaat 23729
>emb|AL021346.1|CEH37A05 Caenorhabditis elegans Fosmid H37A05, complete sequence Length = 31226 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 218 aaatcgatggatagatggatc 238 ||||||||||||||||||||| Sbjct: 20684 aaatcgatggatagatggatc 20664
>gb|AC157785.2| Mus musculus chromosome 19, clone RP24-272L14, complete sequence Length = 159030 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 43 gtatgtatatccttttacaat 63 ||||||||||||||||||||| Sbjct: 26425 gtatgtatatccttttacaat 26405
>ref|XM_776757.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein LOC576450 (LOC576450), mRNA Length = 907 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 320 tgatgccgaggatgttggccc 340 ||||||||||||||||||||| Sbjct: 115 tgatgccgaggatgttggccc 95
>emb|AL939128.1|SCO939128 Streptomyces coelicolor A3(2) complete genome; segment 25/29 Length = 296500 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 361 acggcggcgtcgaggtcggcg 381 ||||||||||||||||||||| Sbjct: 131502 acggcggcgtcgaggtcggcg 131482
>emb|CR788320.11| Zebrafish DNA sequence from clone DKEY-217F16 in linkage group 13, complete sequence Length = 174497 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 120 agcttataaagcatgcatgca 140 ||||||||||||||||||||| Sbjct: 118082 agcttataaagcatgcatgca 118062
>emb|CR450720.5| Zebrafish DNA sequence from clone DKEYP-51F11 in linkage group 2, complete sequence Length = 200950 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 217 taaatcgatggatagatggat 237 ||||||||||||||||||||| Sbjct: 80562 taaatcgatggatagatggat 80542 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 217 taaatcgatggatagatggat 237 ||||||||||||||||||||| Sbjct: 80378 taaatcgatggatagatggat 80358
>emb|BX640499.5| Zebrafish DNA sequence from clone DKEYP-67D2 in linkage group 9, complete sequence Length = 184606 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 120 agcttataaagcatgcatgca 140 ||||||||||||||||||||| Sbjct: 55665 agcttataaagcatgcatgca 55685
>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome Length = 3046682 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 402 gcactgctcgttggccggcac 422 ||||||||||||||||||||| Sbjct: 2011419 gcactgctcgttggccggcac 2011439
>emb|AL954696.17| Zebrafish DNA sequence from clone CH211-234K4, complete sequence Length = 149858 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 120 agcttataaagcatgcatgca 140 ||||||||||||||||||||| Sbjct: 56466 agcttataaagcatgcatgca 56446 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 120 agcttataaagcatgcatgca 140 ||||||||||||||||||||| Sbjct: 31135 agcttataaagcatgcatgca 31155
>emb|BX569781.7| Zebrafish DNA sequence from clone DKEY-72L18 in linkage group 17, complete sequence Length = 170138 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 61 aatatgcaaatcatgcatttagata 85 ||||||||||| ||||||||||||| Sbjct: 131136 aatatgcaaatgatgcatttagata 131160
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 362 cggcggcgtcgaggtcggcga 382 ||||||||||||||||||||| Sbjct: 4768255 cggcggcgtcgaggtcggcga 4768235
>emb|BX088690.9| Zebrafish DNA sequence from clone CH211-211A20 in linkage group 18, complete sequence Length = 218713 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 120 agcttataaagcatgcatgca 140 ||||||||||||||||||||| Sbjct: 18784 agcttataaagcatgcatgca 18764
>emb|AL929193.19| Zebrafish DNA sequence from clone CH211-274P24 in linkage group 20, complete sequence Length = 159094 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 120 agcttataaagcatgcatgca 140 ||||||||||||||||||||| Sbjct: 67660 agcttataaagcatgcatgca 67640
>emb|CR788229.7| Zebrafish DNA sequence from clone DKEY-261F4 in linkage group 18, complete sequence Length = 127565 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 120 agcttataaagcatgcatgca 140 ||||||||||||||||||||| Sbjct: 22690 agcttataaagcatgcatgca 22670
>emb|AL772356.2| Zebrafish DNA sequence from clone BUSM1-258D18 in linkage group 9, complete sequence Length = 80182 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 120 agcttataaagcatgcatgca 140 ||||||||||||||||||||| Sbjct: 1681 agcttataaagcatgcatgca 1661
>gb|AY105889.1| Zea mays PCO106909 mRNA sequence Length = 1420 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 341 tgatggcggtgcagaggcacacggc 365 |||||| |||||||||||||||||| Sbjct: 861 tgatggtggtgcagaggcacacggc 837
>gb|AE000782.1| Archaeoglobus fulgidus DSM 4304, complete genome Length = 2178400 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 434 gcttcagcaggttcagcacgt 454 ||||||||||||||||||||| Sbjct: 1711084 gcttcagcaggttcagcacgt 1711064
>gb|U73214.1|TAU73214 Triticum aestivum cold acclimation protein WCOR518 (Wcor518) mRNA, parial cds Length = 1168 Score = 42.1 bits (21), Expect = 1.6 Identities = 33/37 (89%) Strand = Plus / Minus Query: 341 tgatggcggtgcagaggcacacggcggcgtcgaggtc 377 |||||| |||||||||||| | |||||||||||||| Sbjct: 845 tgatggtggtgcagaggcagagcgcggcgtcgaggtc 809
>gb|CP000108.1| Chlorobium chlorochromatii CaD3, complete genome Length = 2572079 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 310 acattgagcttgatgccgaggatg 333 ||||||||||||||||||| |||| Sbjct: 185925 acattgagcttgatgccgatgatg 185902
>ref|NM_194119.1| Oryza sativa (japonica cultivar-group), mRNA Length = 369 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 362 cggcggcgtcgaggtcggcg 381 |||||||||||||||||||| Sbjct: 316 cggcggcgtcgaggtcggcg 297
>gb|AC134511.2| Homo sapiens 12 BAC RP11-528M24 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 125643 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 282 gttgagtaggagggtgaggt 301 |||||||||||||||||||| Sbjct: 33253 gttgagtaggagggtgaggt 33234
>gb|AC122022.4| Mus musculus BAC clone RP24-372J5 from chromosome 5, complete sequence Length = 174861 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 56 tttacaatatgcaaatcatgcatt 79 ||||||||| |||||||||||||| Sbjct: 144719 tttacaataagcaaatcatgcatt 144742
>gb|AC126010.13| Medicago truncatula clone mth2-20e4, complete sequence Length = 113964 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 101 atgacattgatcaatcacaa 120 |||||||||||||||||||| Sbjct: 11394 atgacattgatcaatcacaa 11375
>emb|CR854992.5| Zebrafish DNA sequence from clone DKEYP-30C3 in linkage group 5, complete sequence Length = 104348 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 121 gcttataaagcatgcatgca 140 |||||||||||||||||||| Sbjct: 18662 gcttataaagcatgcatgca 18681
>emb|X81885.2|SFTYLORF Streptomyces fradiae tylMIII(orf1*), tylMII(orf2*), tylMI(orf3*) and ccr(orf4*) genes Length = 4986 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 365 cggcgtcgaggtcggcgagcccgcccag 392 |||||||||||||| |||||||| |||| Sbjct: 2390 cggcgtcgaggtcgccgagcccggccag 2363
>emb|CR555306.1| Azoarcus sp. EbN1 complete genome Length = 4296230 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 368 cgtcgaggtcggcgagcccg 387 |||||||||||||||||||| Sbjct: 31381 cgtcgaggtcggcgagcccg 31400
>emb|CR380953.1| Candida glabrata strain CBS138 chromosome G complete sequence Length = 992211 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 56 tttacaatatgcaaatcatgcatttaga 83 |||||||||||||||| |||||||||| Sbjct: 402747 tttacaatatgcaaatattgcatttaga 402720
>emb|BX927152.1| Corynebacterium glutamicum ATCC 13032, IS fingerprint type 4-5, complete genome; segment 5/10 Length = 349799 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 gagggtgaggtcgatgggga 310 |||||||||||||||||||| Sbjct: 334590 gagggtgaggtcgatgggga 334609
>gb|AE016828.2| Coxiella burnetii RSA 493, complete genome Length = 1995281 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 aacccaacttgaacaacctt 20 |||||||||||||||||||| Sbjct: 1082607 aacccaacttgaacaacctt 1082588
>emb|BX569691.1| Synechococcus sp. WH8102 complete genome; segment 3/7 Length = 347365 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 231 gatggatcacatgcggcagg 250 |||||||||||||||||||| Sbjct: 182979 gatggatcacatgcggcagg 182998
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 360 cacggcggcgtcgaggtcggcgag 383 ||||||||||||||| |||||||| Sbjct: 164966 cacggcggcgtcgagatcggcgag 164989
>gb|AC108043.3| Homo sapiens BAC clone RP11-270L13 from 4, complete sequence Length = 138020 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 345 ggcggtgcagaggcacacggcggc 368 |||||||||||||| ||||||||| Sbjct: 45282 ggcggtgcagaggcccacggcggc 45305
>gb|AC073427.7| Homo sapiens BAC clone RP11-746K19 from 4, complete sequence Length = 157152 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 115 tcacaagcttataaagcatg 134 |||||||||||||||||||| Sbjct: 77653 tcacaagcttataaagcatg 77672
>gb|AC006549.28| Homo sapiens chromosome 22 clone p215k21 map 22q11, complete sequence Length = 174840 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 214 gagtaaatcgatggatagatggat 237 |||||||| ||||||||||||||| Sbjct: 78547 gagtaaatggatggatagatggat 78524
>gb|AC000097.1| Homo sapiens Chromosome 22q11.2 PAC Clone p201m18 In DGCR Region, complete sequence Length = 162269 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 214 gagtaaatcgatggatagatggat 237 |||||||| ||||||||||||||| Sbjct: 148376 gagtaaatggatggatagatggat 148353
>gb|AC006547.9| Homo sapiens chromosome 22 clone p158l19 map 22q11, complete sequence Length = 179269 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 214 gagtaaatcgatggatagatggat 237 |||||||| ||||||||||||||| Sbjct: 160594 gagtaaatggatggatagatggat 160571
>gb|AC058790.14| Homo sapiens chromosome 22 clone b518b9 map 22q11, complete sequence Length = 184929 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 214 gagtaaatcgatggatagatggat 237 |||||||| ||||||||||||||| Sbjct: 57686 gagtaaatggatggatagatggat 57663
>gb|AC007663.29| Homo sapiens chromosome 22 clone b444p24 map 22q11, complete sequence Length = 168239 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 214 gagtaaatcgatggatagatggat 237 |||||||| ||||||||||||||| Sbjct: 45886 gagtaaatggatggatagatggat 45863
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 362 cggcggcgtcgaggtcggcg 381 |||||||||||||||||||| Sbjct: 718853 cggcggcgtcgaggtcggcg 718872
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 tataaagcatgcatgcatga 143 |||||||||||||||||||| Sbjct: 24699528 tataaagcatgcatgcatga 24699509
>dbj|BA000036.3| Corynebacterium glutamicum ATCC 13032 DNA, complete genome Length = 3309401 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 gagggtgaggtcgatgggga 310 |||||||||||||||||||| Sbjct: 1728813 gagggtgaggtcgatgggga 1728832
>dbj|AP003328.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1040D09 Length = 148102 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 tataaagcatgcatgcatga 143 |||||||||||||||||||| Sbjct: 125491 tataaagcatgcatgcatga 125472
>gb|AF235504.1|AF235504 Streptomyces hygroscopicus var. ascomyceticus FK520 biosynthetic gene cluster, partial sequence Length = 77534 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 358 cacacggcggcgtcgaggtcggcg 381 |||||||||||||||| ||||||| Sbjct: 36322 cacacggcggcgtcgaagtcggcg 36345
>gb|AF263912.1|AF263912 Streptomyces noursei ATCC 11455 nystatin biosynthetic gene cluster, complete sequence Length = 123580 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 362 cggcggcgtcgaggtcggcgagcc 385 |||||||||||||| ||||||||| Sbjct: 81371 cggcggcgtcgaggccggcgagcc 81348
>dbj|AP003874.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1118_G09 Length = 115815 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 362 cggcggcgtcgaggtcggcg 381 |||||||||||||||||||| Sbjct: 57384 cggcggcgtcgaggtcggcg 57403
>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome Length = 4659019 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 361 acggcggcgtcgaggtcggcgagc 384 ||||||||||||||||||| |||| Sbjct: 3603602 acggcggcgtcgaggtcggagagc 3603579
>dbj|AP002843.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0407B12 Length = 148762 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 tataaagcatgcatgcatga 143 |||||||||||||||||||| Sbjct: 68105 tataaagcatgcatgcatga 68086
>dbj|AP005244.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1513_F02 Length = 126845 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 362 cggcggcgtcgaggtcggcg 381 |||||||||||||||||||| Sbjct: 38660 cggcggcgtcgaggtcggcg 38679
>emb|BX572098.1| Prochlorococcus marinus MIT9313 complete genome; segment 4/7 Length = 346683 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 231 gatggatcacatgcggcagg 250 |||||||||||||||||||| Sbjct: 121940 gatggatcacatgcggcagg 121921
>gb|AC117614.12| Mus musculus chromosome 5, clone RP23-110C17, complete sequence Length = 222809 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 56 tttacaatatgcaaatcatgcatt 79 ||||||||| |||||||||||||| Sbjct: 3882 tttacaataagcaaatcatgcatt 3905
>gb|U34333.1|PVU34333 Phaseolus vulgaris proline-rich 14 kDa protein mRNA, complete cds Length = 677 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 303 gatggggacattgagcttgatgcc 326 ||||||||||||||| |||||||| Sbjct: 337 gatggggacattgaggttgatgcc 314
>emb|BX000489.8| Zebrafish DNA sequence from clone CH211-215E19, complete sequence Length = 201748 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 93 gtgatacaatgacattgatcaatc 116 ||||||||||||| |||||||||| Sbjct: 15783 gtgatacaatgacgttgatcaatc 15760 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 93 gtgatacaatgacattgatcaatc 116 ||||||||||||| |||||||||| Sbjct: 14998 gtgatacaatgacgttgatcaatc 14975 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,347,012 Number of Sequences: 3902068 Number of extensions: 3347012 Number of successful extensions: 79142 Number of sequences better than 10.0: 148 Number of HSP's better than 10.0 without gapping: 156 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 77749 Number of HSP's gapped (non-prelim): 1387 length of query: 463 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 441 effective length of database: 17,147,199,772 effective search space: 7561915099452 effective search space used: 7561915099452 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)