ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart13e06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 184 2e-43
2gb|AY466108.1| Oryza sativa (japonica cultivar-group) lipid tran... 184 2e-43
3gb|AC118673.2| Genomic sequence for Oryza sativa, Nipponbare str... 184 2e-43
4gb|AC125411.1| Genomic sequence for Oryza sativa, Nipponbare str... 184 2e-43
5dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 184 2e-43
6gb|AF485811.1| Oryza sativa BAC OSJNa0049F05, complete sequence 184 2e-43
7dbj|AK103618.1| Oryza sativa (japonica cultivar-group) cDNA clon... 184 2e-43
8dbj|AK062654.1| Oryza sativa (japonica cultivar-group) cDNA clon... 167 4e-38
9gb|AY108363.1| Zea mays PCO069442 mRNA sequence 135 1e-28
10ref|NM_197681.1| Oryza sativa (japonica cultivar-group) putative... 125 1e-25
11gb|AC026758.8| Oryza sativa chromosome 10 BAC OSJNBa0015J15 geno... 125 1e-25
12dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 125 1e-25
13dbj|AK062381.1| Oryza sativa (japonica cultivar-group) cDNA clon... 125 1e-25
14gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 125 1e-25
15ref|XM_467170.1| Oryza sativa (japonica cultivar-group), mRNA 123 5e-25
16dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 123 5e-25
17dbj|AP004037.3| Oryza sativa (japonica cultivar-group) genomic D... 123 5e-25
18dbj|AP004883.3| Oryza sativa (japonica cultivar-group) genomic D... 123 5e-25
19dbj|AK109149.1| Oryza sativa (japonica cultivar-group) cDNA clon... 123 5e-25
20gb|L27208.1|RICRCC3 Oryza sativa root-specific RCc3 mRNA, comple... 123 5e-25
21ref|NM_197679.1| Oryza sativa (japonica cultivar-group) putative... 117 3e-23
22dbj|AK062911.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 3e-23
23ref|NM_197676.1| Oryza sativa (japonica cultivar-group) putative... 115 1e-22
24gb|AY108411.1| Zea mays PCO134698 mRNA sequence 113 5e-22
25ref|NM_197680.1| Oryza sativa (japonica cultivar-group) putative... 109 8e-21
26dbj|AK063090.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 8e-21
27ref|XM_473448.1| Oryza sativa (japonica cultivar-group), predic... 105 1e-19
28gb|AY466109.1| Oryza sativa (japonica cultivar-group) lipid tran... 105 1e-19
29emb|AL606633.3|OSJN00060 Oryza sativa genomic DNA, chromosome 4,... 105 1e-19
30dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 105 1e-19
31ref|NM_197671.1| Oryza sativa (japonica cultivar-group) putative... 101 2e-18
32gb|L27210.1|RICRCG2 Oryza sativa root-specific protein (RCg2) ge... 101 2e-18
33gb|L27209.1|RICRCC2 Oryza sativa root-specific RCc2 mRNA, comple... 101 2e-18
34ref|XM_473449.1| Oryza sativa (japonica cultivar-group), predic... 98 3e-17
35gb|AY105972.1| Zea mays PCO122221 mRNA sequence 94 5e-16
36ref|NM_197675.1| Oryza sativa (japonica cultivar-group) putative... 92 2e-15
37ref|NM_197672.1| Oryza sativa (japonica cultivar-group) putative... 82 2e-12
38emb|Z12103.1|ZMDELINM Z.mays mRNA that delineates a novel subset... 82 2e-12
39dbj|AK102086.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 2e-12
40gb|AY104687.1| Zea mays PCO121733 mRNA sequence 82 2e-12
41gb|AY105236.1| Zea mays PCO121732 mRNA sequence 82 2e-12
42gb|AF001634.1|AF001634 Zea mays physical impedance induced prote... 82 2e-12
43ref|XM_467171.1| Oryza sativa (japonica cultivar-group), mRNA 78 3e-11
44ref|NM_197674.1| Oryza sativa (japonica cultivar-group) putative... 78 3e-11
45dbj|AK058218.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
46ref|XM_473450.1| Oryza sativa (japonica cultivar-group), predic... 74 4e-10
47ref|NM_185320.1| Oryza sativa (japonica cultivar-group), mRNA 72 2e-09
48gb|AF149815.1| Oryza sativa unknown gene 72 2e-09
49dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
50dbj|AP001129.1| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
51ref|NM_195931.1| Oryza sativa (japonica cultivar-group) putative... 70 7e-09
52gb|AC123594.1| Oryza sativa (japonica cultivar-group) chromosome... 70 7e-09
53dbj|AK062848.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 7e-09
54gb|AY106116.1| Zea mays PCO091367 mRNA sequence 70 7e-09
55ref|XM_469576.1| Oryza sativa (japonica cultivar-group), mRNA 66 1e-07
56ref|XM_473863.1| Oryza sativa (japonica cultivar-group), predic... 66 1e-07
57ref|XM_473862.1| Oryza sativa (japonica cultivar-group), predic... 66 1e-07
58gb|AC147426.2| Oryza sativa chromosome 3 B1377B10 genomic seque... 66 1e-07
59emb|AL731610.4|OSJN00255 Oryza sativa genomic DNA, chromosome 4,... 66 1e-07
60gb|AC091532.13| Oryza sativa chromosome 3 BAC OSJNBa0078A17 geno... 66 1e-07
61dbj|AK062781.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
62dbj|AK062295.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
63ref|NM_197670.1| Oryza sativa (japonica cultivar-group) putative... 62 2e-06
64dbj|AK107851.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
65gb|AY105149.1| Zea mays PCO087109 mRNA sequence 60 7e-06
66dbj|AP003523.3| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
67dbj|AK103715.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
68dbj|AK063037.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
69gb|AF026382.1| Fragaria x ananassa HyPRP mRNA, complete cds 52 0.002
70gb|AY530533.1| Fragaria x ananassa cultivar Chandler HyPRP gene,... 52 0.002
71dbj|AB018588.1| Zea mays ZmGR1b mRNA, complete cds 52 0.002
72dbj|AB018587.1| Zea mays ZmGR1a mRNA, complete cds 52 0.002
73ref|NM_195927.1| Oryza sativa (japonica cultivar-group) putative... 50 0.006
74ref|XM_474092.1| Oryza sativa (japonica cultivar-group), predic... 48 0.026
75ref|NM_185028.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.026
76gb|AC108906.9| Oryza sativa chromosome 3 BAC OSJNBa0087C10 genom... 48 0.026
77gb|AC104321.7| Oryza sativa chromosome 3 BAC OSJNBa0052F07 genom... 48 0.026
78dbj|AK105903.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.026
79dbj|AK105778.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.026
80dbj|AK104623.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.026
81dbj|AK071989.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.026
82dbj|AK061322.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.026
83emb|AL732331.2| Oryza sativa genomic DNA, chromosome 4, BAC clon... 48 0.026
84emb|AL606454.3|OSJN00009 Oryza sativa genomic DNA, chromosome 4,... 48 0.026
85ref|NM_195930.1| Oryza sativa (japonica cultivar-group) putative... 44 0.40
86ref|NM_195926.1| Oryza sativa (japonica cultivar-group) putative... 44 0.40
87gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 44 0.40
88gb|AC073903.8| Homo sapiens BAC clone RP11-564F5 from 7, complet... 44 0.40
89gb|AC146161.2| Pan troglodytes BAC clone RP43-1G6 from 7, comple... 44 0.40
90gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome 44 0.40
91emb|BX537260.8| Zebrafish DNA sequence from clone DKEY-234J21 in... 44 0.40
92gb|AE004524.1| Pseudomonas aeruginosa PAO1, section 85 of 529 of... 44 0.40
93emb|Z93108.1|MAZ93108 M.acuminata mRNA; clone pBAN UU70 44 0.40
94dbj|AK108560.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.40
95gb|AF011922.1|AF011922 Pseudomonas aeruginosa aru gene cluster, ... 44 0.40
96gb|AC120159.9| Mus musculus chromosome 19, clone RP24-408B13, co... 42 1.6
97emb|AL021346.1|CEH37A05 Caenorhabditis elegans Fosmid H37A05, co... 42 1.6
98gb|AC157785.2| Mus musculus chromosome 19, clone RP24-272L14, co... 42 1.6
99ref|XM_776757.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 42 1.6
100emb|AL939128.1|SCO939128 Streptomyces coelicolor A3(2) complete ... 42 1.6
101emb|CR788320.11| Zebrafish DNA sequence from clone DKEY-217F16 i... 42 1.6
102emb|CR450720.5| Zebrafish DNA sequence from clone DKEYP-51F11 in... 42 1.6
103emb|BX640499.5| Zebrafish DNA sequence from clone DKEYP-67D2 in ... 42 1.6
104gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome 42 1.6
105emb|AL954696.17| Zebrafish DNA sequence from clone CH211-234K4, ... 42 1.6
106emb|BX569781.7| Zebrafish DNA sequence from clone DKEY-72L18 in ... 42 1.6
107gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 42 1.6
108emb|BX088690.9| Zebrafish DNA sequence from clone CH211-211A20 i... 42 1.6
109emb|AL929193.19| Zebrafish DNA sequence from clone CH211-274P24 ... 42 1.6
110emb|CR788229.7| Zebrafish DNA sequence from clone DKEY-261F4 in ... 42 1.6
111emb|AL772356.2| Zebrafish DNA sequence from clone BUSM1-258D18 i... 42 1.6
112gb|AY105889.1| Zea mays PCO106909 mRNA sequence 42 1.6
113gb|AE000782.1| Archaeoglobus fulgidus DSM 4304, complete genome 42 1.6
114gb|U73214.1|TAU73214 Triticum aestivum cold acclimation protein ... 42 1.6
115gb|CP000108.1| Chlorobium chlorochromatii CaD3, complete genome 40 6.2
116ref|NM_194119.1| Oryza sativa (japonica cultivar-group), mRNA 40 6.2
117gb|AC134511.2| Homo sapiens 12 BAC RP11-528M24 (Roswell Park Can... 40 6.2
118gb|AC122022.4| Mus musculus BAC clone RP24-372J5 from chromosome... 40 6.2
119gb|AC126010.13| Medicago truncatula clone mth2-20e4, complete se... 40 6.2
120emb|CR854992.5| Zebrafish DNA sequence from clone DKEYP-30C3 in ... 40 6.2
121emb|X81885.2|SFTYLORF Streptomyces fradiae tylMIII(orf1*), tylMI... 40 6.2
122emb|CR555306.1| Azoarcus sp. EbN1 complete genome 40 6.2
123emb|CR380953.1| Candida glabrata strain CBS138 chromosome G comp... 40 6.2
124emb|BX927152.1| Corynebacterium glutamicum ATCC 13032, IS finger... 40 6.2
125gb|AE016828.2| Coxiella burnetii RSA 493, complete genome 40 6.2
126emb|BX569691.1| Synechococcus sp. WH8102 complete genome; segmen... 40 6.2
127gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 6.2
128gb|AC108043.3| Homo sapiens BAC clone RP11-270L13 from 4, comple... 40 6.2
129gb|AC073427.7| Homo sapiens BAC clone RP11-746K19 from 4, comple... 40 6.2
130gb|AC006549.28| Homo sapiens chromosome 22 clone p215k21 map 22q... 40 6.2
131gb|AC000097.1| Homo sapiens Chromosome 22q11.2 PAC Clone p201m18... 40 6.2
132gb|AC006547.9| Homo sapiens chromosome 22 clone p158l19 map 22q1... 40 6.2
133gb|AC058790.14| Homo sapiens chromosome 22 clone b518b9 map 22q1... 40 6.2
134gb|AC007663.29| Homo sapiens chromosome 22 clone b444p24 map 22q... 40 6.2
135dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.2
136dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.2
137dbj|BA000036.3| Corynebacterium glutamicum ATCC 13032 DNA, compl... 40 6.2
138dbj|AP003328.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.2
139gb|AF235504.1|AF235504 Streptomyces hygroscopicus var. ascomycet... 40 6.2
140gb|AF263912.1|AF263912 Streptomyces noursei ATCC 11455 nystatin ... 40 6.2
141dbj|AP003874.5| Oryza sativa (japonica cultivar-group) genomic D... 40 6.2
142dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome 40 6.2
143dbj|AP002843.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.2
144dbj|AP005244.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.2
145emb|BX572098.1| Prochlorococcus marinus MIT9313 complete genome;... 40 6.2
146gb|AC117614.12| Mus musculus chromosome 5, clone RP23-110C17, co... 40 6.2
147gb|U34333.1|PVU34333 Phaseolus vulgaris proline-rich 14 kDa prot... 40 6.2
148emb|BX000489.8| Zebrafish DNA sequence from clone CH211-215E19, ... 40 6.2

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  184 bits (93), Expect = 2e-43
 Identities = 186/217 (85%)
 Strand = Plus / Minus

                                                                          
Query: 245    ggcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcga 304
              |||||||||||| || ||||||  |||||  ||| | |||||| ||||| | ||| ||||
Sbjct: 187235 ggcaggtgaagtcggaggggcaggtcttgtggcagtagttgagaaggagagagagatcga 187176

                                                                          
Query: 305    tggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacgg 364
               |||||  ||||| ||||||||||||||||||||| ||||||||||||||||||| ||||
Sbjct: 187175 cggggatgttgagattgatgccgaggatgttggccttgatggcggtgcagaggcagacgg 187116

                                                                          
Query: 365    cggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgctcgttggccggcacgc 424
              |||||||||||||| |||| || ||||| |  ||||||||||||||| |  |||||||||
Sbjct: 187115 cggcgtcgaggtcgacgaggccacccagcaacgggcagcactgctcgctctccggcacgc 187056

                                                   
Query: 425    caatcttaagcttcagcaggttcagcacgttgccgca 461
              | ||||| |||||||||||||| ||||||||| ||||
Sbjct: 187055 cgatcttcagcttcagcaggttgagcacgttggcgca 187019



 Score =  167 bits (84), Expect = 4e-38
 Identities = 156/180 (86%)
 Strand = Plus / Minus

                                                                          
Query: 282    gttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggccct 341
              |||||| ||||||  |||||||| |||||| ||||  ||||||||||||| ||||||| |
Sbjct: 189902 gttgaggaggaggacgaggtcgacggggacgttgatgttgatgccgaggacgttggcctt 189843

                                                                          
Query: 342    gatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggca 401
              |||||||||||||||||| |||||||||||||||||| ||||||| ||||| || |||||
Sbjct: 189842 gatggcggtgcagaggcagacggcggcgtcgaggtcgacgagcccccccagcagcgggca 189783

                                                                          
Query: 402    gcactgctcgttggccggcacgccaatcttaagcttcagcaggttcagcacgttgccgca 461
              ||||| |||| | |||||||| || | ||| ||||| |||||||| ||||||||| ||||
Sbjct: 189782 gcactcctcgctcgccggcacccccaccttgagcttgagcaggttgagcacgttggcgca 189723



 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Minus

                                                                          
Query: 289    aggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggccctgatggcg 348
              |||||| |||||| ||||||||  ||||| |||||||| ||||||||||| | || ||||
Sbjct: 198916 aggaggctgaggttgatggggaggttgaggttgatgccaaggatgttggcgcggagggcg 198857

                                                 
Query: 349    gtgcagaggcacacggcggcgtcgaggtcggcgag 383
              |||||||||||||||||||| || |||||||||||
Sbjct: 198856 gtgcagaggcacacggcggcctcaaggtcggcgag 198822



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                            
Query: 339      cctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgg 398
                ||||||||||| |||||||||| | |||||||||||||   |||| |  ||||| || ||
Sbjct: 28817161 cctgatggcggcgcagaggcacgccgcggcgtcgaggttcacgaggctccccagcagcgg 28817102

                                                             
Query: 399      gcagcactgctcgttggccggcacgccaatcttaagcttcagcag 443
                ||||||||||| | | |||||||||   ||||| |||||||||||
Sbjct: 28817101 gcagcactgctggctcgccggcacgttgatcttcagcttcagcag 28817057



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                    
Query: 348      ggtgcagaggcacacggcggcgtcgaggtcggcgag 383
                |||||||||||| ||| |||||||||||||| ||||
Sbjct: 33114069 ggtgcagaggcagacgacggcgtcgaggtcgacgag 33114104



to top

>gb|AY466108.1| Oryza sativa (japonica cultivar-group) lipid transfer protein-like
           protein (LTP1) mRNA, complete cds
          Length = 772

 Score =  184 bits (93), Expect = 2e-43
 Identities = 186/217 (85%)
 Strand = Plus / Minus

                                                                       
Query: 245 ggcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcga 304
           |||||||||||| || ||||||  |||||  ||| | |||||| ||||| | ||| ||||
Sbjct: 529 ggcaggtgaagtcggaggggcaggtcttgtggcagtagttgagaaggagagagagatcga 470

                                                                       
Query: 305 tggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacgg 364
            |||||  ||||| ||||||||||||||||||||| ||||||||||||||||||| ||||
Sbjct: 469 cggggatgttgagattgatgccgaggatgttggccttgatggcggtgcagaggcagacgg 410

                                                                       
Query: 365 cggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgctcgttggccggcacgc 424
           |||||||||||||| |||| || ||||| |  ||||||||||||||| |  |||||||||
Sbjct: 409 cggcgtcgaggtcgacgaggccacccagcaacgggcagcactgctcgctctccggcacgc 350

                                                
Query: 425 caatcttaagcttcagcaggttcagcacgttgccgca 461
           | ||||| |||||||||||||| ||||||||| ||||
Sbjct: 349 cgatcttcagcttcagcaggttgagcacgttggcgca 313



to top

>gb|AC118673.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBb0080O10, from chromosome 3, complete sequence
          Length = 127917

 Score =  184 bits (93), Expect = 2e-43
 Identities = 186/217 (85%)
 Strand = Plus / Minus

                                                                         
Query: 245   ggcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcga 304
             |||||||||||| || ||||||  |||||  ||| | |||||| ||||| | ||| ||||
Sbjct: 24302 ggcaggtgaagtcggaggggcaggtcttgtggcagtagttgagaaggagagagagatcga 24243

                                                                         
Query: 305   tggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacgg 364
              |||||  ||||| ||||||||||||||||||||| ||||||||||||||||||| ||||
Sbjct: 24242 cggggatgttgagattgatgccgaggatgttggccttgatggcggtgcagaggcagacgg 24183

                                                                         
Query: 365   cggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgctcgttggccggcacgc 424
             |||||||||||||| |||| || ||||| |  ||||||||||||||| |  |||||||||
Sbjct: 24182 cggcgtcgaggtcgacgaggccacccagcaacgggcagcactgctcgctctccggcacgc 24123

                                                  
Query: 425   caatcttaagcttcagcaggttcagcacgttgccgca 461
             | ||||| |||||||||||||| ||||||||| ||||
Sbjct: 24122 cgatcttcagcttcagcaggttgagcacgttggcgca 24086



 Score =  167 bits (84), Expect = 4e-38
 Identities = 156/180 (86%)
 Strand = Plus / Minus

                                                                         
Query: 282   gttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggccct 341
             |||||| ||||||  |||||||| |||||| ||||  ||||||||||||| ||||||| |
Sbjct: 26969 gttgaggaggaggacgaggtcgacggggacgttgatgttgatgccgaggacgttggcctt 26910

                                                                         
Query: 342   gatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggca 401
             |||||||||||||||||| |||||||||||||||||| ||||||| ||||| || |||||
Sbjct: 26909 gatggcggtgcagaggcagacggcggcgtcgaggtcgacgagcccccccagcagcgggca 26850

                                                                         
Query: 402   gcactgctcgttggccggcacgccaatcttaagcttcagcaggttcagcacgttgccgca 461
             ||||| |||| | |||||||| || | ||| ||||| |||||||| ||||||||| ||||
Sbjct: 26849 gcactcctcgctcgccggcacccccaccttgagcttgagcaggttgagcacgttggcgca 26790



 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Minus

                                                                         
Query: 289   aggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggccctgatggcg 348
             |||||| |||||| ||||||||  ||||| |||||||| ||||||||||| | || ||||
Sbjct: 35983 aggaggctgaggttgatggggaggttgaggttgatgccaaggatgttggcgcggagggcg 35924

                                                
Query: 349   gtgcagaggcacacggcggcgtcgaggtcggcgag 383
             |||||||||||||||||||| || |||||||||||
Sbjct: 35923 gtgcagaggcacacggcggcctcaaggtcggcgag 35889



to top

>gb|AC125411.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNAb0079B22, from chromosome 3, complete sequence
          Length = 156933

 Score =  184 bits (93), Expect = 2e-43
 Identities = 186/217 (85%)
 Strand = Plus / Minus

                                                                          
Query: 245    ggcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcga 304
              |||||||||||| || ||||||  |||||  ||| | |||||| ||||| | ||| ||||
Sbjct: 121235 ggcaggtgaagtcggaggggcaggtcttgtggcagtagttgagaaggagagagagatcga 121176

                                                                          
Query: 305    tggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacgg 364
               |||||  ||||| ||||||||||||||||||||| ||||||||||||||||||| ||||
Sbjct: 121175 cggggatgttgagattgatgccgaggatgttggccttgatggcggtgcagaggcagacgg 121116

                                                                          
Query: 365    cggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgctcgttggccggcacgc 424
              |||||||||||||| |||| || ||||| |  ||||||||||||||| |  |||||||||
Sbjct: 121115 cggcgtcgaggtcgacgaggccacccagcaacgggcagcactgctcgctctccggcacgc 121056

                                                   
Query: 425    caatcttaagcttcagcaggttcagcacgttgccgca 461
              | ||||| |||||||||||||| ||||||||| ||||
Sbjct: 121055 cgatcttcagcttcagcaggttgagcacgttggcgca 121019



 Score =  167 bits (84), Expect = 4e-38
 Identities = 156/180 (86%)
 Strand = Plus / Minus

                                                                          
Query: 282    gttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggccct 341
              |||||| ||||||  |||||||| |||||| ||||  ||||||||||||| ||||||| |
Sbjct: 123902 gttgaggaggaggacgaggtcgacggggacgttgatgttgatgccgaggacgttggcctt 123843

                                                                          
Query: 342    gatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggca 401
              |||||||||||||||||| |||||||||||||||||| ||||||| ||||| || |||||
Sbjct: 123842 gatggcggtgcagaggcagacggcggcgtcgaggtcgacgagcccccccagcagcgggca 123783

                                                                          
Query: 402    gcactgctcgttggccggcacgccaatcttaagcttcagcaggttcagcacgttgccgca 461
              ||||| |||| | |||||||| || | ||| ||||| |||||||| ||||||||| ||||
Sbjct: 123782 gcactcctcgctcgccggcacccccaccttgagcttgagcaggttgagcacgttggcgca 123723



 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Minus

                                                                          
Query: 289    aggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggccctgatggcg 348
              |||||| |||||| ||||||||  ||||| |||||||| ||||||||||| | || ||||
Sbjct: 132916 aggaggctgaggttgatggggaggttgaggttgatgccaaggatgttggcgcggagggcg 132857

                                                 
Query: 349    gtgcagaggcacacggcggcgtcgaggtcggcgag 383
              |||||||||||||||||||| || |||||||||||
Sbjct: 132856 gtgcagaggcacacggcggcctcaaggtcggcgag 132822



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3,
              complete sequence
          Length = 36192742

 Score =  184 bits (93), Expect = 2e-43
 Identities = 186/217 (85%)
 Strand = Plus / Minus

                                                                          
Query: 245    ggcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcga 304
              |||||||||||| || ||||||  |||||  ||| | |||||| ||||| | ||| ||||
Sbjct: 187235 ggcaggtgaagtcggaggggcaggtcttgtggcagtagttgagaaggagagagagatcga 187176

                                                                          
Query: 305    tggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacgg 364
               |||||  ||||| ||||||||||||||||||||| ||||||||||||||||||| ||||
Sbjct: 187175 cggggatgttgagattgatgccgaggatgttggccttgatggcggtgcagaggcagacgg 187116

                                                                          
Query: 365    cggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgctcgttggccggcacgc 424
              |||||||||||||| |||| || ||||| |  ||||||||||||||| |  |||||||||
Sbjct: 187115 cggcgtcgaggtcgacgaggccacccagcaacgggcagcactgctcgctctccggcacgc 187056

                                                   
Query: 425    caatcttaagcttcagcaggttcagcacgttgccgca 461
              | ||||| |||||||||||||| ||||||||| ||||
Sbjct: 187055 cgatcttcagcttcagcaggttgagcacgttggcgca 187019



 Score =  167 bits (84), Expect = 4e-38
 Identities = 156/180 (86%)
 Strand = Plus / Minus

                                                                          
Query: 282    gttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggccct 341
              |||||| ||||||  |||||||| |||||| ||||  ||||||||||||| ||||||| |
Sbjct: 189902 gttgaggaggaggacgaggtcgacggggacgttgatgttgatgccgaggacgttggcctt 189843

                                                                          
Query: 342    gatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggca 401
              |||||||||||||||||| |||||||||||||||||| ||||||| ||||| || |||||
Sbjct: 189842 gatggcggtgcagaggcagacggcggcgtcgaggtcgacgagcccccccagcagcgggca 189783

                                                                          
Query: 402    gcactgctcgttggccggcacgccaatcttaagcttcagcaggttcagcacgttgccgca 461
              ||||| |||| | |||||||| || | ||| ||||| |||||||| ||||||||| ||||
Sbjct: 189782 gcactcctcgctcgccggcacccccaccttgagcttgagcaggttgagcacgttggcgca 189723



 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Minus

                                                                          
Query: 289    aggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggccctgatggcg 348
              |||||| |||||| ||||||||  ||||| |||||||| ||||||||||| | || ||||
Sbjct: 198916 aggaggctgaggttgatggggaggttgaggttgatgccaaggatgttggcgcggagggcg 198857

                                                 
Query: 349    gtgcagaggcacacggcggcgtcgaggtcggcgag 383
              |||||||||||||||||||| || |||||||||||
Sbjct: 198856 gtgcagaggcacacggcggcctcaaggtcggcgag 198822



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                            
Query: 339      cctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgg 398
                ||||||||||| |||||||||| | |||||||||||||   |||| |  ||||| || ||
Sbjct: 28908485 cctgatggcggcgcagaggcacgccgcggcgtcgaggttcacgaggctccccagcagcgg 28908426

                                                             
Query: 399      gcagcactgctcgttggccggcacgccaatcttaagcttcagcag 443
                ||||||||||| | | |||||||||   ||||| |||||||||||
Sbjct: 28908425 gcagcactgctggctcgccggcacgttgatcttcagcttcagcag 28908381



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                    
Query: 348      ggtgcagaggcacacggcggcgtcgaggtcggcgag 383
                |||||||||||| ||| |||||||||||||| ||||
Sbjct: 33204579 ggtgcagaggcagacgacggcgtcgaggtcgacgag 33204614



to top

>gb|AF485811.1| Oryza sativa BAC OSJNa0049F05, complete sequence
          Length = 162241

 Score =  184 bits (93), Expect = 2e-43
 Identities = 186/217 (85%)
 Strand = Plus / Plus

                                                                         
Query: 245   ggcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcga 304
             |||||||||||| || ||||||  |||||  ||| | |||||| ||||| | ||| ||||
Sbjct: 75419 ggcaggtgaagtcggaggggcaggtcttgtggcagtagttgagaaggagagagagatcga 75478

                                                                         
Query: 305   tggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacgg 364
              |||||  ||||| ||||||||||||||||||||| ||||||||||||||||||| ||||
Sbjct: 75479 cggggatgttgagattgatgccgaggatgttggccttgatggcggtgcagaggcagacgg 75538

                                                                         
Query: 365   cggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgctcgttggccggcacgc 424
             |||||||||||||| |||| || ||||| |  ||||||||||||||| |  |||||||||
Sbjct: 75539 cggcgtcgaggtcgacgaggccacccagcaacgggcagcactgctcgctctccggcacgc 75598

                                                  
Query: 425   caatcttaagcttcagcaggttcagcacgttgccgca 461
             | ||||| |||||||||||||| ||||||||| ||||
Sbjct: 75599 cgatcttcagcttcagcaggttgagcacgttggcgca 75635



 Score =  167 bits (84), Expect = 4e-38
 Identities = 156/180 (86%)
 Strand = Plus / Plus

                                                                         
Query: 282   gttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggccct 341
             |||||| ||||||  |||||||| |||||| ||||  ||||||||||||| ||||||| |
Sbjct: 72752 gttgaggaggaggacgaggtcgacggggacgttgatgttgatgccgaggacgttggcctt 72811

                                                                         
Query: 342   gatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggca 401
             |||||||||||||||||| |||||||||||||||||| ||||||| ||||| || |||||
Sbjct: 72812 gatggcggtgcagaggcagacggcggcgtcgaggtcgacgagcccccccagcagcgggca 72871

                                                                         
Query: 402   gcactgctcgttggccggcacgccaatcttaagcttcagcaggttcagcacgttgccgca 461
             ||||| |||| | |||||||| || | ||| ||||| |||||||| ||||||||| ||||
Sbjct: 72872 gcactcctcgctcgccggcacccccaccttgagcttgagcaggttgagcacgttggcgca 72931



 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                         
Query: 289   aggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggccctgatggcg 348
             |||||| |||||| ||||||||  ||||| |||||||| ||||||||||| | || ||||
Sbjct: 63740 aggaggctgaggttgatggggaggttgaggttgatgccaaggatgttggcgcggagggcg 63799

                                                
Query: 349   gtgcagaggcacacggcggcgtcgaggtcggcgag 383
             |||||||||||||||||||| || |||||||||||
Sbjct: 63800 gtgcagaggcacacggcggcctcaaggtcggcgag 63834



to top

>dbj|AK103618.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033133L09, full
           insert sequence
          Length = 780

 Score =  184 bits (93), Expect = 2e-43
 Identities = 186/217 (85%)
 Strand = Plus / Minus

                                                                       
Query: 245 ggcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcga 304
           |||||||||||| || ||||||  |||||  ||| | |||||| ||||| | ||| ||||
Sbjct: 550 ggcaggtgaagtcggaggggcaggtcttgtggcagtagttgagaaggagagagagatcga 491

                                                                       
Query: 305 tggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacgg 364
            |||||  ||||| ||||||||||||||||||||| ||||||||||||||||||| ||||
Sbjct: 490 cggggatgttgagattgatgccgaggatgttggccttgatggcggtgcagaggcagacgg 431

                                                                       
Query: 365 cggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgctcgttggccggcacgc 424
           |||||||||||||| |||| || ||||| |  ||||||||||||||| |  |||||||||
Sbjct: 430 cggcgtcgaggtcgacgaggccacccagcaacgggcagcactgctcgctctccggcacgc 371

                                                
Query: 425 caatcttaagcttcagcaggttcagcacgttgccgca 461
           | ||||| |||||||||||||| ||||||||| ||||
Sbjct: 370 cgatcttcagcttcagcaggttgagcacgttggcgca 334



to top

>dbj|AK062654.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-105-E10, full
           insert sequence
          Length = 736

 Score =  167 bits (84), Expect = 4e-38
 Identities = 156/180 (86%)
 Strand = Plus / Minus

                                                                       
Query: 282 gttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggccct 341
           |||||| ||||||  |||||||| |||||| ||||  ||||||||||||| ||||||| |
Sbjct: 474 gttgaggaggaggacgaggtcgacggggacgttgatgttgatgccgaggacgttggcctt 415

                                                                       
Query: 342 gatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggca 401
           |||||||||||||||||| |||||||||||||||||| ||||||| ||||| || |||||
Sbjct: 414 gatggcggtgcagaggcagacggcggcgtcgaggtcgacgagcccccccagcagcgggca 355

                                                                       
Query: 402 gcactgctcgttggccggcacgccaatcttaagcttcagcaggttcagcacgttgccgca 461
           ||||| |||| | |||||||| || | ||| ||||| |||||||| ||||||||| ||||
Sbjct: 354 gcactcctcgctcgccggcacccccaccttgagcttgagcaggttgagcacgttggcgca 295



to top

>gb|AY108363.1| Zea mays PCO069442 mRNA sequence
          Length = 837

 Score =  135 bits (68), Expect = 1e-28
 Identities = 131/152 (86%)
 Strand = Plus / Minus

                                                                       
Query: 261 ggggcacttcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagctt 320
           |||||| ||||||||||| | |||||| | |||| |||||||||||||||  || || ||
Sbjct: 448 ggggcagttcttgccgcagttgttgaggatgaggctgaggtcgatggggaggttaaggtt 389

                                                                       
Query: 321 gatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 380
           ||||||||||||||||||| ||| ||||||||||||||| |||||||| || |||||| |
Sbjct: 388 gatgccgaggatgttggccttgacggcggtgcagaggcagacggcggcctccaggtcgac 329

                                           
Query: 381 gagcccgcccaggagtgggcagcactgctcgt 412
           ||||||| |||| || | ||||||| ||||||
Sbjct: 328 gagcccgtccagcagcgagcagcacggctcgt 297



to top

>ref|NM_197681.1| Oryza sativa (japonica cultivar-group) putative lipid transfer
           protein (OSJNBa0015J15.6), mRNA
          Length = 399

 Score =  125 bits (63), Expect = 1e-25
 Identities = 102/115 (88%)
 Strand = Plus / Minus

                                                                       
Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
           |||||||||| | |||||| | |||| |||||||||||||||  |||||||||||||| |
Sbjct: 367 tcttgccgcagttgttgaggatgaggctgaggtcgatggggaggttgagcttgatgccca 308

                                                                  
Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383
           | | ||||||| ||||||||||||||||||| |||||||||||||||||| ||||
Sbjct: 307 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 253



to top

>gb|AC026758.8| Oryza sativa chromosome 10 BAC OSJNBa0015J15 genomic sequence, complete
             sequence
          Length = 144798

 Score =  125 bits (63), Expect = 1e-25
 Identities = 102/115 (88%)
 Strand = Plus / Minus

                                                                         
Query: 269   tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
             |||||||||| | |||||| | |||| |||||||||||||||  |||||||||||||| |
Sbjct: 27538 tcttgccgcagttgttgaggatgaggctgaggtcgatggggaggttgagcttgatgccca 27479

                                                                    
Query: 329   ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383
             | | ||||||| ||||||||||||||||||| |||||||||||||||||| ||||
Sbjct: 27478 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 27424



 Score =  117 bits (59), Expect = 3e-23
 Identities = 101/115 (87%)
 Strand = Plus / Minus

                                                                         
Query: 269   tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
             |||||||||| | |||||| | |||| |||||||||||||||  ||||| |||| |||||
Sbjct: 34252 tcttgccgcagttgttgaggatgaggctgaggtcgatggggatgttgaggttgaggccga 34193

                                                                    
Query: 329   ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383
             | | ||||||| ||||||||||||||||||| |||||||||||||||||| ||||
Sbjct: 34192 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 34138



 Score =  115 bits (58), Expect = 1e-22
 Identities = 121/142 (85%)
 Strand = Plus / Minus

                                                                         
Query: 246   gcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcgat 305
             ||||||||||| || ||||||  |||||||||||| |||||| | |||| | || |||| 
Sbjct: 50006 gcaggtgaagtcggaggggcagatcttgccgcacttgttgaggatgaggcttagatcgac 49947

                                                                         
Query: 306   ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 365
             || ||  ||||| || |||||||| | ||||||| ||| ||||||||||||||| |||||
Sbjct: 49946 ggcgaggttgagtttcatgccgagcacgttggccttgacggcggtgcagaggcagacggc 49887

                                   
Query: 366   ggcgtcgaggtcggcgagcccg 387
             ||||||||||||||||||||||
Sbjct: 49886 ggcgtcgaggtcggcgagcccg 49865



 Score =  109 bits (55), Expect = 8e-21
 Identities = 100/115 (86%)
 Strand = Plus / Minus

                                                                         
Query: 269   tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
             |||||||||| | |||||| | |||| ||||||||| |||||  | ||||||||||||||
Sbjct: 30806 tcttgccgcagttgttgaggatgaggctgaggtcgacggggaggtcgagcttgatgccga 30747

                                                                    
Query: 329   ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383
             | | ||||||| ||| ||||||||||||||| |||||||||||||||||| ||||
Sbjct: 30746 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcgacgag 30692



 Score =  101 bits (51), Expect = 2e-18
 Identities = 132/159 (83%)
 Strand = Plus / Minus

                                                                         
Query: 246   gcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcgat 305
             ||||||||||| || ||||||  |||||||||||| |||||| | |||  |||| |||| 
Sbjct: 66530 gcaggtgaagtcggaggggcaggtcttgccgcacttgttgaggatgagcttgagctcgac 66471

                                                                         
Query: 306   ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 365
             |||||| ||||| |||| |||||| | ||||||| | | ||||||||||||||| |||||
Sbjct: 66470 ggggacgttgaggttgacgccgagcacgttggccttcacggcggtgcagaggcagacggc 66411

                                                    
Query: 366   ggcgtcgaggtcggcgagcccgcccaggagtgggcagca 404
             |||||||  ||||||||| ||| | || || ||||||||
Sbjct: 66410 ggcgtcggcgtcggcgaggccggcgagcagcgggcagca 66372



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Minus

                                                                         
Query: 269   tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
             |||||| ||||| |||||| | |||| | || |||| ||||| ||| || |||||||| |
Sbjct: 54098 tcttgctgcacttgttgaggatgaggctcagatcgacggggagattcaggttgatgccca 54039

                                                                   
Query: 329   ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382
             | | ||||||| ||| ||||||||||||||| ||||||||||||||||||||||
Sbjct: 54038 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 53985



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 97/115 (84%), Gaps = 3/115 (2%)
 Strand = Plus / Minus

                                                                         
Query: 269   tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatg---c 325
             |||||||||| | |||||| | |||| |||| |||| |||||  ||||| ||||||   |
Sbjct: 62140 tcttgccgcagttgttgaggatgaggctgagatcgacggggatgttgaggttgatgatcc 62081

                                                                    
Query: 326   cgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 380
             | || | ||||||| ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 62080 caagaacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcggc 62026



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                         
Query: 276   gcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggatgtt 335
             ||||| |||||| | |||| | || |||| |||||  ||||| |||||||| || |  ||
Sbjct: 57384 gcacttgttgaggatgaggctcagatcgacggggaggttgaggttgatgcccagcacatt 57325

                                                            
Query: 336   ggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382
             |||| ||| ||||||||||||||| ||||||||||||||||||||||
Sbjct: 57324 ggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 57278



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                         
Query: 349   gtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgc 408
             ||||||||||||||||||||||| | ||||||||| ||| | |||||   ||||||||||
Sbjct: 69079 gtgcagaggcacacggcggcgtccacgtcggcgaggccggcgaggagcccgcagcactgc 69020

                
Query: 409   tcg 411
             |||
Sbjct: 69019 tcg 69017



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  125 bits (63), Expect = 1e-25
 Identities = 102/115 (88%)
 Strand = Plus / Plus

                                                                            
Query: 269      tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
                |||||||||| | |||||| | |||| |||||||||||||||  |||||||||||||| |
Sbjct: 21178168 tcttgccgcagttgttgaggatgaggctgaggtcgatggggaggttgagcttgatgccca 21178227

                                                                       
Query: 329      ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383
                | | ||||||| ||||||||||||||||||| |||||||||||||||||| ||||
Sbjct: 21178228 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 21178282



 Score =  117 bits (59), Expect = 3e-23
 Identities = 101/115 (87%)
 Strand = Plus / Plus

                                                                            
Query: 269      tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
                |||||||||| | |||||| | |||| |||||||||||||||  ||||| |||| |||||
Sbjct: 21171454 tcttgccgcagttgttgaggatgaggctgaggtcgatggggatgttgaggttgaggccga 21171513

                                                                       
Query: 329      ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383
                | | ||||||| ||||||||||||||||||| |||||||||||||||||| ||||
Sbjct: 21171514 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 21171568



 Score =  115 bits (58), Expect = 1e-22
 Identities = 121/142 (85%)
 Strand = Plus / Plus

                                                                            
Query: 246      gcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcgat 305
                ||||||||||| || ||||||  |||||||||||| |||||| | |||| | || |||| 
Sbjct: 21155700 gcaggtgaagtcggaggggcagatcttgccgcacttgttgaggatgaggcttagatcgac 21155759

                                                                            
Query: 306      ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 365
                || ||  ||||| || |||||||| | ||||||| ||| ||||||||||||||| |||||
Sbjct: 21155760 ggcgaggttgagtttcatgccgagcacgttggccttgacggcggtgcagaggcagacggc 21155819

                                      
Query: 366      ggcgtcgaggtcggcgagcccg 387
                ||||||||||||||||||||||
Sbjct: 21155820 ggcgtcgaggtcggcgagcccg 21155841



 Score =  109 bits (55), Expect = 8e-21
 Identities = 100/115 (86%)
 Strand = Plus / Plus

                                                                            
Query: 269      tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
                |||||||||| | |||||| | |||| ||||||||| |||||  | ||||||||||||||
Sbjct: 21174900 tcttgccgcagttgttgaggatgaggctgaggtcgacggggaggtcgagcttgatgccga 21174959

                                                                       
Query: 329      ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383
                | | ||||||| ||| ||||||||||||||| |||||||||||||||||| ||||
Sbjct: 21174960 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcgacgag 21175014



 Score =  101 bits (51), Expect = 2e-18
 Identities = 132/159 (83%)
 Strand = Plus / Plus

                                                                            
Query: 246      gcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcgat 305
                ||||||||||| || ||||||  |||||||||||| |||||| | |||  |||| |||| 
Sbjct: 21139176 gcaggtgaagtcggaggggcaggtcttgccgcacttgttgaggatgagcttgagctcgac 21139235

                                                                            
Query: 306      ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 365
                |||||| ||||| |||| |||||| | ||||||| | | ||||||||||||||| |||||
Sbjct: 21139236 ggggacgttgaggttgacgccgagcacgttggccttcacggcggtgcagaggcagacggc 21139295

                                                       
Query: 366      ggcgtcgaggtcggcgagcccgcccaggagtgggcagca 404
                |||||||  ||||||||| ||| | || || ||||||||
Sbjct: 21139296 ggcgtcggcgtcggcgaggccggcgagcagcgggcagca 21139334



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Plus

                                                                            
Query: 269      tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
                |||||| ||||| |||||| | |||| | || |||| ||||| ||| || |||||||| |
Sbjct: 21151608 tcttgctgcacttgttgaggatgaggctcagatcgacggggagattcaggttgatgccca 21151667

                                                                      
Query: 329      ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382
                | | ||||||| ||| ||||||||||||||| ||||||||||||||||||||||
Sbjct: 21151668 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 21151721



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 97/115 (84%), Gaps = 3/115 (2%)
 Strand = Plus / Plus

                                                                            
Query: 269      tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatg---c 325
                |||||||||| | |||||| | |||| |||| |||| |||||  ||||| ||||||   |
Sbjct: 21143566 tcttgccgcagttgttgaggatgaggctgagatcgacggggatgttgaggttgatgatcc 21143625

                                                                       
Query: 326      cgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 380
                | || | ||||||| ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 21143626 caagaacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcggc 21143680



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Plus

                                                                            
Query: 276      gcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggatgtt 335
                ||||| |||||| | |||| | || |||| |||||  ||||| |||||||| || |  ||
Sbjct: 21148322 gcacttgttgaggatgaggctcagatcgacggggaggttgaggttgatgcccagcacatt 21148381

                                                               
Query: 336      ggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382
                |||| ||| ||||||||||||||| ||||||||||||||||||||||
Sbjct: 21148382 ggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 21148428



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                           
Query: 346      gcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggcagca 404
                |||||||||||||| ||||||||||||||||||||||  ||| |||| || ||||||||
Sbjct: 10072332 gcggtgcagaggcagacggcggcgtcgaggtcggcgataccggccagcagcgggcagca 10072390



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                            
Query: 349      gtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgc 408
                ||||||||||||||||||||||| | ||||||||| ||| | |||||   ||||||||||
Sbjct: 21136627 gtgcagaggcacacggcggcgtccacgtcggcgaggccggcgaggagcccgcagcactgc 21136686

                   
Query: 409      tcg 411
                |||
Sbjct: 21136687 tcg 21136689



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                            
Query: 322      atgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcg 381
                ||||| |||| ||||||| | | ||| ||||||||||| |||||||| ||||| ||||||
Sbjct: 10051276 atgccaaggacgttggccttcacggcagtgcagaggcagacggcggcatcgagatcggcg 10051335

                 
Query: 382      a 382
                |
Sbjct: 10051336 a 10051336



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                      
Query: 345      ggcggtgcagaggcacacggcggcgtcgaggtcggcga 382
                ||||||||||||||| ||||| |||||||  |||||||
Sbjct: 10063375 ggcggtgcagaggcagacggcagcgtcgatatcggcga 10063412



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                  
Query: 349      gtgcagaggcacacggcggcgtcgaggtcggcga 382
                ||||||||||| ||||| |||||||| |||||||
Sbjct: 10048162 gtgcagaggcagacggcagcgtcgagatcggcga 10048195



to top

>dbj|AK062381.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-102-B09, full
           insert sequence
          Length = 702

 Score =  125 bits (63), Expect = 1e-25
 Identities = 102/115 (88%)
 Strand = Plus / Minus

                                                                       
Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
           |||||||||| | |||||| | |||| |||||||||||||||  |||||||||||||| |
Sbjct: 436 tcttgccgcagttgttgaggatgaggctgaggtcgatggggaggttgagcttgatgccca 377

                                                                  
Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383
           | | ||||||| ||||||||||||||||||| |||||||||||||||||| ||||
Sbjct: 376 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 322



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  125 bits (63), Expect = 1e-25
 Identities = 102/115 (88%)
 Strand = Plus / Plus

                                                                            
Query: 269      tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
                |||||||||| | |||||| | |||| |||||||||||||||  |||||||||||||| |
Sbjct: 21189432 tcttgccgcagttgttgaggatgaggctgaggtcgatggggaggttgagcttgatgccca 21189491

                                                                       
Query: 329      ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383
                | | ||||||| ||||||||||||||||||| |||||||||||||||||| ||||
Sbjct: 21189492 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 21189546



 Score =  117 bits (59), Expect = 3e-23
 Identities = 101/115 (87%)
 Strand = Plus / Plus

                                                                            
Query: 269      tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
                |||||||||| | |||||| | |||| |||||||||||||||  ||||| |||| |||||
Sbjct: 21182718 tcttgccgcagttgttgaggatgaggctgaggtcgatggggatgttgaggttgaggccga 21182777

                                                                       
Query: 329      ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383
                | | ||||||| ||||||||||||||||||| |||||||||||||||||| ||||
Sbjct: 21182778 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 21182832



 Score =  115 bits (58), Expect = 1e-22
 Identities = 121/142 (85%)
 Strand = Plus / Plus

                                                                            
Query: 246      gcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcgat 305
                ||||||||||| || ||||||  |||||||||||| |||||| | |||| | || |||| 
Sbjct: 21166964 gcaggtgaagtcggaggggcagatcttgccgcacttgttgaggatgaggcttagatcgac 21167023

                                                                            
Query: 306      ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 365
                || ||  ||||| || |||||||| | ||||||| ||| ||||||||||||||| |||||
Sbjct: 21167024 ggcgaggttgagtttcatgccgagcacgttggccttgacggcggtgcagaggcagacggc 21167083

                                      
Query: 366      ggcgtcgaggtcggcgagcccg 387
                ||||||||||||||||||||||
Sbjct: 21167084 ggcgtcgaggtcggcgagcccg 21167105



 Score =  109 bits (55), Expect = 8e-21
 Identities = 100/115 (86%)
 Strand = Plus / Plus

                                                                            
Query: 269      tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
                |||||||||| | |||||| | |||| ||||||||| |||||  | ||||||||||||||
Sbjct: 21186164 tcttgccgcagttgttgaggatgaggctgaggtcgacggggaggtcgagcttgatgccga 21186223

                                                                       
Query: 329      ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383
                | | ||||||| ||| ||||||||||||||| |||||||||||||||||| ||||
Sbjct: 21186224 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcgacgag 21186278



 Score =  101 bits (51), Expect = 2e-18
 Identities = 132/159 (83%)
 Strand = Plus / Plus

                                                                            
Query: 246      gcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcgat 305
                ||||||||||| || ||||||  |||||||||||| |||||| | |||  |||| |||| 
Sbjct: 21150440 gcaggtgaagtcggaggggcaggtcttgccgcacttgttgaggatgagcttgagctcgac 21150499

                                                                            
Query: 306      ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 365
                |||||| ||||| |||| |||||| | ||||||| | | ||||||||||||||| |||||
Sbjct: 21150500 ggggacgttgaggttgacgccgagcacgttggccttcacggcggtgcagaggcagacggc 21150559

                                                       
Query: 366      ggcgtcgaggtcggcgagcccgcccaggagtgggcagca 404
                |||||||  ||||||||| ||| | || || ||||||||
Sbjct: 21150560 ggcgtcggcgtcggcgaggccggcgagcagcgggcagca 21150598



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Plus

                                                                            
Query: 269      tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
                |||||| ||||| |||||| | |||| | || |||| ||||| ||| || |||||||| |
Sbjct: 21162872 tcttgctgcacttgttgaggatgaggctcagatcgacggggagattcaggttgatgccca 21162931

                                                                      
Query: 329      ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382
                | | ||||||| ||| ||||||||||||||| ||||||||||||||||||||||
Sbjct: 21162932 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 21162985



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 97/115 (84%), Gaps = 3/115 (2%)
 Strand = Plus / Plus

                                                                            
Query: 269      tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatg---c 325
                |||||||||| | |||||| | |||| |||| |||| |||||  ||||| ||||||   |
Sbjct: 21154830 tcttgccgcagttgttgaggatgaggctgagatcgacggggatgttgaggttgatgatcc 21154889

                                                                       
Query: 326      cgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 380
                | || | ||||||| ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 21154890 caagaacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcggc 21154944



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Plus

                                                                            
Query: 276      gcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggatgtt 335
                ||||| |||||| | |||| | || |||| |||||  ||||| |||||||| || |  ||
Sbjct: 21159586 gcacttgttgaggatgaggctcagatcgacggggaggttgaggttgatgcccagcacatt 21159645

                                                               
Query: 336      ggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382
                |||| ||| ||||||||||||||| ||||||||||||||||||||||
Sbjct: 21159646 ggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 21159692



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                           
Query: 346      gcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggcagca 404
                |||||||||||||| ||||||||||||||||||||||  ||| |||| || ||||||||
Sbjct: 10078371 gcggtgcagaggcagacggcggcgtcgaggtcggcgataccggccagcagcgggcagca 10078429



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                            
Query: 349      gtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgc 408
                ||||||||||||||||||||||| | ||||||||| ||| | |||||   ||||||||||
Sbjct: 21147891 gtgcagaggcacacggcggcgtccacgtcggcgaggccggcgaggagcccgcagcactgc 21147950

                   
Query: 409      tcg 411
                |||
Sbjct: 21147951 tcg 21147953



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                            
Query: 322      atgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcg 381
                ||||| |||| ||||||| | | ||| ||||||||||| |||||||| ||||| ||||||
Sbjct: 10057315 atgccaaggacgttggccttcacggcagtgcagaggcagacggcggcatcgagatcggcg 10057374

                 
Query: 382      a 382
                |
Sbjct: 10057375 a 10057375



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                      
Query: 345      ggcggtgcagaggcacacggcggcgtcgaggtcggcga 382
                ||||||||||||||| ||||| |||||||  |||||||
Sbjct: 10069414 ggcggtgcagaggcagacggcagcgtcgatatcggcga 10069451



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                  
Query: 349      gtgcagaggcacacggcggcgtcgaggtcggcga 382
                ||||||||||| ||||| |||||||| |||||||
Sbjct: 10054201 gtgcagaggcagacggcagcgtcgagatcggcga 10054234



to top

>ref|XM_467170.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 833

 Score =  123 bits (62), Expect = 5e-25
 Identities = 122/142 (85%)
 Strand = Plus / Minus

                                                                       
Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
           |||||||||| | |||||| | |||| |||||||||||||||  ||||| ||||| ||||
Sbjct: 475 tcttgccgcagtagttgaggatgaggctgaggtcgatggggaggttgaggttgattccga 416

                                                                       
Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 388
           |||||||| |||||||||| |||||||||||||| || || ||||||||| |||||||  
Sbjct: 415 ggatgttgcccctgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccct 356

                                 
Query: 389 ccaggagtgggcagcactgctc 410
           |||| || ||||||||| ||||
Sbjct: 355 ccagcagcgggcagcacggctc 334



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  123 bits (62), Expect = 5e-25
 Identities = 122/142 (85%)
 Strand = Plus / Minus

                                                                            
Query: 269      tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
                |||||||||| | |||||| | |||| |||||||||||||||  ||||| ||||| ||||
Sbjct: 26823955 tcttgccgcagtagttgaggatgaggctgaggtcgatggggaggttgaggttgattccga 26823896

                                                                            
Query: 329      ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 388
                |||||||| |||||||||| |||||||||||||| || || ||||||||| |||||||  
Sbjct: 26823895 ggatgttgcccctgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccct 26823836

                                      
Query: 389      ccaggagtgggcagcactgctc 410
                |||| || ||||||||| ||||
Sbjct: 26823835 ccagcagcgggcagcacggctc 26823814



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 66/75 (88%)
 Strand = Plus / Minus

                                                                            
Query: 320      tgatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcgg 379
                |||||||||| | ||||||| |||||||||||||||| || |||||||| || |||||||
Sbjct: 26833519 tgatgccgagcacgttggccttgatggcggtgcagagacagacggcggcctcaaggtcgg 26833460

                               
Query: 380      cgagcccgcccagga 394
                |||| ||||| ||||
Sbjct: 26833459 cgaggccgccgagga 26833445



to top

>dbj|AP004037.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
            clone:OJ1001_D02
          Length = 129081

 Score =  123 bits (62), Expect = 5e-25
 Identities = 122/142 (85%)
 Strand = Plus / Minus

                                                                        
Query: 269  tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
            |||||||||| | |||||| | |||| |||||||||||||||  ||||| ||||| ||||
Sbjct: 2498 tcttgccgcagtagttgaggatgaggctgaggtcgatggggaggttgaggttgattccga 2439

                                                                        
Query: 329  ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 388
            |||||||| |||||||||| |||||||||||||| || || ||||||||| |||||||  
Sbjct: 2438 ggatgttgcccctgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccct 2379

                                  
Query: 389  ccaggagtgggcagcactgctc 410
            |||| || ||||||||| ||||
Sbjct: 2378 ccagcagcgggcagcacggctc 2357



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 66/75 (88%)
 Strand = Plus / Minus

                                                                         
Query: 320   tgatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcgg 379
             |||||||||| | ||||||| |||||||||||||||| || |||||||| || |||||||
Sbjct: 12062 tgatgccgagcacgttggccttgatggcggtgcagagacagacggcggcctcaaggtcgg 12003

                            
Query: 380   cgagcccgcccagga 394
             |||| ||||| ||||
Sbjct: 12002 cgaggccgccgagga 11988



to top

>dbj|AP004883.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0516F12
          Length = 146364

 Score =  123 bits (62), Expect = 5e-25
 Identities = 122/142 (85%)
 Strand = Plus / Minus

                                                                         
Query: 269   tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
             |||||||||| | |||||| | |||| |||||||||||||||  ||||| ||||| ||||
Sbjct: 90008 tcttgccgcagtagttgaggatgaggctgaggtcgatggggaggttgaggttgattccga 89949

                                                                         
Query: 329   ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 388
             |||||||| |||||||||| |||||||||||||| || || ||||||||| |||||||  
Sbjct: 89948 ggatgttgcccctgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccct 89889

                                   
Query: 389   ccaggagtgggcagcactgctc 410
             |||| || ||||||||| ||||
Sbjct: 89888 ccagcagcgggcagcacggctc 89867



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 66/75 (88%)
 Strand = Plus / Minus

                                                                         
Query: 320   tgatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcgg 379
             |||||||||| | ||||||| |||||||||||||||| || |||||||| || |||||||
Sbjct: 99572 tgatgccgagcacgttggccttgatggcggtgcagagacagacggcggcctcaaggtcgg 99513

                            
Query: 380   cgagcccgcccagga 394
             |||| ||||| ||||
Sbjct: 99512 cgaggccgccgagga 99498



to top

>dbj|AK109149.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-155-F07, full
           insert sequence
          Length = 833

 Score =  123 bits (62), Expect = 5e-25
 Identities = 122/142 (85%)
 Strand = Plus / Minus

                                                                       
Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
           |||||||||| | |||||| | |||| |||||||||||||||  ||||| ||||| ||||
Sbjct: 475 tcttgccgcagtagttgaggatgaggctgaggtcgatggggaggttgaggttgattccga 416

                                                                       
Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 388
           |||||||| |||||||||| |||||||||||||| || || ||||||||| |||||||  
Sbjct: 415 ggatgttgcccctgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccct 356

                                 
Query: 389 ccaggagtgggcagcactgctc 410
           |||| || ||||||||| ||||
Sbjct: 355 ccagcagcgggcagcacggctc 334



to top

>gb|L27208.1|RICRCC3 Oryza sativa root-specific RCc3 mRNA, complete cds
          Length = 715

 Score =  123 bits (62), Expect = 5e-25
 Identities = 122/142 (85%)
 Strand = Plus / Minus

                                                                       
Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
           |||||||||| | |||||| | |||| |||||||||||||||  ||||| ||||| ||||
Sbjct: 400 tcttgccgcagtagttgaggatgaggctgaggtcgatggggaggttgaggttgattccga 341

                                                                       
Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 388
           |||||||| |||||||||| |||||||||||||| || || ||||||||| |||||||  
Sbjct: 340 ggatgttgcccctgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccct 281

                                 
Query: 389 ccaggagtgggcagcactgctc 410
           |||| || ||||||||| ||||
Sbjct: 280 ccagcagcgggcagcacggctc 259



to top

>ref|NM_197679.1| Oryza sativa (japonica cultivar-group) putative lipid transfer
           protein (OSJNBa0015J15.8), mRNA
          Length = 402

 Score =  117 bits (59), Expect = 3e-23
 Identities = 101/115 (87%)
 Strand = Plus / Minus

                                                                       
Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
           |||||||||| | |||||| | |||| |||||||||||||||  ||||| |||| |||||
Sbjct: 373 tcttgccgcagttgttgaggatgaggctgaggtcgatggggatgttgaggttgaggccga 314

                                                                  
Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383
           | | ||||||| ||||||||||||||||||| |||||||||||||||||| ||||
Sbjct: 313 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 259



to top

>dbj|AK062911.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-108-G07, full
           insert sequence
          Length = 757

 Score =  117 bits (59), Expect = 3e-23
 Identities = 101/115 (87%)
 Strand = Plus / Minus

                                                                       
Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
           |||||||||| | |||||| | |||| |||||||||||||||  ||||| |||| |||||
Sbjct: 460 tcttgccgcagttgttgaggatgaggctgaggtcgatggggatgttgaggttgaggccga 401

                                                                  
Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383
           | | ||||||| ||||||||||||||||||| |||||||||||||||||| ||||
Sbjct: 400 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 346



to top

>ref|NM_197676.1| Oryza sativa (japonica cultivar-group) putative lipid transfer
           protein (OSJNBa0015J15.11), mRNA
          Length = 411

 Score =  115 bits (58), Expect = 1e-22
 Identities = 121/142 (85%)
 Strand = Plus / Minus

                                                                       
Query: 246 gcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcgat 305
           ||||||||||| || ||||||  |||||||||||| |||||| | |||| | || |||| 
Sbjct: 408 gcaggtgaagtcggaggggcagatcttgccgcacttgttgaggatgaggcttagatcgac 349

                                                                       
Query: 306 ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 365
           || ||  ||||| || |||||||| | ||||||| ||| ||||||||||||||| |||||
Sbjct: 348 ggcgaggttgagtttcatgccgagcacgttggccttgacggcggtgcagaggcagacggc 289

                                 
Query: 366 ggcgtcgaggtcggcgagcccg 387
           ||||||||||||||||||||||
Sbjct: 288 ggcgtcgaggtcggcgagcccg 267



to top

>gb|AY108411.1| Zea mays PCO134698 mRNA sequence
          Length = 667

 Score =  113 bits (57), Expect = 5e-22
 Identities = 117/137 (85%)
 Strand = Plus / Minus

                                                                       
Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
           |||||||||| | |||||| || |||||||| | || |||||| | ||| ||||||||||
Sbjct: 483 tcttgccgcagtagttgaggagcagggtgagcttgacggggacgtcgaggttgatgccga 424

                                                                       
Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 388
           | | ||||||| |||  |||||||||||||| |||||||| || ||||||||||||||| 
Sbjct: 423 gcacgttggccttgagcgcggtgcagaggcagacggcggcctctaggtcggcgagcccgt 364

                            
Query: 389 ccaggagtgggcagcac 405
           |||| ||||||||||||
Sbjct: 363 ccagcagtgggcagcac 347



to top

>ref|NM_197680.1| Oryza sativa (japonica cultivar-group) putative lipid transfer
           protein (OSJNBa0015J15.7), mRNA
          Length = 375

 Score =  109 bits (55), Expect = 8e-21
 Identities = 100/115 (86%)
 Strand = Plus / Minus

                                                                       
Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
           |||||||||| | |||||| | |||| ||||||||| |||||  | ||||||||||||||
Sbjct: 343 tcttgccgcagttgttgaggatgaggctgaggtcgacggggaggtcgagcttgatgccga 284

                                                                  
Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383
           | | ||||||| ||| ||||||||||||||| |||||||||||||||||| ||||
Sbjct: 283 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcgacgag 229



to top

>dbj|AK063090.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-111-A12, full
           insert sequence
          Length = 627

 Score =  109 bits (55), Expect = 8e-21
 Identities = 100/115 (86%)
 Strand = Plus / Minus

                                                                       
Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
           |||||||||| | |||||| | |||| ||||||||| |||||  | ||||||||||||||
Sbjct: 428 tcttgccgcagttgttgaggatgaggctgaggtcgacggggaggtcgagcttgatgccga 369

                                                                  
Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383
           | | ||||||| ||| ||||||||||||||| |||||||||||||||||| ||||
Sbjct: 368 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcgacgag 314



to top

>ref|XM_473448.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 393

 Score =  105 bits (53), Expect = 1e-19
 Identities = 119/141 (84%)
 Strand = Plus / Minus

                                                                       
Query: 270 cttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgag 329
           ||||||||| | |||||| | |||| ||||||||| |||||  ||||| |||||||||||
Sbjct: 366 cttgccgcagtagttgaggatgaggctgaggtcgacggggaggttgaggttgatgccgag 307

                                                                       
Query: 330 gatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcc 389
           ||||||| | |||||||| ||||||||||| || || || ||||||||| |||||||  |
Sbjct: 306 gatgttgcctctgatggccgtgcagaggcataccgccgcctcgaggtcgacgagcccctc 247

                                
Query: 390 caggagtgggcagcactgctc 410
           ||| || ||||||||| ||||
Sbjct: 246 cagcagcgggcagcacggctc 226



to top

>gb|AY466109.1| Oryza sativa (japonica cultivar-group) lipid transfer protein-like
           protein (LTP2) mRNA, complete cds
          Length = 758

 Score =  105 bits (53), Expect = 1e-19
 Identities = 119/141 (84%)
 Strand = Plus / Minus

                                                                       
Query: 270 cttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgag 329
           ||||||||| | |||||| | |||| ||||||||| |||||  ||||| |||||||||||
Sbjct: 441 cttgccgcagtagttgaggatgaggctgaggtcgacggggaggttgaggttgatgccgag 382

                                                                       
Query: 330 gatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcc 389
           ||||||| | |||||||| ||||||||||| || || || ||||||||| |||||||  |
Sbjct: 381 gatgttgcctctgatggccgtgcagaggcataccgccgcctcgaggtcgacgagcccctc 322

                                
Query: 390 caggagtgggcagcactgctc 410
           ||| || ||||||||| ||||
Sbjct: 321 cagcagcgggcagcacggctc 301



to top

>emb|AL606633.3|OSJN00060 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0010H02,
              complete sequence
          Length = 173522

 Score =  105 bits (53), Expect = 1e-19
 Identities = 119/141 (84%)
 Strand = Plus / Minus

                                                                          
Query: 270    cttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgag 329
              ||||||||| | |||||| | |||| ||||||||| |||||  ||||| |||||||||||
Sbjct: 144413 cttgccgcagtagttgaggatgaggctgaggtcgacggggaggttgaggttgatgccgag 144354

                                                                          
Query: 330    gatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcc 389
              ||||||| | |||||||| ||||||||||| || || || ||||||||| |||||||  |
Sbjct: 144353 gatgttgcctctgatggccgtgcagaggcataccgccgcctcgaggtcgacgagcccctc 144294

                                   
Query: 390    caggagtgggcagcactgctc 410
              ||| || ||||||||| ||||
Sbjct: 144293 cagcagcgggcagcacggctc 144273



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                          
Query: 270    cttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgag 329
              ||||||||| | |||||| | |||| ||||||||| |||||  || || |||||||||||
Sbjct: 147613 cttgccgcagtagttgaggatgaggctgaggtcgacggggaggttaaggttgatgccgag 147554

                                                                          
Query: 330    gatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcc 389
               |||||| || ||||||| |||||||||||||| || || ||||||||| |||||||  |
Sbjct: 147553 aatgttgcccttgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccctc 147494

                                   
Query: 390    caggagtgggcagcactgctc 410
              ||| || ||||||||| ||||
Sbjct: 147493 cagcagcgggcagcacggctc 147473



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                          
Query: 324    gccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383
              |||||| | ||||||| ||||||| ||||||||||| |||||||| ||||||||||||||
Sbjct: 157691 gccgagcacgttggccttgatggccgtgcagaggcagacggcggcctcgaggtcggcgag 157632

                   
Query: 384    cccgc 388
               ||||
Sbjct: 157631 gccgc 157627



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  105 bits (53), Expect = 1e-19
 Identities = 119/141 (84%)
 Strand = Plus / Minus

                                                                            
Query: 270      cttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgag 329
                ||||||||| | |||||| | |||| ||||||||| |||||  ||||| |||||||||||
Sbjct: 27713787 cttgccgcagtagttgaggatgaggctgaggtcgacggggaggttgaggttgatgccgag 27713728

                                                                            
Query: 330      gatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcc 389
                ||||||| | |||||||| ||||||||||| || || || ||||||||| |||||||  |
Sbjct: 27713727 gatgttgcctctgatggccgtgcagaggcataccgccgcctcgaggtcgacgagcccctc 27713668

                                     
Query: 390      caggagtgggcagcactgctc 410
                ||| || ||||||||| ||||
Sbjct: 27713667 cagcagcgggcagcacggctc 27713647



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                            
Query: 270      cttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgag 329
                ||||||||| | |||||| | |||| ||||||||| |||||  || || |||||||||||
Sbjct: 27716987 cttgccgcagtagttgaggatgaggctgaggtcgacggggaggttaaggttgatgccgag 27716928

                                                                            
Query: 330      gatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcc 389
                 |||||| || ||||||| |||||||||||||| || || ||||||||| |||||||  |
Sbjct: 27716927 aatgttgcccttgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccctc 27716868

                                     
Query: 390      caggagtgggcagcactgctc 410
                ||| || ||||||||| ||||
Sbjct: 27716867 cagcagcgggcagcacggctc 27716847



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                            
Query: 324      gccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383
                |||||| | ||||||| ||||||| ||||||||||| |||||||| ||||||||||||||
Sbjct: 27727065 gccgagcacgttggccttgatggccgtgcagaggcagacggcggcctcgaggtcggcgag 27727006

                     
Query: 384      cccgc 388
                 ||||
Sbjct: 27727005 gccgc 27727001



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                                 
Query: 334      ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382
                |||||| ||||||||||||||||||| |  |||||||||||||||||||
Sbjct: 31096018 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 31095970



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                                 
Query: 334      ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382
                |||||| ||||||||||||||||||| |  |||||||||||||||||||
Sbjct: 31085599 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 31085551



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                    
Query: 334      ttggccctgatggcggtgcagaggcacacggcggcg 369
                |||||| |||||||||||||||||||  ||||||||
Sbjct: 32827227 ttggccttgatggcggtgcagaggcaggcggcggcg 32827262



to top

>ref|NM_197671.1| Oryza sativa (japonica cultivar-group) putative lipid transfer
           protein (OSJNBa0015J15.16), mRNA
          Length = 441

 Score =  101 bits (51), Expect = 2e-18
 Identities = 132/159 (83%)
 Strand = Plus / Minus

                                                                       
Query: 246 gcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcgat 305
           ||||||||||| || ||||||  |||||||||||| |||||| | |||  |||| |||| 
Sbjct: 438 gcaggtgaagtcggaggggcaggtcttgccgcacttgttgaggatgagcttgagctcgac 379

                                                                       
Query: 306 ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 365
           |||||| ||||| |||| |||||| | ||||||| | | ||||||||||||||| |||||
Sbjct: 378 ggggacgttgaggttgacgccgagcacgttggccttcacggcggtgcagaggcagacggc 319

                                                  
Query: 366 ggcgtcgaggtcggcgagcccgcccaggagtgggcagca 404
           |||||||  ||||||||| ||| | || || ||||||||
Sbjct: 318 ggcgtcggcgtcggcgaggccggcgagcagcgggcagca 280



to top

>gb|L27210.1|RICRCG2 Oryza sativa root-specific protein (RCg2) gene, complete cds
          Length = 2252

 Score =  101 bits (51), Expect = 2e-18
 Identities = 132/159 (83%)
 Strand = Plus / Minus

                                                                        
Query: 246  gcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcgat 305
            ||||||||||| || ||||||  |||||||||||| |||||| | |||  |||| |||| 
Sbjct: 2094 gcaggtgaagtcggaggggcaggtcttgccgcacttgttgaggatgagcttgagctcgac 2035

                                                                        
Query: 306  ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 365
            |||||| ||||| |||| |||||| | ||||||| | | ||||||||||||||| |||||
Sbjct: 2034 ggggacgttgaggttgacgccgagcacgttggccttcacggcggtgcagaggcagacggc 1975

                                                   
Query: 366  ggcgtcgaggtcggcgagcccgcccaggagtgggcagca 404
            |||||||  ||||||||| ||| | || || ||||||||
Sbjct: 1974 ggcgtcggcgtcggcgaggccggcgagcagcgggcagca 1936



to top

>gb|L27209.1|RICRCC2 Oryza sativa root-specific RCc2 mRNA, complete cds
          Length = 654

 Score =  101 bits (51), Expect = 2e-18
 Identities = 132/159 (83%)
 Strand = Plus / Minus

                                                                       
Query: 246 gcaggtgaagttggcggggcacttcttgccgcactggttgagtaggagggtgaggtcgat 305
           ||||||||||| || ||||||  |||||||||||| |||||| | |||  |||| |||| 
Sbjct: 482 gcaggtgaagtcggaggggcaggtcttgccgcacttgttgaggatgagcttgagctcgac 423

                                                                       
Query: 306 ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 365
           |||||| ||||| |||| |||||| | ||||||| | | ||||||||||||||| |||||
Sbjct: 422 ggggacgttgaggttgacgccgagcacgttggccttcacggcggtgcagaggcagacggc 363

                                                  
Query: 366 ggcgtcgaggtcggcgagcccgcccaggagtgggcagca 404
           |||||||  ||||||||| ||| | || || ||||||||
Sbjct: 362 ggcgtcggcgtcggcgaggccggcgagcagcgggcagca 324



to top

>ref|XM_473449.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 396

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 270 cttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgag 329
           ||||||||| | |||||| | |||| ||||||||| |||||  || || |||||||||||
Sbjct: 366 cttgccgcagtagttgaggatgaggctgaggtcgacggggaggttaaggttgatgccgag 307

                                                                       
Query: 330 gatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcc 389
            |||||| || ||||||| |||||||||||||| || || ||||||||| |||||||  |
Sbjct: 306 aatgttgcccttgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccctc 247

                                
Query: 390 caggagtgggcagcactgctc 410
           ||| || ||||||||| ||||
Sbjct: 246 cagcagcgggcagcacggctc 226



to top

>gb|AY105972.1| Zea mays PCO122221 mRNA sequence
          Length = 768

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
           |||||||||| |||||||| | |||| ||||||||| ||| |  ||||||||||| ||||
Sbjct: 445 tcttgccgcagtggttgaggatgaggctgaggtcgacgggcaggttgagcttgattccga 386

                                                                  
Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383
           |||  |   || |||||||||||||||||||||||||||| ||||||||| ||||
Sbjct: 385 ggacctctcccttgatggcggtgcagaggcacacggcggcctcgaggtcgacgag 331



to top

>ref|NM_197675.1| Oryza sativa (japonica cultivar-group) putative lipid transfer
           protein (OSJNBa0015J15.12), mRNA
          Length = 396

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Minus

                                                                       
Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccga 328
           |||||| ||||| |||||| | |||| | || |||| ||||| ||| || |||||||| |
Sbjct: 370 tcttgctgcacttgttgaggatgaggctcagatcgacggggagattcaggttgatgccca 311

                                                                 
Query: 329 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382
           | | ||||||| ||| ||||||||||||||| ||||||||||||||||||||||
Sbjct: 310 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 257



to top

>ref|NM_197672.1| Oryza sativa (japonica cultivar-group) putative lipid transfer
           protein (OSJNBa0015J15.15), mRNA
          Length = 429

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 97/115 (84%), Gaps = 3/115 (2%)
 Strand = Plus / Minus

                                                                       
Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatg---c 325
           |||||||||| | |||||| | |||| |||| |||| |||||  ||||| ||||||   |
Sbjct: 403 tcttgccgcagttgttgaggatgaggctgagatcgacggggatgttgaggttgatgatcc 344

                                                                  
Query: 326 cgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 380
           | || | ||||||| ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 343 caagaacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcggc 289



to top

>emb|Z12103.1|ZMDELINM Z.mays mRNA that delineates a novel subset of cortical cells
          Length = 594

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                    
Query: 321 gatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtc 377
           ||||||||||| ||||||| |||||||||||||||||||||  ||||||||||||||
Sbjct: 326 gatgccgaggacgttggccttgatggcggtgcagaggcacaatgcggcgtcgaggtc 270



to top

>dbj|AK102086.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033082M21, full
           insert sequence
          Length = 769

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 97/115 (84%), Gaps = 3/115 (2%)
 Strand = Plus / Minus

                                                                       
Query: 269 tcttgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatg---c 325
           |||||||||| | |||||| | |||| |||| |||| |||||  ||||| ||||||   |
Sbjct: 482 tcttgccgcagttgttgaggatgaggctgagatcgacggggatgttgaggttgatgatcc 423

                                                                  
Query: 326 cgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 380
           | || | ||||||| ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 422 caagaacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcggc 368



to top

>gb|AY104687.1| Zea mays PCO121733 mRNA sequence
          Length = 680

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                    
Query: 321 gatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtc 377
           ||||||||||| ||||||| |||||||||||||||||||||  ||||||||||||||
Sbjct: 388 gatgccgaggacgttggccttgatggcggtgcagaggcacaatgcggcgtcgaggtc 332



to top

>gb|AY105236.1| Zea mays PCO121732 mRNA sequence
          Length = 763

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 86/101 (85%)
 Strand = Plus / Minus

                                                                       
Query: 312 attgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtc 371
           |||||| | ||||||||||| ||||||| |||||||||||||||||||||  ||| | ||
Sbjct: 403 attgaggtggatgccgaggacgttggccttgatggcggtgcagaggcacagtgcgacatc 344

                                                    
Query: 372 gaggtcggcgagcccgcccaggagtgggcagcactgctcgt 412
           ||||||  | |||||  |||| ||||||||||| |||||||
Sbjct: 343 gaggtccaccagcccctccagcagtgggcagcattgctcgt 303



to top

>gb|AF001634.1|AF001634 Zea mays physical impedance induced protein (IIG1) mRNA, complete
           cds
          Length = 677

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                    
Query: 321 gatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtc 377
           ||||||||||| ||||||| |||||||||||||||||||||  ||||||||||||||
Sbjct: 401 gatgccgaggacgttggccttgatggcggtgcagaggcacaatgcggcgtcgaggtc 345



to top

>ref|XM_467171.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 757

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 66/75 (88%)
 Strand = Plus / Minus

                                                                       
Query: 320 tgatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcgg 379
           |||||||||| | ||||||| |||||||||||||||| || |||||||| || |||||||
Sbjct: 390 tgatgccgagcacgttggccttgatggcggtgcagagacagacggcggcctcaaggtcgg 331

                          
Query: 380 cgagcccgcccagga 394
           |||| ||||| ||||
Sbjct: 330 cgaggccgccgagga 316



to top

>ref|NM_197674.1| Oryza sativa (japonica cultivar-group) putative lipid transfer
           protein (OSJNBa0015J15.13), mRNA
          Length = 396

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 276 gcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggatgtt 335
           ||||| |||||| | |||| | || |||| |||||  ||||| |||||||| || |  ||
Sbjct: 363 gcacttgttgaggatgaggctcagatcgacggggaggttgaggttgatgcccagcacatt 304

                                                          
Query: 336 ggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382
           |||| ||| ||||||||||||||| ||||||||||||||||||||||
Sbjct: 303 ggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 257



to top

>dbj|AK058218.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-010-F04, full
           insert sequence
          Length = 757

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 66/75 (88%)
 Strand = Plus / Minus

                                                                       
Query: 320 tgatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcgg 379
           |||||||||| | ||||||| |||||||||||||||| || |||||||| || |||||||
Sbjct: 390 tgatgccgagcacgttggccttgatggcggtgcagagacagacggcggcctcaaggtcgg 331

                          
Query: 380 cgagcccgcccagga 394
           |||| ||||| ||||
Sbjct: 330 cgaggccgccgagga 316



to top

>ref|XM_473450.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 414

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 324 gccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383
           |||||| | ||||||| ||||||| ||||||||||| |||||||| ||||||||||||||
Sbjct: 330 gccgagcacgttggccttgatggccgtgcagaggcagacggcggcctcgaggtcggcgag 271

                
Query: 384 cccgc 388
            ||||
Sbjct: 270 gccgc 266



to top

>ref|NM_185320.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 903

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 90/108 (83%)
 Strand = Plus / Minus

                                                                       
Query: 273 gccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggat 332
           |||||| | |||||| ||||||| |||||||| |||||| | ||| |||| |||||| | 
Sbjct: 318 gccgcagtagttgaggaggagggagaggtcgacggggacgtcgaggttgaggccgagaag 259

                                                           
Query: 333 gttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 380
           ||||||  ||||||||  ||||| ||| ||||||||||| ||||||||
Sbjct: 258 gttggcgttgatggcgaggcagacgcagacggcggcgtccaggtcggc 211



to top

>gb|AF149815.1| Oryza sativa unknown gene
          Length = 1293

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 90/108 (83%)
 Strand = Plus / Minus

                                                                       
Query: 273 gccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggat 332
           |||||| | |||||| ||||||| |||||||| |||||| | ||| |||| |||||| | 
Sbjct: 160 gccgcagtagttgaggaggagggagaggtcgacggggacgtcgaggttgaggccgagaag 101

                                                           
Query: 333 gttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 380
           ||||||  ||||||||  ||||| ||| ||||||||||| ||||||||
Sbjct: 100 gttggcgttgatggcgaggcagacgcagacggcggcgtccaggtcggc 53



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
              complete sequence
          Length = 30731886

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 90/108 (83%)
 Strand = Plus / Minus

                                                                          
Query: 273    gccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggat 332
              |||||| | |||||| ||||||| |||||||| |||||| | ||| |||| |||||| | 
Sbjct: 343474 gccgcagtagttgaggaggagggagaggtcgacggggacgtcgaggttgaggccgagaag 343415

                                                              
Query: 333    gttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 380
              ||||||  ||||||||  ||||| ||| ||||||||||| ||||||||
Sbjct: 343414 gttggcgttgatggcgaggcagacgcagacggcggcgtccaggtcggc 343367



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                            
Query: 339      cctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgg 398
                |||||||| ||||||||||||||||||||| || || ||  |||||||  |||| || ||
Sbjct: 25844215 cctgatggtggtgcagaggcacacggcggcctccagctccacgagcccctccagcagcgg 25844156

                        
Query: 399      gcagcact 406
                ||||||||
Sbjct: 25844155 gcagcact 25844148



to top

>dbj|AP001129.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0644B06
          Length = 194509

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 90/108 (83%)
 Strand = Plus / Minus

                                                                         
Query: 273   gccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggat 332
             |||||| | |||||| ||||||| |||||||| |||||| | ||| |||| |||||| | 
Sbjct: 53427 gccgcagtagttgaggaggagggagaggtcgacggggacgtcgaggttgaggccgagaag 53368

                                                             
Query: 333   gttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 380
             ||||||  ||||||||  ||||| ||| ||||||||||| ||||||||
Sbjct: 53367 gttggcgttgatggcgaggcagacgcagacggcggcgtccaggtcggc 53320



to top

>ref|NM_195931.1| Oryza sativa (japonica cultivar-group) putative lipid tranfer
           protein (OSJNAb0078C13.15), mRNA
          Length = 381

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 346 gcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggcagca 404
           |||||||||||||| ||||||||||||||||||||||  ||| |||| || ||||||||
Sbjct: 275 gcggtgcagaggcagacggcggcgtcgaggtcggcgataccggccagcagcgggcagca 217



to top

>gb|AC123594.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone
             OSJNAb0078C13, complete sequence
          Length = 146538

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                        
Query: 346   gcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggcagca 404
             |||||||||||||| ||||||||||||||||||||||  ||| |||| || ||||||||
Sbjct: 89091 gcggtgcagaggcagacggcggcgtcgaggtcggcgataccggccagcagcgggcagca 89149



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                         
Query: 322   atgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcg 381
             ||||| |||| ||||||| | | ||| ||||||||||| |||||||| ||||| ||||||
Sbjct: 68035 atgccaaggacgttggccttcacggcagtgcagaggcagacggcggcatcgagatcggcg 68094

              
Query: 382   a 382
             |
Sbjct: 68095 a 68095



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 345   ggcggtgcagaggcacacggcggcgtcgaggtcggcga 382
             ||||||||||||||| ||||| |||||||  |||||||
Sbjct: 80134 ggcggtgcagaggcagacggcagcgtcgatatcggcga 80171



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 349   gtgcagaggcacacggcggcgtcgaggtcggcga 382
             ||||||||||| ||||| |||||||| |||||||
Sbjct: 64921 gtgcagaggcagacggcagcgtcgagatcggcga 64954



to top

>dbj|AK062848.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-107-H12, full
           insert sequence
          Length = 662

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 346 gcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggcagca 404
           |||||||||||||| ||||||||||||||||||||||  ||| |||| || ||||||||
Sbjct: 337 gcggtgcagaggcagacggcggcgtcgaggtcggcgataccggccagcagcgggcagca 279



to top

>gb|AY106116.1| Zea mays PCO091367 mRNA sequence
          Length = 842

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                       
Query: 272 tgccgcactggttgagtaggagggtgaggtcgatggggacattgagcttgatgccgagga 331
           ||||||| | |||||  |||||| |||||| |||||| |  ||||| |||||||| ||||
Sbjct: 539 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 480

                                          
Query: 332 tgttggccctgatggcggtgcagaggcacac 362
            ||||||||||| | ||||||||||||||||
Sbjct: 479 cgttggccctgaggacggtgcagaggcacac 449



to top

>ref|XM_469576.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 445

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                       
Query: 339 cctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgg 398
           ||||||||||| |||||||||| | |||||||||||||   |||| |  ||||| || ||
Sbjct: 343 cctgatggcggcgcagaggcacgccgcggcgtcgaggttcacgaggctccccagcagcgg 284

                                                        
Query: 399 gcagcactgctcgttggccggcacgccaatcttaagcttcagcag 443
           ||||||||||| | | |||||||||   ||||| |||||||||||
Sbjct: 283 gcagcactgctggctcgccggcacgttgatcttcagcttcagcag 239



to top

>ref|XM_473863.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 465

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 334 ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382
           |||||| ||||||||||||||||||| |  |||||||||||||||||||
Sbjct: 368 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 320



to top

>ref|XM_473862.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 609

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 334 ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382
           |||||| ||||||||||||||||||| |  |||||||||||||||||||
Sbjct: 494 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 446



to top

>gb|AC147426.2| Oryza sativa chromosome 3  B1377B10 genomic sequence, complete
           sequence
          Length = 184366

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                       
Query: 339 cctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgg 398
           ||||||||||| |||||||||| | |||||||||||||   |||| |  ||||| || ||
Sbjct: 456 cctgatggcggcgcagaggcacgccgcggcgtcgaggttcacgaggctccccagcagcgg 397

                                                        
Query: 399 gcagcactgctcgttggccggcacgccaatcttaagcttcagcag 443
           ||||||||||| | | |||||||||   ||||| |||||||||||
Sbjct: 396 gcagcactgctggctcgccggcacgttgatcttcagcttcagcag 352



to top

>emb|AL731610.4|OSJN00255 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0070C17,
             complete sequence
          Length = 160484

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                              
Query: 334   ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382
             |||||| ||||||||||||||||||| |  |||||||||||||||||||
Sbjct: 78099 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 78051



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                              
Query: 334   ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382
             |||||| ||||||||||||||||||| |  |||||||||||||||||||
Sbjct: 67680 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 67632



to top

>gb|AC091532.13| Oryza sativa chromosome 3 BAC OSJNBa0078A17 genomic sequence, complete
              sequence
          Length = 147344

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                          
Query: 339    cctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgg 398
              ||||||||||| |||||||||| | |||||||||||||   |||| |  ||||| || ||
Sbjct: 124142 cctgatggcggcgcagaggcacgccgcggcgtcgaggttcacgaggctccccagcagcgg 124083

                                                           
Query: 399    gcagcactgctcgttggccggcacgccaatcttaagcttcagcag 443
              ||||||||||| | | |||||||||   ||||| |||||||||||
Sbjct: 124082 gcagcactgctggctcgccggcacgttgatcttcagcttcagcag 124038



to top

>dbj|AK062781.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-107-B03, full
           insert sequence
          Length = 713

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 334 ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382
           |||||| ||||||||||||||||||| |  |||||||||||||||||||
Sbjct: 228 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 180



to top

>dbj|AK062295.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-100-F05, full
           insert sequence
          Length = 570

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 334 ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 382
           |||||| ||||||||||||||||||| |  |||||||||||||||||||
Sbjct: 144 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 96



to top

>ref|NM_197670.1| Oryza sativa (japonica cultivar-group) putative lipid transfer
           protein (OSJNBa0015J15.17), mRNA
          Length = 489

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                       
Query: 349 gtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgc 408
           ||||||||||||||||||||||| | ||||||||| ||| | |||||   ||||||||||
Sbjct: 371 gtgcagaggcacacggcggcgtccacgtcggcgaggccggcgaggagcccgcagcactgc 312

              
Query: 409 tcg 411
           |||
Sbjct: 311 tcg 309



to top

>dbj|AK107851.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-134-A09, full
           insert sequence
          Length = 764

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                       
Query: 349 gtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgggcagcactgc 408
           ||||||||||||||||||||||| | ||||||||| ||| | |||||   ||||||||||
Sbjct: 450 gtgcagaggcacacggcggcgtccacgtcggcgaggccggcgaggagcccgcagcactgc 391

              
Query: 409 tcg 411
           |||
Sbjct: 390 tcg 388



to top

>gb|AY105149.1| Zea mays PCO087109 mRNA sequence
          Length = 966

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 324 gccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcga 373
           |||||||| ||||||| ||||||| ||||||||||| |||||||| ||||
Sbjct: 494 gccgaggacgttggccttgatggccgtgcagaggcagacggcggcctcga 445



to top

>dbj|AP003523.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0416A11
          Length = 171519

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                          
Query: 339    cctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcccaggagtgg 398
              |||||||| ||||||||||||||||||||| || || ||  |||||||  |||| || ||
Sbjct: 126419 cctgatggtggtgcagaggcacacggcggcctccagctccacgagcccctccagcagcgg 126360

                      
Query: 399    gcagcact 406
              ||||||||
Sbjct: 126359 gcagcact 126352



to top

>dbj|AK103715.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033137N14, full
           insert sequence
          Length = 1338

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 339 cctgatggcggtgcagaggcacacggcggc 368
           |||||||| |||||||||||||||||||||
Sbjct: 760 cctgatggtggtgcagaggcacacggcggc 731



to top

>dbj|AK063037.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-110-D01, full
           insert sequence
          Length = 498

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 282 gttgagtaggagggtgaggtcgatggggacattgagcttgatgccgaggatgttggcc 339
           |||||| ||||||  |||||||| |||||| ||||  ||||||||||||| |||||||
Sbjct: 236 gttgaggaggaggacgaggtcgacggggacgttgatgttgatgccgaggacgttggcc 179



to top

>gb|AF026382.1| Fragaria x ananassa HyPRP mRNA, complete cds
          Length = 798

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 319 ttgatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcg 378
           ||||||||||| ||| |||| |||||||| ||||||||||| || || || ||||| |||
Sbjct: 463 ttgatgccgagaatgctggctctgatggcagtgcagaggcatacagcagcttcgagatcg 404

             
Query: 379 gc 380
           ||
Sbjct: 403 gc 402



to top

>gb|AY530533.1| Fragaria x ananassa cultivar Chandler HyPRP gene, complete cds
          Length = 2071

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                        
Query: 319  ttgatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcg 378
            ||||||||||| ||| |||| |||||||| ||||||||||| || || || ||||| |||
Sbjct: 1294 ttgatgccgagaatgctggctctgatggcagtgcagaggcatacagcagcttcgagatcg 1235

              
Query: 379  gc 380
            ||
Sbjct: 1234 gc 1233



to top

>dbj|AB018588.1| Zea mays ZmGR1b mRNA, complete cds
          Length = 813

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 324 gccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcga 373
           |||||| | ||||||| ||||||| ||||||||||| |||||||| ||||
Sbjct: 361 gccgagcacgttggccttgatggccgtgcagaggcagacggcggcctcga 312



to top

>dbj|AB018587.1| Zea mays ZmGR1a mRNA, complete cds
          Length = 833

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 324 gccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcga 373
           |||||| | ||||||| ||||||| ||||||||||| |||||||| ||||
Sbjct: 364 gccgagcacgttggccttgatggccgtgcagaggcagacggcggcctcga 315



to top

>ref|NM_195927.1| Oryza sativa (japonica cultivar-group) putative lipid tranfer
           protein (OSJNAb0078C13.11), mRNA
          Length = 414

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 atgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcg 381
           ||||| |||| ||||||| | | ||| ||||||||||| |||||||| ||||| ||||||
Sbjct: 335 atgccaaggacgttggccttcacggcagtgcagaggcagacggcggcatcgagatcggcg 276

            
Query: 382 a 382
           |
Sbjct: 275 a 275



to top

>ref|XM_474092.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 783

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 334 ttggccctgatggcggtgcagaggcacacggcggcg 369
           |||||| |||||||||||||||||||  ||||||||
Sbjct: 692 ttggccttgatggcggtgcagaggcaggcggcggcg 657



to top

>ref|NM_185028.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 459

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 348 ggtgcagaggcacacggcggcgtcgaggtcggcgag 383
           |||||||||||| ||| |||||||||||||| ||||
Sbjct: 225 ggtgcagaggcagacgacggcgtcgaggtcgacgag 190



to top

>gb|AC108906.9| Oryza sativa chromosome 3 BAC OSJNBa0087C10 genomic sequence, complete
              sequence
          Length = 144487

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                  
Query: 348    ggtgcagaggcacacggcggcgtcgaggtcggcgag 383
              |||||||||||| ||| |||||||||||||| ||||
Sbjct: 130486 ggtgcagaggcagacgacggcgtcgaggtcgacgag 130451



to top

>gb|AC104321.7| Oryza sativa chromosome 3 BAC OSJNBa0052F07 genomic sequence,
            complete sequence
          Length = 139823

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 348  ggtgcagaggcacacggcggcgtcgaggtcggcgag 383
            |||||||||||| ||| |||||||||||||| ||||
Sbjct: 9239 ggtgcagaggcagacgacggcgtcgaggtcgacgag 9204



to top

>dbj|AK105903.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-F11, full
           insert sequence
          Length = 1255

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 334 ttggccctgatggcggtgcagaggcacacggcggcg 369
           |||||| |||||||||||||||||||  ||||||||
Sbjct: 842 ttggccttgatggcggtgcagaggcaggcggcggcg 807



to top

>dbj|AK105778.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-202-F10, full
           insert sequence
          Length = 1242

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 334 ttggccctgatggcggtgcagaggcacacggcggcg 369
           |||||| |||||||||||||||||||  ||||||||
Sbjct: 842 ttggccttgatggcggtgcagaggcaggcggcggcg 807



to top

>dbj|AK104623.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-H11, full
           insert sequence
          Length = 1251

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 334 ttggccctgatggcggtgcagaggcacacggcggcg 369
           |||||| |||||||||||||||||||  ||||||||
Sbjct: 838 ttggccttgatggcggtgcagaggcaggcggcggcg 803



to top

>dbj|AK071989.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094H13, full
           insert sequence
          Length = 1272

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 334 ttggccctgatggcggtgcagaggcacacggcggcg 369
           |||||| |||||||||||||||||||  ||||||||
Sbjct: 846 ttggccttgatggcggtgcagaggcaggcggcggcg 811



to top

>dbj|AK061322.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-F03, full
           insert sequence
          Length = 1257

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 334 ttggccctgatggcggtgcagaggcacacggcggcg 369
           |||||| |||||||||||||||||||  ||||||||
Sbjct: 844 ttggccttgatggcggtgcagaggcaggcggcggcg 809



to top

>emb|AL732331.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0413E07, complete
             sequence
          Length = 76546

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                 
Query: 334   ttggccctgatggcggtgcagaggcacacggcggcg 369
             |||||| |||||||||||||||||||  ||||||||
Sbjct: 22462 ttggccttgatggcggtgcagaggcaggcggcggcg 22497



to top

>emb|AL606454.3|OSJN00009 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0033G05,
             complete sequence
          Length = 142556

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                 
Query: 334   ttggccctgatggcggtgcagaggcacacggcggcg 369
             |||||| |||||||||||||||||||  ||||||||
Sbjct: 89513 ttggccttgatggcggtgcagaggcaggcggcggcg 89548



to top

>ref|NM_195930.1| Oryza sativa (japonica cultivar-group) putative lipid tranfer
           protein (OSJNAb0078C13.14), mRNA
          Length = 393

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 345 ggcggtgcagaggcacacggcggcgtcgaggtcggcga 382
           ||||||||||||||| ||||| |||||||  |||||||
Sbjct: 291 ggcggtgcagaggcagacggcagcgtcgatatcggcga 254



to top

>ref|NM_195926.1| Oryza sativa (japonica cultivar-group) putative lipid transfer
           protein (OSJNAb0078C13.10), mRNA
          Length = 414

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 349 gtgcagaggcacacggcggcgtcgaggtcggcga 382
           ||||||||||| ||||| |||||||| |||||||
Sbjct: 308 gtgcagaggcagacggcagcgtcgagatcggcga 275



to top

>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 362     cggcggcgtcgaggtcggcgag 383
               ||||||||||||||||||||||
Sbjct: 2864055 cggcggcgtcgaggtcggcgag 2864034



to top

>gb|AC073903.8| Homo sapiens BAC clone RP11-564F5 from 7, complete sequence
          Length = 80531

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 55    ttttacaatatgcaaatcatgc 76
             ||||||||||||||||||||||
Sbjct: 23023 ttttacaatatgcaaatcatgc 23044



to top

>gb|AC146161.2| Pan troglodytes BAC clone RP43-1G6 from 7, complete sequence
          Length = 205885

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 55     ttttacaatatgcaaatcatgc 76
              ||||||||||||||||||||||
Sbjct: 154858 ttttacaatatgcaaatcatgc 154837



to top

>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 362     cggcggcgtcgaggtcggcgag 383
               ||||||||||||||||||||||
Sbjct: 3593634 cggcggcgtcgaggtcggcgag 3593613



to top

>emb|BX537260.8| Zebrafish DNA sequence from clone DKEY-234J21 in linkage group 1,
             complete sequence
          Length = 150038

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 119   aagcttataaagcatgcatgca 140
             ||||||||||||||||||||||
Sbjct: 36511 aagcttataaagcatgcatgca 36490



to top

>gb|AE004524.1| Pseudomonas aeruginosa PAO1, section 85 of 529 of the complete genome
          Length = 11749

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 361  acggcggcgtcgaggtcggcga 382
            ||||||||||||||||||||||
Sbjct: 4416 acggcggcgtcgaggtcggcga 4395



to top

>emb|Z93108.1|MAZ93108 M.acuminata mRNA; clone pBAN UU70
          Length = 785

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 336 ggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 383
           |||| |||| || | ||| |||||||||||||| ||||||||| ||||
Sbjct: 398 ggccntgatagcagngcaaaggcacacggcggcctcgaggtcgacgag 351



to top

>dbj|AK108560.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-145-A10, full
           insert sequence
          Length = 719

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 349 gtgcagaggcacacggcggcgtcgaggtcggcga 382
           ||||||||||| ||||| |||||||| |||||||
Sbjct: 389 gtgcagaggcagacggcagcgtcgagatcggcga 356



to top

>gb|AF011922.1|AF011922 Pseudomonas aeruginosa aru gene cluster, ArgR regulatory protein
            (argR), succinylornithine aminotransferase (aruC),
            arginine/ornithine succinyltransferase AI subunit (aruF),
            arginine/ornithine succinyltransferase AII subunit
            (aruG), succinylglutamate 5-semialdehyde dehydrogenase
            (aruD), succinylarginine dihydrolase (aruB),
            succinylglutamate desuccinylase (aruE) genes, complete
            cds; and alanine tRNA synthetase (alaS) gene, partial cds
          Length = 12949

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 361  acggcggcgtcgaggtcggcga 382
            ||||||||||||||||||||||
Sbjct: 7794 acggcggcgtcgaggtcggcga 7773



to top

>gb|AC120159.9| Mus musculus chromosome 19, clone RP24-408B13, complete sequence
          Length = 178918

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 43    gtatgtatatccttttacaat 63
             |||||||||||||||||||||
Sbjct: 23709 gtatgtatatccttttacaat 23729



to top

>emb|AL021346.1|CEH37A05 Caenorhabditis elegans Fosmid H37A05, complete sequence
          Length = 31226

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 218   aaatcgatggatagatggatc 238
             |||||||||||||||||||||
Sbjct: 20684 aaatcgatggatagatggatc 20664



to top

>gb|AC157785.2| Mus musculus chromosome 19, clone RP24-272L14, complete sequence
          Length = 159030

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 43    gtatgtatatccttttacaat 63
             |||||||||||||||||||||
Sbjct: 26425 gtatgtatatccttttacaat 26405



to top

>ref|XM_776757.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC576450 (LOC576450), mRNA
          Length = 907

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 320 tgatgccgaggatgttggccc 340
           |||||||||||||||||||||
Sbjct: 115 tgatgccgaggatgttggccc 95



to top

>emb|AL939128.1|SCO939128 Streptomyces coelicolor A3(2) complete genome; segment 25/29
          Length = 296500

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 361    acggcggcgtcgaggtcggcg 381
              |||||||||||||||||||||
Sbjct: 131502 acggcggcgtcgaggtcggcg 131482



to top

>emb|CR788320.11| Zebrafish DNA sequence from clone DKEY-217F16 in linkage group 13,
              complete sequence
          Length = 174497

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 120    agcttataaagcatgcatgca 140
              |||||||||||||||||||||
Sbjct: 118082 agcttataaagcatgcatgca 118062



to top

>emb|CR450720.5| Zebrafish DNA sequence from clone DKEYP-51F11 in linkage group 2,
             complete sequence
          Length = 200950

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 217   taaatcgatggatagatggat 237
             |||||||||||||||||||||
Sbjct: 80562 taaatcgatggatagatggat 80542



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 217   taaatcgatggatagatggat 237
             |||||||||||||||||||||
Sbjct: 80378 taaatcgatggatagatggat 80358



to top

>emb|BX640499.5| Zebrafish DNA sequence from clone DKEYP-67D2 in linkage group 9,
             complete sequence
          Length = 184606

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 120   agcttataaagcatgcatgca 140
             |||||||||||||||||||||
Sbjct: 55665 agcttataaagcatgcatgca 55685



to top

>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome
          Length = 3046682

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 402     gcactgctcgttggccggcac 422
               |||||||||||||||||||||
Sbjct: 2011419 gcactgctcgttggccggcac 2011439



to top

>emb|AL954696.17| Zebrafish DNA sequence from clone CH211-234K4, complete sequence
          Length = 149858

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 120   agcttataaagcatgcatgca 140
             |||||||||||||||||||||
Sbjct: 56466 agcttataaagcatgcatgca 56446



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 120   agcttataaagcatgcatgca 140
             |||||||||||||||||||||
Sbjct: 31135 agcttataaagcatgcatgca 31155



to top

>emb|BX569781.7| Zebrafish DNA sequence from clone DKEY-72L18 in linkage group 17,
              complete sequence
          Length = 170138

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 61     aatatgcaaatcatgcatttagata 85
              ||||||||||| |||||||||||||
Sbjct: 131136 aatatgcaaatgatgcatttagata 131160



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 362     cggcggcgtcgaggtcggcga 382
               |||||||||||||||||||||
Sbjct: 4768255 cggcggcgtcgaggtcggcga 4768235



to top

>emb|BX088690.9| Zebrafish DNA sequence from clone CH211-211A20 in linkage group 18,
             complete sequence
          Length = 218713

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 120   agcttataaagcatgcatgca 140
             |||||||||||||||||||||
Sbjct: 18784 agcttataaagcatgcatgca 18764



to top

>emb|AL929193.19| Zebrafish DNA sequence from clone CH211-274P24 in linkage group 20,
             complete sequence
          Length = 159094

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 120   agcttataaagcatgcatgca 140
             |||||||||||||||||||||
Sbjct: 67660 agcttataaagcatgcatgca 67640



to top

>emb|CR788229.7| Zebrafish DNA sequence from clone DKEY-261F4 in linkage group 18,
             complete sequence
          Length = 127565

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 120   agcttataaagcatgcatgca 140
             |||||||||||||||||||||
Sbjct: 22690 agcttataaagcatgcatgca 22670



to top

>emb|AL772356.2| Zebrafish DNA sequence from clone BUSM1-258D18 in linkage group 9,
            complete sequence
          Length = 80182

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 120  agcttataaagcatgcatgca 140
            |||||||||||||||||||||
Sbjct: 1681 agcttataaagcatgcatgca 1661



to top

>gb|AY105889.1| Zea mays PCO106909 mRNA sequence
          Length = 1420

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 341 tgatggcggtgcagaggcacacggc 365
           |||||| ||||||||||||||||||
Sbjct: 861 tgatggtggtgcagaggcacacggc 837



to top

>gb|AE000782.1| Archaeoglobus fulgidus DSM 4304, complete genome
          Length = 2178400

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 434     gcttcagcaggttcagcacgt 454
               |||||||||||||||||||||
Sbjct: 1711084 gcttcagcaggttcagcacgt 1711064



to top

>gb|U73214.1|TAU73214 Triticum aestivum cold acclimation protein WCOR518 (Wcor518) mRNA,
           parial cds
          Length = 1168

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 341 tgatggcggtgcagaggcacacggcggcgtcgaggtc 377
           |||||| |||||||||||| |  ||||||||||||||
Sbjct: 845 tgatggtggtgcagaggcagagcgcggcgtcgaggtc 809



to top

>gb|CP000108.1| Chlorobium chlorochromatii CaD3, complete genome
          Length = 2572079

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 310    acattgagcttgatgccgaggatg 333
              ||||||||||||||||||| ||||
Sbjct: 185925 acattgagcttgatgccgatgatg 185902



to top

>ref|NM_194119.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 369

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 362 cggcggcgtcgaggtcggcg 381
           ||||||||||||||||||||
Sbjct: 316 cggcggcgtcgaggtcggcg 297



to top

>gb|AC134511.2| Homo sapiens 12 BAC RP11-528M24 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 125643

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 282   gttgagtaggagggtgaggt 301
             ||||||||||||||||||||
Sbjct: 33253 gttgagtaggagggtgaggt 33234



to top

>gb|AC122022.4| Mus musculus BAC clone RP24-372J5 from chromosome 5, complete sequence
          Length = 174861

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 56     tttacaatatgcaaatcatgcatt 79
              ||||||||| ||||||||||||||
Sbjct: 144719 tttacaataagcaaatcatgcatt 144742



to top

>gb|AC126010.13| Medicago truncatula clone mth2-20e4, complete sequence
          Length = 113964

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 101   atgacattgatcaatcacaa 120
             ||||||||||||||||||||
Sbjct: 11394 atgacattgatcaatcacaa 11375



to top

>emb|CR854992.5| Zebrafish DNA sequence from clone DKEYP-30C3 in linkage group 5,
             complete sequence
          Length = 104348

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 121   gcttataaagcatgcatgca 140
             ||||||||||||||||||||
Sbjct: 18662 gcttataaagcatgcatgca 18681



to top

>emb|X81885.2|SFTYLORF Streptomyces fradiae tylMIII(orf1*), tylMII(orf2*), tylMI(orf3*) and
            ccr(orf4*) genes
          Length = 4986

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 365  cggcgtcgaggtcggcgagcccgcccag 392
            |||||||||||||| |||||||| ||||
Sbjct: 2390 cggcgtcgaggtcgccgagcccggccag 2363



to top

>emb|CR555306.1| Azoarcus sp. EbN1 complete genome
          Length = 4296230

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 368   cgtcgaggtcggcgagcccg 387
             ||||||||||||||||||||
Sbjct: 31381 cgtcgaggtcggcgagcccg 31400



to top

>emb|CR380953.1| Candida glabrata strain CBS138 chromosome G complete sequence
          Length = 992211

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 56     tttacaatatgcaaatcatgcatttaga 83
              ||||||||||||||||  ||||||||||
Sbjct: 402747 tttacaatatgcaaatattgcatttaga 402720



to top

>emb|BX927152.1| Corynebacterium glutamicum ATCC 13032, IS fingerprint type 4-5, complete
              genome; segment 5/10
          Length = 349799

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 291    gagggtgaggtcgatgggga 310
              ||||||||||||||||||||
Sbjct: 334590 gagggtgaggtcgatgggga 334609



to top

>gb|AE016828.2| Coxiella burnetii RSA 493, complete genome
          Length = 1995281

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 1       aacccaacttgaacaacctt 20
               ||||||||||||||||||||
Sbjct: 1082607 aacccaacttgaacaacctt 1082588



to top

>emb|BX569691.1| Synechococcus sp. WH8102 complete genome; segment 3/7
          Length = 347365

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 231    gatggatcacatgcggcagg 250
              ||||||||||||||||||||
Sbjct: 182979 gatggatcacatgcggcagg 182998



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 360    cacggcggcgtcgaggtcggcgag 383
              ||||||||||||||| ||||||||
Sbjct: 164966 cacggcggcgtcgagatcggcgag 164989



to top

>gb|AC108043.3| Homo sapiens BAC clone RP11-270L13 from 4, complete sequence
          Length = 138020

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 345   ggcggtgcagaggcacacggcggc 368
             |||||||||||||| |||||||||
Sbjct: 45282 ggcggtgcagaggcccacggcggc 45305



to top

>gb|AC073427.7| Homo sapiens BAC clone RP11-746K19 from 4, complete sequence
          Length = 157152

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 115   tcacaagcttataaagcatg 134
             ||||||||||||||||||||
Sbjct: 77653 tcacaagcttataaagcatg 77672



to top

>gb|AC006549.28| Homo sapiens chromosome 22 clone p215k21 map 22q11, complete sequence
          Length = 174840

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 214   gagtaaatcgatggatagatggat 237
             |||||||| |||||||||||||||
Sbjct: 78547 gagtaaatggatggatagatggat 78524



to top

>gb|AC000097.1| Homo sapiens Chromosome 22q11.2 PAC Clone p201m18 In DGCR Region,
              complete sequence
          Length = 162269

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 214    gagtaaatcgatggatagatggat 237
              |||||||| |||||||||||||||
Sbjct: 148376 gagtaaatggatggatagatggat 148353



to top

>gb|AC006547.9| Homo sapiens chromosome 22 clone p158l19 map 22q11, complete sequence
          Length = 179269

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 214    gagtaaatcgatggatagatggat 237
              |||||||| |||||||||||||||
Sbjct: 160594 gagtaaatggatggatagatggat 160571



to top

>gb|AC058790.14| Homo sapiens chromosome 22 clone b518b9 map 22q11, complete sequence
          Length = 184929

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 214   gagtaaatcgatggatagatggat 237
             |||||||| |||||||||||||||
Sbjct: 57686 gagtaaatggatggatagatggat 57663



to top

>gb|AC007663.29| Homo sapiens chromosome 22 clone b444p24 map 22q11, complete sequence
          Length = 168239

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 214   gagtaaatcgatggatagatggat 237
             |||||||| |||||||||||||||
Sbjct: 45886 gagtaaatggatggatagatggat 45863



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7,
              complete sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 362    cggcggcgtcgaggtcggcg 381
              ||||||||||||||||||||
Sbjct: 718853 cggcggcgtcgaggtcggcg 718872



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 124      tataaagcatgcatgcatga 143
                ||||||||||||||||||||
Sbjct: 24699528 tataaagcatgcatgcatga 24699509



to top

>dbj|BA000036.3| Corynebacterium glutamicum ATCC 13032 DNA, complete genome
          Length = 3309401

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 291     gagggtgaggtcgatgggga 310
               ||||||||||||||||||||
Sbjct: 1728813 gagggtgaggtcgatgggga 1728832



to top

>dbj|AP003328.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:B1040D09
          Length = 148102

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 124    tataaagcatgcatgcatga 143
              ||||||||||||||||||||
Sbjct: 125491 tataaagcatgcatgcatga 125472



to top

>gb|AF235504.1|AF235504 Streptomyces hygroscopicus var. ascomyceticus FK520 biosynthetic gene
             cluster, partial sequence
          Length = 77534

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 358   cacacggcggcgtcgaggtcggcg 381
             |||||||||||||||| |||||||
Sbjct: 36322 cacacggcggcgtcgaagtcggcg 36345



to top

>gb|AF263912.1|AF263912 Streptomyces noursei ATCC 11455 nystatin biosynthetic gene cluster,
             complete sequence
          Length = 123580

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 362   cggcggcgtcgaggtcggcgagcc 385
             |||||||||||||| |||||||||
Sbjct: 81371 cggcggcgtcgaggccggcgagcc 81348



to top

>dbj|AP003874.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1118_G09
          Length = 115815

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 362   cggcggcgtcgaggtcggcg 381
             ||||||||||||||||||||
Sbjct: 57384 cggcggcgtcgaggtcggcg 57403



to top

>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome
          Length = 4659019

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 361     acggcggcgtcgaggtcggcgagc 384
               ||||||||||||||||||| ||||
Sbjct: 3603602 acggcggcgtcgaggtcggagagc 3603579



to top

>dbj|AP002843.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0407B12
          Length = 148762

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 124   tataaagcatgcatgcatga 143
             ||||||||||||||||||||
Sbjct: 68105 tataaagcatgcatgcatga 68086



to top

>dbj|AP005244.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1513_F02
          Length = 126845

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 362   cggcggcgtcgaggtcggcg 381
             ||||||||||||||||||||
Sbjct: 38660 cggcggcgtcgaggtcggcg 38679



to top

>emb|BX572098.1| Prochlorococcus marinus MIT9313 complete genome; segment 4/7
          Length = 346683

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 231    gatggatcacatgcggcagg 250
              ||||||||||||||||||||
Sbjct: 121940 gatggatcacatgcggcagg 121921



to top

>gb|AC117614.12| Mus musculus chromosome 5, clone RP23-110C17, complete sequence
          Length = 222809

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 56   tttacaatatgcaaatcatgcatt 79
            ||||||||| ||||||||||||||
Sbjct: 3882 tttacaataagcaaatcatgcatt 3905



to top

>gb|U34333.1|PVU34333 Phaseolus vulgaris proline-rich 14 kDa protein mRNA, complete cds
          Length = 677

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 303 gatggggacattgagcttgatgcc 326
           ||||||||||||||| ||||||||
Sbjct: 337 gatggggacattgaggttgatgcc 314



to top

>emb|BX000489.8| Zebrafish DNA sequence from clone CH211-215E19, complete sequence
          Length = 201748

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 93    gtgatacaatgacattgatcaatc 116
             ||||||||||||| ||||||||||
Sbjct: 15783 gtgatacaatgacgttgatcaatc 15760



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 93    gtgatacaatgacattgatcaatc 116
             ||||||||||||| ||||||||||
Sbjct: 14998 gtgatacaatgacgttgatcaatc 14975


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,347,012
Number of Sequences: 3902068
Number of extensions: 3347012
Number of successful extensions: 79142
Number of sequences better than 10.0: 148
Number of HSP's better than 10.0 without gapping: 156
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 77749
Number of HSP's gapped (non-prelim): 1387
length of query: 463
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 441
effective length of database: 17,147,199,772
effective search space: 7561915099452
effective search space used: 7561915099452
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top