ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbart13d05 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK103409.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033128E16, full insert sequence Length = 1056 Score = 369 bits (186), Expect = 6e-99 Identities = 318/362 (87%) Strand = Plus / Minus Query: 182 atgcaatgatgaaagggagcacagtcaacatgaatgcctcgtaactgaaagttgcagacc 241 ||||||||| |||||||| ||||||| |||||| ||||||||| | ||||| ||||| | Sbjct: 935 atgcaatgagaaaagggagtacagtcagcatgaaagcctcgtaagtaaaagtcgcagagc 876 Query: 242 cggagtaagccgtgtccttctccttgaacttctcagtcagacccttgactgtaaggcaac 301 | ||| | || ||||| ||||||||||||||||||||||||||||| ||||| ||||| | Sbjct: 875 ccgagaaggcagtgtctttctccttgaacttctcagtcagacccttaactgtgaggcagc 816 Query: 302 actcaataaagttatcatattcgactgctttgctcatgcccccagtcttgtcgaatttag 361 | ||||| |||||||||||||| | |||||| || |||||||||||||||| || || | Sbjct: 815 attcaatgaagttatcatattcaatggctttgttcttgcccccagtcttgtcaaactttg 756 Query: 362 acacgagcaagtctagcacagttggagaaactgaataacccagactgagaagagcatcac 421 |||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 755 acacaagcaagtctagcacagttggagaaactgaatatcccagactgagaagagcatcac 696 Query: 422 gcagctccgatgcatcaattttaccacttcggtcacggtcaaacctctcaaatatagacc 481 ||| || | ||||||||||||||||||| ||||||| ||||||||||| || || |||| Sbjct: 695 gcaattctgttgcatcaattttaccactttggtcacgatcaaacctctcgaaaatggacc 636 Query: 482 tccaattctgaagactgtaaaaaacagaagtaaactccttgggcccgatcctgcggacgt 541 |||||||||||||||||||||| ||||| ||||| |||||||| || ||| ||||||||| Sbjct: 635 tccaattctgaagactgtaaaacacagaggtaaattccttgggaccaatcttgcggacgt 576 Query: 542 tg 543 || Sbjct: 575 tg 574
>dbj|AK059278.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-025-C08, full insert sequence Length = 1104 Score = 361 bits (182), Expect = 2e-96 Identities = 317/362 (87%) Strand = Plus / Minus Query: 182 atgcaatgatgaaagggagcacagtcaacatgaatgcctcgtaactgaaagttgcagacc 241 ||||||||| || ||||| ||||||| |||||| ||||||||| | ||||| ||||| | Sbjct: 947 atgcaatgagaaaggggagtacagtcagcatgaaagcctcgtaagtaaaagtcgcagagc 888 Query: 242 cggagtaagccgtgtccttctccttgaacttctcagtcagacccttgactgtaaggcaac 301 | ||| | || ||||| || |||||||||||||||||||||||||| ||||| ||||| | Sbjct: 887 ccgagaaggctgtgtctttttccttgaacttctcagtcagacccttaactgtgaggcagc 828 Query: 302 actcaataaagttatcatattcgactgctttgctcatgcccccagtcttgtcgaatttag 361 | ||||| |||||||||||||| | |||||| || |||||||||||||||| || || | Sbjct: 827 attcaatgaagttatcatattcaatggctttgttcttgcccccagtcttgtcaaactttg 768 Query: 362 acacgagcaagtctagcacagttggagaaactgaataacccagactgagaagagcatcac 421 |||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 767 acacaagcaagtctagcacagttggagaaactgaatatcccagactgagaagagcatcac 708 Query: 422 gcagctccgatgcatcaattttaccacttcggtcacggtcaaacctctcaaatatagacc 481 ||| || | ||||||||||||||||||||||||||| ||||||||||| || || |||| Sbjct: 707 gcaattctgttgcatcaattttaccacttcggtcacgatcaaacctctcgaaaatggacc 648 Query: 482 tccaattctgaagactgtaaaaaacagaagtaaactccttgggcccgatcctgcggacgt 541 |||||||||||||||||||||| ||||| ||||| |||||||| || ||| ||||||||| Sbjct: 647 tccaattctgaagactgtaaaacacagaggtaaattccttgggaccaatcttgcggacgt 588 Query: 542 tg 543 || Sbjct: 587 tg 586
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 208 bits (105), Expect = 1e-50 Identities = 153/169 (90%) Strand = Plus / Plus Query: 302 actcaataaagttatcatattcgactgctttgctcatgcccccagtcttgtcgaatttag 361 ||||||| |||||||||||||| | |||||| || |||||||||||||||| || || | Sbjct: 1794422 actcaatgaagttatcatattcaatggctttgttcttgcccccagtcttgtcaaactttg 1794481 Query: 362 acacgagcaagtctagcacagttggagaaactgaataacccagactgagaagagcatcac 421 |||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 1794482 acacaagcaagtctagcacagttggagaaactgaatatcccagactgagaagagcatcac 1794541 Query: 422 gcagctccgatgcatcaattttaccacttcggtcacggtcaaacctctc 470 ||| || | ||||||||||||||||||||||||||| ||||||||||| Sbjct: 1794542 gcaattctgttgcatcaattttaccacttcggtcacgatcaaacctctc 1794590 Score = 89.7 bits (45), Expect = 9e-15 Identities = 90/105 (85%) Strand = Plus / Plus Query: 182 atgcaatgatgaaagggagcacagtcaacatgaatgcctcgtaactgaaagttgcagacc 241 ||||||||| |||||||| ||||||| |||||| ||||||||| | ||||| ||||| | Sbjct: 1793614 atgcaatgagaaaagggagtacagtcagcatgaaagcctcgtaagtaaaagtcgcagagc 1793673 Query: 242 cggagtaagccgtgtccttctccttgaacttctcagtcagaccct 286 | ||| | || ||||| || ||||||||||||||||||||||||| Sbjct: 1793674 ccgagaaggctgtgtctttttccttgaacttctcagtcagaccct 1793718 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 480 cctccaattctgaagactgtaaaaaacagaagtaaactccttggg 524 |||||||||||||||||||||||| ||||| ||||| |||||||| Sbjct: 1794701 cctccaattctgaagactgtaaaacacagaggtaaattccttggg 1794745
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 208 bits (105), Expect = 1e-50 Identities = 153/169 (90%) Strand = Plus / Plus Query: 302 actcaataaagttatcatattcgactgctttgctcatgcccccagtcttgtcgaatttag 361 ||||||| |||||||||||||| | |||||| || |||||||||||||||| || || | Sbjct: 1794400 actcaatgaagttatcatattcaatggctttgttcttgcccccagtcttgtcaaactttg 1794459 Query: 362 acacgagcaagtctagcacagttggagaaactgaataacccagactgagaagagcatcac 421 |||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 1794460 acacaagcaagtctagcacagttggagaaactgaatatcccagactgagaagagcatcac 1794519 Query: 422 gcagctccgatgcatcaattttaccacttcggtcacggtcaaacctctc 470 ||| || | ||||||||||||||||||||||||||| ||||||||||| Sbjct: 1794520 gcaattctgttgcatcaattttaccacttcggtcacgatcaaacctctc 1794568 Score = 89.7 bits (45), Expect = 9e-15 Identities = 90/105 (85%) Strand = Plus / Plus Query: 182 atgcaatgatgaaagggagcacagtcaacatgaatgcctcgtaactgaaagttgcagacc 241 ||||||||| |||||||| ||||||| |||||| ||||||||| | ||||| ||||| | Sbjct: 1793592 atgcaatgagaaaagggagtacagtcagcatgaaagcctcgtaagtaaaagtcgcagagc 1793651 Query: 242 cggagtaagccgtgtccttctccttgaacttctcagtcagaccct 286 | ||| | || ||||| || ||||||||||||||||||||||||| Sbjct: 1793652 ccgagaaggctgtgtctttttccttgaacttctcagtcagaccct 1793696 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 480 cctccaattctgaagactgtaaaaaacagaagtaaactccttggg 524 |||||||||||||||||||||||| ||||| ||||| |||||||| Sbjct: 1794679 cctccaattctgaagactgtaaaacacagaggtaaattccttggg 1794723
>emb|BX000502.2|CNS08CDS Oryza sativa chromosome 12, . BAC OSJNBb0041E01 of library OSJNBb from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 132026 Score = 208 bits (105), Expect = 1e-50 Identities = 153/169 (90%) Strand = Plus / Minus Query: 302 actcaataaagttatcatattcgactgctttgctcatgcccccagtcttgtcgaatttag 361 ||||||| |||||||||||||| | |||||| || |||||||||||||||| || || | Sbjct: 46060 actcaatgaagttatcatattcaatggctttgttcttgcccccagtcttgtcaaactttg 46001 Query: 362 acacgagcaagtctagcacagttggagaaactgaataacccagactgagaagagcatcac 421 |||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 46000 acacaagcaagtctagcacagttggagaaactgaatatcccagactgagaagagcatcac 45941 Query: 422 gcagctccgatgcatcaattttaccacttcggtcacggtcaaacctctc 470 ||| || | ||||||||||||||||||||||||||| ||||||||||| Sbjct: 45940 gcaattctgttgcatcaattttaccacttcggtcacgatcaaacctctc 45892 Score = 89.7 bits (45), Expect = 9e-15 Identities = 90/105 (85%) Strand = Plus / Minus Query: 182 atgcaatgatgaaagggagcacagtcaacatgaatgcctcgtaactgaaagttgcagacc 241 ||||||||| |||||||| ||||||| |||||| ||||||||| | ||||| ||||| | Sbjct: 46868 atgcaatgagaaaagggagtacagtcagcatgaaagcctcgtaagtaaaagtcgcagagc 46809 Query: 242 cggagtaagccgtgtccttctccttgaacttctcagtcagaccct 286 | ||| | || ||||| || ||||||||||||||||||||||||| Sbjct: 46808 ccgagaaggctgtgtctttttccttgaacttctcagtcagaccct 46764 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 480 cctccaattctgaagactgtaaaaaacagaagtaaactccttggg 524 |||||||||||||||||||||||| ||||| ||||| |||||||| Sbjct: 45781 cctccaattctgaagactgtaaaacacagaggtaaattccttggg 45737
>gb|AC123527.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0068G15, complete sequence Length = 146175 Score = 200 bits (101), Expect = 3e-48 Identities = 152/169 (89%) Strand = Plus / Plus Query: 302 actcaataaagttatcatattcgactgctttgctcatgcccccagtcttgtcgaatttag 361 ||||||| |||||||||||||| | |||||| || |||||||||||||||| || || | Sbjct: 80910 actcaatgaagttatcatattcaatggctttgttcttgcccccagtcttgtcaaactttg 80969 Query: 362 acacgagcaagtctagcacagttggagaaactgaataacccagactgagaagagcatcac 421 |||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 80970 acacaagcaagtctagcacagttggagaaactgaatatcccagactgagaagagcatcac 81029 Query: 422 gcagctccgatgcatcaattttaccacttcggtcacggtcaaacctctc 470 ||| || | ||||||||||||||||||| ||||||| ||||||||||| Sbjct: 81030 gcaattctgttgcatcaattttaccactttggtcacgatcaaacctctc 81078 Score = 97.6 bits (49), Expect = 4e-17 Identities = 91/105 (86%) Strand = Plus / Plus Query: 182 atgcaatgatgaaagggagcacagtcaacatgaatgcctcgtaactgaaagttgcagacc 241 ||||||||| |||||||| ||||||| |||||| ||||||||| | ||||| ||||| | Sbjct: 79938 atgcaatgagaaaagggagtacagtcagcatgaaagcctcgtaagtaaaagtcgcagagc 79997 Query: 242 cggagtaagccgtgtccttctccttgaacttctcagtcagaccct 286 | ||| | || ||||| |||||||||||||||||||||||||||| Sbjct: 79998 ccgagaaggcagtgtctttctccttgaacttctcagtcagaccct 80042 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 480 cctccaattctgaagactgtaaaaaacagaagtaaactccttggg 524 |||||||||||||||||||||||| ||||| ||||| |||||||| Sbjct: 81189 cctccaattctgaagactgtaaaacacagaggtaaattccttggg 81233
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 200 bits (101), Expect = 3e-48 Identities = 152/169 (89%) Strand = Plus / Plus Query: 302 actcaataaagttatcatattcgactgctttgctcatgcccccagtcttgtcgaatttag 361 ||||||| |||||||||||||| | |||||| || |||||||||||||||| || || | Sbjct: 1863080 actcaatgaagttatcatattcaatggctttgttcttgcccccagtcttgtcaaactttg 1863139 Query: 362 acacgagcaagtctagcacagttggagaaactgaataacccagactgagaagagcatcac 421 |||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 1863140 acacaagcaagtctagcacagttggagaaactgaatatcccagactgagaagagcatcac 1863199 Query: 422 gcagctccgatgcatcaattttaccacttcggtcacggtcaaacctctc 470 ||| || | ||||||||||||||||||| ||||||| ||||||||||| Sbjct: 1863200 gcaattctgttgcatcaattttaccactttggtcacgatcaaacctctc 1863248 Score = 97.6 bits (49), Expect = 4e-17 Identities = 91/105 (86%) Strand = Plus / Plus Query: 182 atgcaatgatgaaagggagcacagtcaacatgaatgcctcgtaactgaaagttgcagacc 241 ||||||||| |||||||| ||||||| |||||| ||||||||| | ||||| ||||| | Sbjct: 1862108 atgcaatgagaaaagggagtacagtcagcatgaaagcctcgtaagtaaaagtcgcagagc 1862167 Query: 242 cggagtaagccgtgtccttctccttgaacttctcagtcagaccct 286 | ||| | || ||||| |||||||||||||||||||||||||||| Sbjct: 1862168 ccgagaaggcagtgtctttctccttgaacttctcagtcagaccct 1862212 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 480 cctccaattctgaagactgtaaaaaacagaagtaaactccttggg 524 |||||||||||||||||||||||| ||||| ||||| |||||||| Sbjct: 1863359 cctccaattctgaagactgtaaaacacagaggtaaattccttggg 1863403
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 200 bits (101), Expect = 3e-48 Identities = 152/169 (89%) Strand = Plus / Plus Query: 302 actcaataaagttatcatattcgactgctttgctcatgcccccagtcttgtcgaatttag 361 ||||||| |||||||||||||| | |||||| || |||||||||||||||| || || | Sbjct: 1860801 actcaatgaagttatcatattcaatggctttgttcttgcccccagtcttgtcaaactttg 1860860 Query: 362 acacgagcaagtctagcacagttggagaaactgaataacccagactgagaagagcatcac 421 |||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 1860861 acacaagcaagtctagcacagttggagaaactgaatatcccagactgagaagagcatcac 1860920 Query: 422 gcagctccgatgcatcaattttaccacttcggtcacggtcaaacctctc 470 ||| || | ||||||||||||||||||| ||||||| ||||||||||| Sbjct: 1860921 gcaattctgttgcatcaattttaccactttggtcacgatcaaacctctc 1860969 Score = 97.6 bits (49), Expect = 4e-17 Identities = 91/105 (86%) Strand = Plus / Plus Query: 182 atgcaatgatgaaagggagcacagtcaacatgaatgcctcgtaactgaaagttgcagacc 241 ||||||||| |||||||| ||||||| |||||| ||||||||| | ||||| ||||| | Sbjct: 1859829 atgcaatgagaaaagggagtacagtcagcatgaaagcctcgtaagtaaaagtcgcagagc 1859888 Query: 242 cggagtaagccgtgtccttctccttgaacttctcagtcagaccct 286 | ||| | || ||||| |||||||||||||||||||||||||||| Sbjct: 1859889 ccgagaaggcagtgtctttctccttgaacttctcagtcagaccct 1859933 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 480 cctccaattctgaagactgtaaaaaacagaagtaaactccttggg 524 |||||||||||||||||||||||| ||||| ||||| |||||||| Sbjct: 1861080 cctccaattctgaagactgtaaaacacagaggtaaattccttggg 1861124
>gb|AY106160.1| Zea mays PCO089266 mRNA sequence Length = 571 Score = 85.7 bits (43), Expect = 1e-13 Identities = 88/103 (85%) Strand = Plus / Minus Query: 184 gcaatgatgaaagggagcacagtcaacatgaatgcctcgtaactgaaagttgcagacccg 243 ||||||| |||||| ||||| |||| |||||| |||||||| ||||||| || ||||| Sbjct: 358 gcaatgaggaaaggcagcacggtcagcatgaaggcctcgtaggtgaaagtcgccgaccca 299 Query: 244 gagtaagccgtgtccttctccttgaacttctcagtcagaccct 286 ||||| || ||||| ||||||||||||||||| ||||| |||| Sbjct: 298 gagtaggctgtgtcattctccttgaacttctctgtcagcccct 256
>gb|DQ226650.1| Boechera divaricarpa isolate SLW-5-G06 mRNA sequence Length = 1323 Score = 77.8 bits (39), Expect = 3e-11 Identities = 54/59 (91%) Strand = Plus / Plus Query: 460 tcaaacctctcaaatatagacctccaattctgaagactgtaaaaaacagaagtaaactc 518 |||||||||||||| || ||||||||||||||||||||||| |||| ||||||||||| Sbjct: 1051 tcaaacctctcaaagatggacctccaattctgaagactgtagaaaagtgaagtaaactc 1109 Score = 63.9 bits (32), Expect = 5e-07 Identities = 95/116 (81%) Strand = Plus / Plus Query: 210 catgaatgcctcgtaactgaaagttgcagacccggagtaagccgtgtccttctccttgaa 269 |||||| | ||||||| ||||||| || ||||| || |||||| || ||||||||||| Sbjct: 801 catgaacgtctcgtaattgaaagtagctgaccctgatagagccgtatctttctccttgaa 860 Query: 270 cttctcagtcagacccttgactgtaaggcaacactcaataaagttatcatattcga 325 |||||||||||| ||||| || || | ||| ||||| || || || |||||||||| Sbjct: 861 cttctcagtcagcccctttacagtcaagcagcactcgatgaaattgtcatattcga 916
>gb|BT014117.1| Lycopersicon esculentum clone 133222R, mRNA sequence Length = 1324 Score = 71.9 bits (36), Expect = 2e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctcagtcagacccttgactgtaaggcaacactcaataaagtta 315 ||||||||||||||||||||||| || || || || || ||||| |||||||| |||||| Sbjct: 991 tccttctccttgaacttctcagttagccctttaacggtgaggcagcactcaatgaagtta 932 Query: 316 tcatattc 323 |||||||| Sbjct: 931 tcatattc 924
>ref|NM_111865.4| Arabidopsis thaliana calcium ion binding AT3G10300 transcript variant AT3G10300.3 mRNA, complete cds Length = 1258 Score = 69.9 bits (35), Expect = 8e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 460 tcaaacctctcaaatatagacctccaattctgaagactgtaaaaaacagaagtaaactc 518 |||||||||||||| ||||||||||||||||||||||| | |||| ||||||||||| Sbjct: 843 tcaaacctctcaaagatagacctccaattctgaagactaaagaaaagtgaagtaaactc 785 Score = 48.1 bits (24), Expect = 0.030 Identities = 63/76 (82%) Strand = Plus / Minus Query: 250 gccgtgtccttctccttgaacttctcagtcagacccttgactgtaaggcaacactcaata 309 ||||| |||||||||||||||||||| || || ||||| || || | |||||||| || Sbjct: 1053 gccgtatccttctccttgaacttctcggtgagcccctttacagtcaaacaacactcgatg 994 Query: 310 aagttatcatattcga 325 || || |||||||||| Sbjct: 993 aaattgtcatattcga 978
>ref|NM_180667.2| Arabidopsis thaliana calcium ion binding AT3G10300 transcript variant AT3G10300.2 mRNA, complete cds Length = 1471 Score = 69.9 bits (35), Expect = 8e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 460 tcaaacctctcaaatatagacctccaattctgaagactgtaaaaaacagaagtaaactc 518 |||||||||||||| ||||||||||||||||||||||| | |||| ||||||||||| Sbjct: 843 tcaaacctctcaaagatagacctccaattctgaagactaaagaaaagtgaagtaaactc 785 Score = 44.1 bits (22), Expect = 0.47 Identities = 25/26 (96%) Strand = Plus / Minus Query: 250 gccgtgtccttctccttgaacttctc 275 ||||| |||||||||||||||||||| Sbjct: 1266 gccgtatccttctccttgaacttctc 1241
>ref|NM_001035591.1| Arabidopsis thaliana calcium ion binding AT3G10300 transcript variant AT3G10300.4 mRNA, complete cds Length = 1272 Score = 69.9 bits (35), Expect = 8e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 460 tcaaacctctcaaatatagacctccaattctgaagactgtaaaaaacagaagtaaactc 518 |||||||||||||| ||||||||||||||||||||||| | |||| ||||||||||| Sbjct: 843 tcaaacctctcaaagatagacctccaattctgaagactaaagaaaagtgaagtaaactc 785 Score = 44.1 bits (22), Expect = 0.47 Identities = 25/26 (96%) Strand = Plus / Minus Query: 250 gccgtgtccttctccttgaacttctc 275 ||||| |||||||||||||||||||| Sbjct: 1046 gccgtatccttctccttgaacttctc 1021
>ref|NM_120499.4| Arabidopsis thaliana calcium ion binding AT5G04170 mRNA, complete cds Length = 1475 Score = 69.9 bits (35), Expect = 8e-09 Identities = 83/99 (83%) Strand = Plus / Minus Query: 227 tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctcagtcagaccct 286 ||||||| || || || ||||| || ||||||||||||||||||||||| ||||| |||| Sbjct: 1166 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctctgtcagcccct 1107 Query: 287 tgactgtaaggcaacactcaataaagttatcatattcga 325 | || || || || |||||||| || || |||||||||| Sbjct: 1106 taacagtgagacagcactcaatgaaattgtcatattcga 1068 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 464 acctctcaaatatagacctccaattctgaagactgtaaaaaacagaagtaaactccttgg 523 |||||||||| || |||||||| |||||||||||||| |||| | |||||||||||| | Sbjct: 929 acctctcaaaaatggacctccagttctgaagactgtagaaaagtgcagtaaactccttag 870 Query: 524 gcccgat 530 | ||||| Sbjct: 869 gtccgat 863
>gb|BT015172.1| Arabidopsis thaliana At3g10300 gene, complete cds Length = 1008 Score = 69.9 bits (35), Expect = 8e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 460 tcaaacctctcaaatatagacctccaattctgaagactgtaaaaaacagaagtaaactc 518 |||||||||||||| ||||||||||||||||||||||| | |||| ||||||||||| Sbjct: 728 tcaaacctctcaaagatagacctccaattctgaagactaaagaaaagtgaagtaaactc 670 Score = 48.1 bits (24), Expect = 0.030 Identities = 63/76 (82%) Strand = Plus / Minus Query: 250 gccgtgtccttctccttgaacttctcagtcagacccttgactgtaaggcaacactcaata 309 ||||| |||||||||||||||||||| || || ||||| || || | |||||||| || Sbjct: 938 gccgtatccttctccttgaacttctcggtgagcccctttacagtcaaacaacactcgatg 879 Query: 310 aagttatcatattcga 325 || || |||||||||| Sbjct: 878 aaattgtcatattcga 863
>gb|BT008838.1| Arabidopsis thaliana At5g04170 mRNA, complete cds Length = 1065 Score = 69.9 bits (35), Expect = 8e-09 Identities = 83/99 (83%) Strand = Plus / Minus Query: 227 tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctcagtcagaccct 286 ||||||| || || || ||||| || ||||||||||||||||||||||| ||||| |||| Sbjct: 1018 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctctgtcagcccct 959 Query: 287 tgactgtaaggcaacactcaataaagttatcatattcga 325 | || || || || |||||||| || || |||||||||| Sbjct: 958 taacagtgagacagcactcaatgaaattgtcatattcga 920 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 464 acctctcaaatatagacctccaattctgaagactgtaaaaaacagaagtaaactccttgg 523 |||||||||| || |||||||| |||||||||||||| |||| | |||||||||||| | Sbjct: 781 acctctcaaaaatggacctccagttctgaagactgtagaaaagtgcagtaaactccttag 722 Query: 524 gcccgat 530 | ||||| Sbjct: 721 gtccgat 715
>gb|AY081342.1| Arabidopsis thaliana EF-hand calcium binding protein-like (At5g04170) mRNA, complete cds Length = 1325 Score = 69.9 bits (35), Expect = 8e-09 Identities = 83/99 (83%) Strand = Plus / Minus Query: 227 tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctcagtcagaccct 286 ||||||| || || || ||||| || ||||||||||||||||||||||| ||||| |||| Sbjct: 1044 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctctgtcagcccct 985 Query: 287 tgactgtaaggcaacactcaataaagttatcatattcga 325 | || || || || |||||||| || || |||||||||| Sbjct: 984 taacagtgagacagcactcaatgaaattgtcatattcga 946 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 464 acctctcaaatatagacctccaattctgaagactgtaaaaaacagaagtaaactccttgg 523 |||||||||| || |||||||| |||||||||||||| |||| | |||||||||||| | Sbjct: 807 acctctcaaaaatggacctccagttctgaagactgtagaaaagtgcagtaaactccttag 748 Query: 524 gcccgat 530 | ||||| Sbjct: 747 gtccgat 741
>gb|AY062498.1| Arabidopsis thaliana Unknown protein (At3g10300; F14P13.10) mRNA, complete cds Length = 1196 Score = 69.9 bits (35), Expect = 8e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 460 tcaaacctctcaaatatagacctccaattctgaagactgtaaaaaacagaagtaaactc 518 |||||||||||||| ||||||||||||||||||||||| | |||| ||||||||||| Sbjct: 786 tcaaacctctcaaagatagacctccaattctgaagactaaagaaaagtgaagtaaactc 728 Score = 48.1 bits (24), Expect = 0.030 Identities = 63/76 (82%) Strand = Plus / Minus Query: 250 gccgtgtccttctccttgaacttctcagtcagacccttgactgtaaggcaacactcaata 309 ||||| |||||||||||||||||||| || || ||||| || || | |||||||| || Sbjct: 996 gccgtatccttctccttgaacttctcggtgagcccctttacagtcaaacaacactcgatg 937 Query: 310 aagttatcatattcga 325 || || |||||||||| Sbjct: 936 aaattgtcatattcga 921
>emb|BX823832.1|CNS0A7KF Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS80ZD12 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 654 Score = 69.9 bits (35), Expect = 8e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 460 tcaaacctctcaaatatagacctccaattctgaagactgtaaaaaacagaagtaaactc 518 |||||||||||||| ||||||||||||||||||||||| | |||| ||||||||||| Sbjct: 241 tcaaacctctcaaagatagacctccaattctgaagactaaagaaaagtgaagtaaactc 183 Score = 48.1 bits (24), Expect = 0.030 Identities = 63/76 (82%) Strand = Plus / Minus Query: 250 gccgtgtccttctccttgaacttctcagtcagacccttgactgtaaggcaacactcaata 309 ||||| |||||||||||||||||||| || || ||||| || || | |||||||| || Sbjct: 451 gccgtatccttctccttgaacttctcggtgagcccctttacagtcaaacaacactcgatg 392 Query: 310 aagttatcatattcga 325 || || |||||||||| Sbjct: 391 aaattgtcatattcga 376
>emb|BX831460.1|CNS0A1WC Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS93ZB02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1320 Score = 69.9 bits (35), Expect = 8e-09 Identities = 83/99 (83%) Strand = Plus / Minus Query: 227 tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctcagtcagaccct 286 ||||||| || || || ||||| || ||||||||||||||||||||||| ||||| |||| Sbjct: 1099 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctctgtcagcccct 1040 Query: 287 tgactgtaaggcaacactcaataaagttatcatattcga 325 | || || || || |||||||| || || |||||||||| Sbjct: 1039 taacagtgagacagcactcaatgaaattgtcatattcga 1001 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 464 acctctcaaatatagacctccaattctgaagactgtaaaaaacagaagtaaactccttgg 523 |||||||||| || |||||||| |||||||||||||| |||| | |||||||||||| | Sbjct: 862 acctctcaaaaatggacctccagttctgaagactgtagaaaagtgcagtaaactccttag 803 Query: 524 gcccgat 530 | ||||| Sbjct: 802 gtccgat 796
>emb|BX831038.1|CNS0A1WE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS51ZG02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1306 Score = 69.9 bits (35), Expect = 8e-09 Identities = 83/99 (83%) Strand = Plus / Minus Query: 227 tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctcagtcagaccct 286 ||||||| || || || ||||| || ||||||||||||||||||||||| ||||| |||| Sbjct: 1098 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctctgtcagcccct 1039 Query: 287 tgactgtaaggcaacactcaataaagttatcatattcga 325 | || || || || |||||||| || || |||||||||| Sbjct: 1038 taacagtgagacagcactcaatgaaattgtcatattcga 1000 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 464 acctctcaaatatagacctccaattctgaagactgtaaaaaacagaagtaaactccttgg 523 |||||||||| || |||||||| |||||||||||||| |||| | |||||||||||| | Sbjct: 861 acctctcaaaaatggacctccagttctgaagactgtagaaaagtgcagtaaactccttag 802 Query: 524 gcccgat 530 | ||||| Sbjct: 801 gtccgat 795
>emb|BX830610.1|CNS0A1Z3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB94ZA02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1278 Score = 69.9 bits (35), Expect = 8e-09 Identities = 83/99 (83%) Strand = Plus / Minus Query: 227 tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctcagtcagaccct 286 ||||||| || || || ||||| || ||||||||||||||||||||||| ||||| |||| Sbjct: 1075 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctctgtcagcccct 1016 Query: 287 tgactgtaaggcaacactcaataaagttatcatattcga 325 | || || || || |||||||| || || |||||||||| Sbjct: 1015 taacagtgagacagcactcaatgaaattgtcatattcga 977 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 464 acctctcaaatatagacctccaattctgaagactgtaaaaaacagaagtaaactccttgg 523 |||||||||| || |||||||| |||||||||||||| |||| | |||||||||||| | Sbjct: 838 acctctcaaaaatggacctccagttctgaagactgtagaaaagtgcagtaaactccttag 779 Query: 524 gcccgat 530 | ||||| Sbjct: 778 gtccgat 772
>emb|BX830373.1|CNS0A1YJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB76ZE09 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1296 Score = 69.9 bits (35), Expect = 8e-09 Identities = 83/99 (83%) Strand = Plus / Minus Query: 227 tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctcagtcagaccct 286 ||||||| || || || ||||| || ||||||||||||||||||||||| ||||| |||| Sbjct: 1107 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctctgtcagcccct 1048 Query: 287 tgactgtaaggcaacactcaataaagttatcatattcga 325 | || || || || |||||||| || || |||||||||| Sbjct: 1047 taacagtgagacagcactcaatgaaattgtcatattcga 1009 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 464 acctctcaaatatagacctccaattctgaagactgtaaaaaacagaagtaaactccttgg 523 |||||||||| || |||||||| |||||||||||||| |||| | |||||||||||| | Sbjct: 870 acctctcaaaaatggacctccagttctgaagactgtagaaaagtgcagtaaactccttag 811 Query: 524 gcccgat 530 | ||||| Sbjct: 810 gtccgat 804
>emb|BX831366.1|CNS0A273 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS82ZD05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1326 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 464 acctctcaaatatagacctccaattctgaagactgtaaaaaacagaagtaaactccttgg 523 |||||||||| || |||||||| |||||||||||||| |||| | |||||||||||| | Sbjct: 871 acctctcaaaaatggacctccagttctgaagactgtagaaaagtgcagtaaactccttag 812 Query: 524 gcccgat 530 | ||||| Sbjct: 811 gtccgat 805 Score = 54.0 bits (27), Expect = 5e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 227 tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctcagtcag 281 ||||||| || || || ||||| || ||||||||||||||||||||||| ||||| Sbjct: 1106 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctctgtcag 1052
>emb|BX831737.1|CNS0A1X3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH27ZA04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1263 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 464 acctctcaaatatagacctccaattctgaagactgtaaaaaacagaagtaaactccttgg 523 |||||||||| || |||||||| |||||||||||||| |||| | |||||||||||| | Sbjct: 817 acctctcaaaaatggacctccagttctgaagactgtagaaaagtgcagtaaactccttag 758 Query: 524 gcccgat 530 | ||||| Sbjct: 757 gtccgat 751 Score = 54.0 bits (27), Expect = 5e-04 Identities = 57/67 (85%) Strand = Plus / Minus Query: 259 ttctccttgaacttctcagtcagacccttgactgtaaggcaacactcaataaagttatca 318 ||||||||||||||||| ||||| ||||| || || || || |||||||| || || ||| Sbjct: 1023 ttctccttgaacttctctgtcagccccttaacagtgagacagcactcaatgaaattgtca 964 Query: 319 tattcga 325 ||||||| Sbjct: 963 tattcga 957
>emb|BX830151.1|CNS0A1YG Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB62ZG12 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1299 Score = 61.9 bits (31), Expect = 2e-06 Identities = 82/99 (82%) Strand = Plus / Minus Query: 227 tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctcagtcagaccct 286 ||||||| || || || ||||| || ||||||||||||||||||||||| || || |||| Sbjct: 1104 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctctgtgagcccct 1045 Query: 287 tgactgtaaggcaacactcaataaagttatcatattcga 325 | || || || || |||||||| || || |||||||||| Sbjct: 1044 taacagtgagacagcactcaatgaaattgtcatattcga 1006 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 464 acctctcaaatatagacctccaattctgaagactgtaaaaaacagaagtaaactccttgg 523 |||||||||| || |||||||| |||||||||||||| |||| | |||||||||||| | Sbjct: 867 acctctcaaaaatggacctccagttctgaagactgtagaaaagtgcagtaaactccttag 808 Query: 524 gcccgat 530 | ||||| Sbjct: 807 gtccgat 801
>emb|BX830310.1|CNS0A08N Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB72ZB04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1271 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 464 acctctcaaatatagacctccaattctgaagactgtaaaaaacagaagtaaactccttgg 523 |||||||||| || |||||||| |||||||||||||| |||| | |||||||||||| | Sbjct: 793 acctctcaaaaatggacctccagttctgaagactgtagaaaagtgcagtaaactccttag 734 Query: 524 gcccgat 530 | ||||| Sbjct: 733 gtccgat 727 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 227 tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctc 275 ||||||| || || || ||||| || ||||||||||||||||||||||| Sbjct: 1030 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctc 982
>emb|BX830845.1|CNS09ZFX Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS30ZB01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1305 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 464 acctctcaaatatagacctccaattctgaagactgtaaaaaacagaagtaaactccttgg 523 |||||||||| || |||||||| |||||||||||||| |||| | |||||||||||| | Sbjct: 860 acctctcaaaaatggacctccagttctgaagactgtagaaaagtgcagtaaactccttag 801 Query: 524 gcccgat 530 | ||||| Sbjct: 800 gtccgat 794 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 244 gagtaagccgtgtccttctccttgaacttctcagtcag 281 ||||| || ||||||||||||||||||||||| ||||| Sbjct: 1080 gagtatgctgtgtccttctccttgaacttctctgtcag 1043
>emb|AJ251828.1|PSA251828 Pisum sativum partial mRNA for putative cysteine protease (plp gene) Length = 1155 Score = 58.0 bits (29), Expect = 3e-05 Identities = 209/269 (77%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctcagtcagacccttgactgtaaggcaacactcaataaagtta 315 |||||||||||||| || ||||| || ||||| || || || ||||||||||| || || Sbjct: 812 tccttctccttgaatttgtcagttagtcccttcacggtgagacaacactcaatgaaattg 753 Query: 316 tcatattcgactgctttgctcatgcccccagtcttgtcgaatttagacacgagcaagtct 375 |||||||| || || ||| |||| ||||| ||||| || || || || |||||||| Sbjct: 752 tcatattcaacagccttgtgtttgccaccagttttgtcaaacttggagacaagcaagtcc 693 Query: 376 agcacagttggagaaactgaataacccagactgagaagagcatcacgcagctccgatgca 435 | || || |||||||| | |||||||| ||| | || ||||| |||||||| || | Sbjct: 692 aataccgtaggagaaacagcataacccaaacttaacagtgcatctcgcagctcatttgaa 633 Query: 436 tcaattttaccacttcggtcacggtcaaacctctcaaatatagacctccaattctgaaga 495 || |||| ||||| | ||| ||||| ||||||||||| |||||| |||||||| Sbjct: 632 tcgatttggccactcctgtccttatcaaatctctcaaatattcccctccagctctgaaga 573 Query: 496 ctgtaaaaaacagaagtaaactccttggg 524 |||||||| | |||||| ||||||||||| Sbjct: 572 ctgtaaaacagagaagtgaactccttggg 544
>emb|AL391716.1|ATF21E1 Arabidopsis thaliana DNA chromosome 5, BAC clone F21E1 (ESSA project) Length = 97451 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 227 tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctcagtcagaccct 286 ||||||| || || || ||||| || ||||||||||||||||||||||| ||||| |||| Sbjct: 51019 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctctgtcagcccct 50960 Score = 44.1 bits (22), Expect = 0.47 Identities = 37/42 (88%) Strand = Plus / Minus Query: 480 cctccaattctgaagactgtaaaaaacagaagtaaactcctt 521 |||||| |||||||||||||| |||| | |||||||||||| Sbjct: 50251 cctccagttctgaagactgtagaaaagtgcagtaaactcctt 50210
>emb|BX831278.1|CNS0A1WK Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS74ZD10 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1375 Score = 54.0 bits (27), Expect = 5e-04 Identities = 57/67 (85%) Strand = Plus / Minus Query: 464 acctctcaaatatagacctccaattctgaagactgtaaaaaacagaagtaaactccttgg 523 ||||||||| || |||||||| |||||||||||||| |||| | |||||||||||| | Sbjct: 870 acctctcaagaatggacctccagttctgaagactgtagaaaagtgcagtaaactccttag 811 Query: 524 gcccgat 530 | ||||| Sbjct: 810 gtccgat 804 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 244 gagtaagccgtgtccttctccttgaacttctcagtcag 281 ||||| || ||||||||||||||||||||||| ||||| Sbjct: 1090 gagtatgctgtgtccttctccttgaacttctctgtcag 1053
>gb|AY742306.1| Malus x domestica calcium-binding EF hand family protein mRNA, partial cds Length = 339 Score = 50.1 bits (25), Expect = 0.008 Identities = 31/33 (93%) Strand = Plus / Minus Query: 202 acagtcaacatgaatgcctcgtaactgaaagtt 234 |||||||||||||| ||||||||||||||||| Sbjct: 98 acagtcaacatgaactcctcgtaactgaaagtt 66
>emb|BX829719.1|CNS0A1ZB Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB30ZH09 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1410 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 227 tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctc 275 ||||||| || || || ||||| || ||||||||||||||||||||||| Sbjct: 1169 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctc 1121 Score = 42.1 bits (21), Expect = 1.9 Identities = 59/69 (85%), Gaps = 2/69 (2%) Strand = Plus / Minus Query: 464 acctctcaaatatagacctccaattctgaaga-ctgtaaaaaacag-aagtaaactcctt 521 |||||||||| || |||||||| ||||||||| ||||| |||| | ||||||||||||| Sbjct: 932 acctctcaaaaatggacctccagttctgaagagctgtagaaaagtgcaagtaaactcctt 873 Query: 522 gggcccgat 530 || ||||| Sbjct: 872 aggtccgat 864
>gb|AY431726.1| Aedes aegypti ASAP ID: 35119 questionable: large ribosomal subunit mRNA sequence Length = 378 Score = 48.1 bits (24), Expect = 0.030 Identities = 24/24 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctcagtc 279 |||||||||||||||||||||||| Sbjct: 183 tccttctccttgaacttctcagtc 160
>emb|CR718554.2|CNS0GHDS Tetraodon nigroviridis full-length cDNA Length = 502 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 254 tgtccttctccttgaacttctca 276 ||||||||||||||||||||||| Sbjct: 86 tgtccttctccttgaacttctca 64
>emb|CR716203.2|CNS0GFKK Tetraodon nigroviridis full-length cDNA Length = 1207 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 254 tgtccttctccttgaacttctca 276 ||||||||||||||||||||||| Sbjct: 501 tgtccttctccttgaacttctca 479
>emb|CR710713.2|CNS0GBC5 Tetraodon nigroviridis full-length cDNA Length = 586 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 254 tgtccttctccttgaacttctca 276 ||||||||||||||||||||||| Sbjct: 435 tgtccttctccttgaacttctca 413
>emb|CR706457.2|CNS0G81X Tetraodon nigroviridis full-length cDNA Length = 498 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 254 tgtccttctccttgaacttctca 276 ||||||||||||||||||||||| Sbjct: 86 tgtccttctccttgaacttctca 64
>emb|CR684420.2|CNS0FR1S Tetraodon nigroviridis full-length cDNA Length = 1160 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 254 tgtccttctccttgaacttctca 276 ||||||||||||||||||||||| Sbjct: 464 tgtccttctccttgaacttctca 442
>gb|AC009400.4|ATAC009400 Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence, complete sequence Length = 87937 Score = 44.1 bits (22), Expect = 0.47 Identities = 25/26 (96%) Strand = Plus / Plus Query: 250 gccgtgtccttctccttgaacttctc 275 ||||| |||||||||||||||||||| Sbjct: 42765 gccgtatccttctccttgaacttctc 42790
>emb|CR704396.2|CNS0G6GO Tetraodon nigroviridis full-length cDNA Length = 1054 Score = 44.1 bits (22), Expect = 0.47 Identities = 22/22 (100%) Strand = Plus / Minus Query: 254 tgtccttctccttgaacttctc 275 |||||||||||||||||||||| Sbjct: 321 tgtccttctccttgaacttctc 300
>emb|CR702313.2|CNS0G4UT Tetraodon nigroviridis full-length cDNA Length = 1183 Score = 44.1 bits (22), Expect = 0.47 Identities = 22/22 (100%) Strand = Plus / Minus Query: 254 tgtccttctccttgaacttctc 275 |||||||||||||||||||||| Sbjct: 441 tgtccttctccttgaacttctc 420
>emb|CR701693.1|CNS0G4DL Tetraodon nigroviridis full-length cDNA Length = 1212 Score = 44.1 bits (22), Expect = 0.47 Identities = 22/22 (100%) Strand = Plus / Minus Query: 254 tgtccttctccttgaacttctc 275 |||||||||||||||||||||| Sbjct: 482 tgtccttctccttgaacttctc 461
>emb|CR701182.2|CNS0G3ZE Tetraodon nigroviridis full-length cDNA Length = 1252 Score = 44.1 bits (22), Expect = 0.47 Identities = 22/22 (100%) Strand = Plus / Minus Query: 254 tgtccttctccttgaacttctc 275 |||||||||||||||||||||| Sbjct: 499 tgtccttctccttgaacttctc 478
>emb|CR700340.1|CNS0G3C0 Tetraodon nigroviridis full-length cDNA Length = 1181 Score = 44.1 bits (22), Expect = 0.47 Identities = 22/22 (100%) Strand = Plus / Minus Query: 254 tgtccttctccttgaacttctc 275 |||||||||||||||||||||| Sbjct: 440 tgtccttctccttgaacttctc 419
>emb|CR696556.2|CNS0G0EW Tetraodon nigroviridis full-length cDNA Length = 1234 Score = 44.1 bits (22), Expect = 0.47 Identities = 22/22 (100%) Strand = Plus / Minus Query: 254 tgtccttctccttgaacttctc 275 |||||||||||||||||||||| Sbjct: 489 tgtccttctccttgaacttctc 468
>emb|CR694535.1|CNS0FYUR Tetraodon nigroviridis full-length cDNA Length = 1204 Score = 44.1 bits (22), Expect = 0.47 Identities = 22/22 (100%) Strand = Plus / Minus Query: 254 tgtccttctccttgaacttctc 275 |||||||||||||||||||||| Sbjct: 487 tgtccttctccttgaacttctc 466
>emb|CR692906.2|CNS0FXLI Tetraodon nigroviridis full-length cDNA Length = 1236 Score = 44.1 bits (22), Expect = 0.47 Identities = 22/22 (100%) Strand = Plus / Minus Query: 254 tgtccttctccttgaacttctc 275 |||||||||||||||||||||| Sbjct: 498 tgtccttctccttgaacttctc 477
>emb|CR692493.2|CNS0FXA1 Tetraodon nigroviridis full-length cDNA Length = 1243 Score = 44.1 bits (22), Expect = 0.47 Identities = 22/22 (100%) Strand = Plus / Minus Query: 254 tgtccttctccttgaacttctc 275 |||||||||||||||||||||| Sbjct: 491 tgtccttctccttgaacttctc 470
>emb|CR691997.2|CNS0FWW9 Tetraodon nigroviridis full-length cDNA Length = 1014 Score = 44.1 bits (22), Expect = 0.47 Identities = 22/22 (100%) Strand = Plus / Minus Query: 254 tgtccttctccttgaacttctc 275 |||||||||||||||||||||| Sbjct: 264 tgtccttctccttgaacttctc 243
>emb|CR688852.2|CNS0FUGW Tetraodon nigroviridis full-length cDNA Length = 1195 Score = 44.1 bits (22), Expect = 0.47 Identities = 22/22 (100%) Strand = Plus / Minus Query: 254 tgtccttctccttgaacttctc 275 |||||||||||||||||||||| Sbjct: 442 tgtccttctccttgaacttctc 421
>emb|CR684360.2|CNS0FR04 Tetraodon nigroviridis full-length cDNA Length = 1193 Score = 44.1 bits (22), Expect = 0.47 Identities = 22/22 (100%) Strand = Plus / Minus Query: 254 tgtccttctccttgaacttctc 275 |||||||||||||||||||||| Sbjct: 443 tgtccttctccttgaacttctc 422
>emb|CR679151.2|CNS0FMZF Tetraodon nigroviridis full-length cDNA Length = 557 Score = 44.1 bits (22), Expect = 0.47 Identities = 22/22 (100%) Strand = Plus / Minus Query: 254 tgtccttctccttgaacttctc 275 |||||||||||||||||||||| Sbjct: 122 tgtccttctccttgaacttctc 101
>emb|CR671534.2|CNS0FH4K Tetraodon nigroviridis full-length cDNA Length = 623 Score = 44.1 bits (22), Expect = 0.47 Identities = 22/22 (100%) Strand = Plus / Minus Query: 254 tgtccttctccttgaacttctc 275 |||||||||||||||||||||| Sbjct: 448 tgtccttctccttgaacttctc 427
>emb|CR670949.1|CNS0FGOB Tetraodon nigroviridis full-length cDNA Length = 1187 Score = 44.1 bits (22), Expect = 0.47 Identities = 22/22 (100%) Strand = Plus / Minus Query: 254 tgtccttctccttgaacttctc 275 |||||||||||||||||||||| Sbjct: 449 tgtccttctccttgaacttctc 428
>emb|CR669089.2|CNS0FF8N Tetraodon nigroviridis full-length cDNA Length = 556 Score = 44.1 bits (22), Expect = 0.47 Identities = 22/22 (100%) Strand = Plus / Minus Query: 254 tgtccttctccttgaacttctc 275 |||||||||||||||||||||| Sbjct: 121 tgtccttctccttgaacttctc 100
>gb|AE000782.1| Archaeoglobus fulgidus DSM 4304, complete genome Length = 2178400 Score = 44.1 bits (22), Expect = 0.47 Identities = 22/22 (100%) Strand = Plus / Minus Query: 254 tgtccttctccttgaacttctc 275 |||||||||||||||||||||| Sbjct: 1087856 tgtccttctccttgaacttctc 1087835
>gb|AF121351.2| Mus musculus chromosome X clone CT7-228O4 complete sequence Length = 123212 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 489 ctgaagactgtaaaaaacagaagta 513 |||||||||| |||||||||||||| Sbjct: 89050 ctgaagactggaaaaaacagaagta 89026
>gb|AC091473.2| Mus musculus chromosome X clones RP21-114F21, RP21-430D6 complete sequence Length = 221860 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 489 ctgaagactgtaaaaaacagaagta 513 |||||||||| |||||||||||||| Sbjct: 32521 ctgaagactggaaaaaacagaagta 32497
>emb|AL591793.1|SME591793 Sinorhizobium meliloti 1021 complete chromosome; segment 12/12 Length = 273785 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 446 cacttcggtcacggtcaaacc 466 ||||||||||||||||||||| Sbjct: 90989 cacttcggtcacggtcaaacc 90969
>emb|AL590733.8| Human DNA sequence from clone RP11-193D23 on chromosome 6 Contains the 3' end of the FLJ14440 gene for thrombospondin, complete sequence Length = 135507 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 188 tgatgaaagggagcacagtcaacat 212 |||||||| |||||||||||||||| Sbjct: 16107 tgatgaaatggagcacagtcaacat 16083
>gb|AC154341.2| Mus musculus BAC clone RP23-240C2 from 16, complete sequence Length = 163871 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 355 aatttagacacgagcaagtct 375 ||||||||||||||||||||| Sbjct: 125281 aatttagacacgagcaagtct 125261
>emb|AL590792.1| Human DNA sequence from clone RP11-416F22 on chromosome 6, complete sequence Length = 51956 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 188 tgatgaaagggagcacagtcaacat 212 |||||||| |||||||||||||||| Sbjct: 14218 tgatgaaatggagcacagtcaacat 14194
>gb|AF009663.1|HSTCRB75A Homo sapiens T cell receptor beta locus, TCRBV8S5P to TCRBV21S2A2 region Length = 136975 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 400 cccagactgagaagagcatc 419 |||||||||||||||||||| Sbjct: 22737 cccagactgagaagagcatc 22718
>gb|AY513883.1| Homo sapiens T-cell receptor beta mRNA, partial cds Length = 720 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 400 cccagactgagaagagcatc 419 |||||||||||||||||||| Sbjct: 78 cccagactgagaagagcatc 59
>gb|AY432072.1| Aedes aegypti ASAP ID: 34485 cytosolic large ribosomal subunit L8 mRNA sequence Length = 1079 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 868 tccttctccttgaacttctc 849
>gb|AF009662.1|HSTCRBB27 Homo sapiens T cell receptor beta locus, TCRBV13S1 to TCRBV6S9 region Length = 36337 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 400 cccagactgagaagagcatc 419 |||||||||||||||||||| Sbjct: 18516 cccagactgagaagagcatc 18497
>gb|DQ440262.1| Aedes aegypti clone AET-322 60S ribosomal protein L2/L8 mRNA, complete cds Length = 786 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 776 tccttctccttgaacttctc 757
>ref|NG_001333.1| Homo sapiens T cell receptor beta locus (TRB@) on chromosome 7 Length = 684973 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 400 cccagactgagaagagcatc 419 |||||||||||||||||||| Sbjct: 278088 cccagactgagaagagcatc 278069
>gb|AF289077.4| Homo sapiens chromosome 8 clone CTD-2003M15 map p23.2, complete sequence Length = 145170 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 atgaatgcctcgtaactgaa 230 |||||||||||||||||||| Sbjct: 23291 atgaatgcctcgtaactgaa 23310
>gb|AY464739.1| Uncultured archaeon clone AF02 16S ribosomal RNA gene, partial sequence Length = 913 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 gaatgcctcgtaactgaaagttgc 236 ||||||||| |||||||||||||| Sbjct: 170 gaatgcctcctaactgaaagttgc 193
>gb|BC071724.1| Homo sapiens cDNA clone IMAGE:5212614, **** WARNING: chimeric clone **** Length = 1381 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 400 cccagactgagaagagcatc 419 |||||||||||||||||||| Sbjct: 295 cccagactgagaagagcatc 276
>emb|AL591472.7| Human DNA sequence from clone RP11-438A6 on chromosome 6 Contains two CpG islands, complete sequence Length = 80601 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 276 agtcagacccttgactgtaa 295 |||||||||||||||||||| Sbjct: 49908 agtcagacccttgactgtaa 49927
>emb|AL137801.11| Human DNA sequence from clone RP4-609B14 on chromosome 1q42.11-42.3 Contains the gene for a novel protein (DKFZp547B1713), the 5' end of the GNPAT gene for glyceronephosphate O-acyltransferase and a CpG island, complete sequence Length = 54486 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 aacatcactcaaattcaaac 92 |||||||||||||||||||| Sbjct: 42621 aacatcactcaaattcaaac 42602
>emb|BX072100.1|CNS09RSO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9DF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 574 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 196 tccttctccttgaacttctc 215
>emb|BX072099.1|CNS09RSN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 847 tccttctccttgaacttctc 828
>emb|BX071992.1|CNS09RPO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9DA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 980 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 236 tccttctccttgaacttctc 255
>emb|BX071991.1|CNS09RPN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1011 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 866 tccttctccttgaacttctc 847
>emb|BX071470.1|CNS09RB6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9AB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1020 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 233 tccttctccttgaacttctc 252
>emb|BX071469.1|CNS09RB5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9AB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1038 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 856 tccttctccttgaacttctc 837
>emb|BX071376.1|CNS09R8K Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8DE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 385 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 217 tccttctccttgaacttctc 236
>emb|BX071012.1|CNS09QYG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 828 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 233 tccttctccttgaacttctc 252
>emb|BX071011.1|CNS09QYF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 911 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 849 tccttctccttgaacttctc 830
>emb|BX070723.1|CNS09QQF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7DG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 900 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 217 tccttctccttgaacttctc 236
>emb|BX070722.1|CNS09QQE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7DG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 999 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 859 tccttctccttgaacttctc 840
>emb|BX070207.1|CNS09QC3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7AG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 469 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 218 tccttctccttgaacttctc 237
>emb|BX069681.1|CNS09PXH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6BG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 711 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 224 tccttctccttgaacttctc 243
>emb|BX061050.1|CNS09J9Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 775 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 207 tccttctccttgaacttctc 226
>emb|BX060948.1|CNS09J6W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41CB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 419 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 223 tccttctccttgaacttctc 242
>emb|BX060936.1|CNS09J6K Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41CB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 825 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 204 tccttctccttgaacttctc 223
>emb|BX060935.1|CNS09J6J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41CB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 988 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 837 tccttctccttgaacttctc 818
>emb|BX069234.1|CNS09PL2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53DC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 496 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 225 tccttctccttgaacttctc 244
>emb|BX068985.1|CNS09PE5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53BH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 866 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 260 tccttctccttgaacttctc 279
>emb|BX068984.1|CNS09PE4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53BH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1029 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 866 tccttctccttgaacttctc 847
>emb|BX068769.1|CNS09P85 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 993 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 237 tccttctccttgaacttctc 256
>emb|BX068768.1|CNS09P84 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 863 tccttctccttgaacttctc 844
>emb|BX067648.1|CNS09OD0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 878 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 223 tccttctccttgaacttctc 242
>emb|BX067647.1|CNS09OCZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 922 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 846 tccttctccttgaacttctc 827
>emb|BX067520.1|CNS09O9G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51BA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 525 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 225 tccttctccttgaacttctc 244
>emb|BX067519.1|CNS09O9F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 846 tccttctccttgaacttctc 827
>emb|BX067280.1|CNS09O2S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50DF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 884 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 240 tccttctccttgaacttctc 259
>emb|BX067279.1|CNS09O2R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 856 tccttctccttgaacttctc 837
>emb|BX067196.1|CNS09O0G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50DB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 401 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 214 tccttctccttgaacttctc 233
>emb|BX066817.1|CNS09NPX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 928 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 212 tccttctccttgaacttctc 231
>emb|BX066816.1|CNS09NPW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1005 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 849 tccttctccttgaacttctc 830
>emb|BX066574.1|CNS09NJ6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 226 tccttctccttgaacttctc 245
>emb|BX066573.1|CNS09NJ5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 995 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 862 tccttctccttgaacttctc 843
>emb|BX066544.1|CNS09NIC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 227 tccttctccttgaacttctc 246
>emb|BX066543.1|CNS09NIB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1030 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 851 tccttctccttgaacttctc 832
>emb|BX066504.1|CNS09NH8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 188 tccttctccttgaacttctc 207
>emb|BX066033.1|CNS09N45 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5AG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 784 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 227 tccttctccttgaacttctc 246
>emb|BX066032.1|CNS09N44 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5AG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 872 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 854 tccttctccttgaacttctc 835
>emb|BX065783.1|CNS09MX7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 507 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 208 tccttctccttgaacttctc 189
>emb|BX065536.1|CNS09MQC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 989 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 220 tccttctccttgaacttctc 239
>emb|BX065162.1|CNS09MFY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48DG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 957 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 227 tccttctccttgaacttctc 246
>emb|BX065161.1|CNS09MFX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1021 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 864 tccttctccttgaacttctc 845
>emb|BX064927.1|CNS09M9F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 579 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 223 tccttctccttgaacttctc 242
>emb|BX064864.1|CNS09M7O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48CA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1015 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 214 tccttctccttgaacttctc 233
>emb|BX064863.1|CNS09M7N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48CA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1065 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 850 tccttctccttgaacttctc 831
>emb|BX064747.1|CNS09M4F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48BB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 536 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 219 tccttctccttgaacttctc 238
>emb|BX064324.1|CNS09LSO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46CC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 228 tccttctccttgaacttctc 247
>emb|BX064323.1|CNS09LSN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46CC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1035 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 844 tccttctccttgaacttctc 825
>emb|BX064211.1|CNS09LPJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46BF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 610 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 226 tccttctccttgaacttctc 245
>emb|BX063827.1|CNS09LEV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 237 tccttctccttgaacttctc 256
>emb|BX063826.1|CNS09LEU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1072 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 855 tccttctccttgaacttctc 836
>emb|BX063741.1|CNS09LCH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1014 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 234 tccttctccttgaacttctc 253
>emb|BX063740.1|CNS09LCG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1010 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 875 tccttctccttgaacttctc 856
>emb|BX063296.1|CNS09L04 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45AB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 919 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 224 tccttctccttgaacttctc 243
>emb|BX063295.1|CNS09L03 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45AB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 974 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 845 tccttctccttgaacttctc 826
>emb|BX063245.1|CNS09KYP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44DH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 875 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 217 tccttctccttgaacttctc 236
>emb|BX063244.1|CNS09KYO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 940 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 702 tccttctccttgaacttctc 683
>emb|BX063171.1|CNS09KWN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44DD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 951 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 233 tccttctccttgaacttctc 252
>emb|BX063170.1|CNS09KWM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1004 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 832 tccttctccttgaacttctc 813
>emb|BX062638.1|CNS09KHU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 560 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 230 tccttctccttgaacttctc 249
>emb|BX062637.1|CNS09KHT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 859 tccttctccttgaacttctc 840
>emb|BX062521.1|CNS09KEL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43DD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 862 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 236 tccttctccttgaacttctc 255
>emb|BX062520.1|CNS09KEK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43DD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1024 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 837 tccttctccttgaacttctc 818
>emb|BX062318.1|CNS09K8Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43CC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 998 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 215 tccttctccttgaacttctc 234
>emb|BX062317.1|CNS09K8X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43CC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 979 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 702 tccttctccttgaacttctc 683
>emb|BX062059.1|CNS09K1R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43AF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 386 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 186 tccttctccttgaacttctc 205
>emb|BX062058.1|CNS09K1Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43AF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 856 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 848 tccttctccttgaacttctc 829
>emb|BX062038.1|CNS09K16 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43AE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 626 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 158 tccttctccttgaacttctc 177
>emb|BX062037.1|CNS09K15 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43AE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 851 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 841 tccttctccttgaacttctc 822
>emb|BX061861.1|CNS09JW9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42DE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 223 tccttctccttgaacttctc 242
>emb|BX061860.1|CNS09JW8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 864 tccttctccttgaacttctc 845
>emb|BX061503.1|CNS09JMB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42BE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1006 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 231 tccttctccttgaacttctc 250
>emb|BX061502.1|CNS09JMA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42BE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1009 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 865 tccttctccttgaacttctc 846
>emb|BX061238.1|CNS09JEY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41DG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 878 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 185 tccttctccttgaacttctc 204
>emb|BX061237.1|CNS09JEX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41DG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 822 tccttctccttgaacttctc 803
>emb|BX061207.1|CNS09JE3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 767 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 228 tccttctccttgaacttctc 247
>emb|BX061125.1|CNS09JBT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41DB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 882 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 820 tccttctccttgaacttctc 801
>emb|BX060724.1|CNS09J0O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41AH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 838 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 223 tccttctccttgaacttctc 242
>emb|BX060723.1|CNS09J0N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41AH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 995 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 839 tccttctccttgaacttctc 820
>emb|BX060569.1|CNS09IWD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41AA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 291 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 205 tccttctccttgaacttctc 224
>emb|BX059883.1|CNS09IDB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 388 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 214 tccttctccttgaacttctc 233
>emb|BX059882.1|CNS09IDA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 865 tccttctccttgaacttctc 846
>emb|BX059853.1|CNS09ICH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4DH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 920 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 212 tccttctccttgaacttctc 231
>emb|BX059852.1|CNS09ICG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4DH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 970 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 846 tccttctccttgaacttctc 827
>emb|BX059824.1|CNS09IBO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4DF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 986 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 220 tccttctccttgaacttctc 239
>emb|BX059823.1|CNS09IBN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4DF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 984 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 841 tccttctccttgaacttctc 822
>emb|BX059792.1|CNS09IAS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4DD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 932 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 217 tccttctccttgaacttctc 236
>emb|BX059791.1|CNS09IAR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4DD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 902 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 756 tccttctccttgaacttctc 737
>emb|BX059612.1|CNS09I5S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4CB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 356 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 225 tccttctccttgaacttctc 244
>emb|BX059267.1|CNS09HW7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4AB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 903 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 239 tccttctccttgaacttctc 258
>emb|BX059266.1|CNS09HW6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 945 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 869 tccttctccttgaacttctc 850
>emb|BX059235.1|CNS09HVB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39DH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 984 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 218 tccttctccttgaacttctc 237
>emb|BX059234.1|CNS09HVA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1019 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 847 tccttctccttgaacttctc 828
>emb|BX059042.1|CNS09HPY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39CH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 951 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 844 tccttctccttgaacttctc 825
>emb|BX058790.1|CNS09HIY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39BE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 874 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 216 tccttctccttgaacttctc 235
>emb|BX058355.1|CNS09H6V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC38CH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 400 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 245 tccttctccttgaacttctc 264
>emb|BX056726.1|CNS09FXM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC36BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 644 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 256 tccttctccttgaacttctc 275
>emb|BX056725.1|CNS09FXL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 872 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 872 tccttctccttgaacttctc 853
>emb|BX057699.1|CNS09GON Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37DB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 367 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 239 tccttctccttgaacttctc 258
>emb|BX057210.1|CNS09GB2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37AC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 535 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 263 tccttctccttgaacttctc 282
>emb|BX057196.1|CNS09GAO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37AB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 607 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 250 tccttctccttgaacttctc 269
>emb|BX057158.1|CNS09G9M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC36DH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 443 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 235 tccttctccttgaacttctc 254
>emb|BX057093.1|CNS09G7T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC36DE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 340 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 237 tccttctccttgaacttctc 256
>emb|BX057044.1|CNS09G6G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC36DC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 783 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 229 tccttctccttgaacttctc 248
>emb|BX056961.1|CNS09G45 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC36CG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 831 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 238 tccttctccttgaacttctc 257
>emb|BX056409.1|CNS09FOT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC35CG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 667 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 248 tccttctccttgaacttctc 267
>emb|BX055358.1|CNS09EVM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC33DG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 402 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 218 tccttctccttgaacttctc 237
>emb|BX055357.1|CNS09EVL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33DG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 849 tccttctccttgaacttctc 830
>emb|BX055232.1|CNS09ES4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC33DB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 831 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 233 tccttctccttgaacttctc 252
>emb|BX055194.1|CNS09ER2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33CH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 787 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 762 tccttctccttgaacttctc 743
>emb|BX055189.1|CNS09EQX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC33CH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 845 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 227 tccttctccttgaacttctc 246
>emb|BX055188.1|CNS09EQW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33CH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 905 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 822 tccttctccttgaacttctc 803
>emb|BX054843.1|CNS09EHB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC33AG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 904 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 223 tccttctccttgaacttctc 242
>emb|BX054842.1|CNS09EHA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33AG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 943 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 869 tccttctccttgaacttctc 850
>emb|BX054817.1|CNS09EGL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC33AF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 240 tccttctccttgaacttctc 259
>emb|BX054816.1|CNS09EGK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33AF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 938 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 868 tccttctccttgaacttctc 849
>emb|BX054769.1|CNS09EF9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC33AC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 604 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 213 tccttctccttgaacttctc 232
>emb|BX054768.1|CNS09EF8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33AC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 927 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 837 tccttctccttgaacttctc 818
>emb|BX053073.1|CNS09D45 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC30CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 270 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 127 tccttctccttgaacttctc 146
>emb|BX053072.1|CNS09D44 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 869 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 798 tccttctccttgaacttctc 779
>emb|BX053031.1|CNS09D2Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC30BG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 521 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 150 tccttctccttgaacttctc 169
>emb|BX054430.1|CNS09E5U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32CD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 722 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 125 tccttctccttgaacttctc 144
>emb|BX054417.1|CNS09E5H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32CC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 912 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 867 tccttctccttgaacttctc 848
>emb|BX054379.1|CNS09E4F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 787 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 226 tccttctccttgaacttctc 245
>emb|BX054108.1|CNS09DWW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 466 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 231 tccttctccttgaacttctc 250
>emb|BX054107.1|CNS09DWV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 851 tccttctccttgaacttctc 832
>emb|BX053844.1|CNS09DPK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC31DA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 960 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 239 tccttctccttgaacttctc 258
>emb|BX053843.1|CNS09DPJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31DA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 981 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 870 tccttctccttgaacttctc 851
>emb|BX053757.1|CNS09DN5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31CE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 847 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 811 tccttctccttgaacttctc 792
>emb|BX053555.1|CNS09DHJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC31BB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 877 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 239 tccttctccttgaacttctc 258
>emb|BX053554.1|CNS09DHI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31BB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 943 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 856 tccttctccttgaacttctc 837
>emb|BX052869.1|CNS09CYH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC30AH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 886 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 240 tccttctccttgaacttctc 259
>emb|BX052868.1|CNS09CYG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30AH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 864 tccttctccttgaacttctc 845
>emb|BX052583.1|CNS09CQJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3CH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 810 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 232 tccttctccttgaacttctc 251
>emb|BX052582.1|CNS09CQI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3CH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 850 tccttctccttgaacttctc 831
>emb|BX052554.1|CNS09CPQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3CG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 951 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 224 tccttctccttgaacttctc 243
>emb|BX052553.1|CNS09CPP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3CG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1001 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 838 tccttctccttgaacttctc 819
>emb|BX052540.1|CNS09CPC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3CF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 234 tccttctccttgaacttctc 253
>emb|BX052539.1|CNS09CPB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3CF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1005 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 850 tccttctccttgaacttctc 831
>emb|BX052387.1|CNS09CL3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3BG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 521 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 234 tccttctccttgaacttctc 253
>emb|BX052272.1|CNS09CHW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3BB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 860 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 228 tccttctccttgaacttctc 247
>emb|BX052271.1|CNS09CHV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3BB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 859 tccttctccttgaacttctc 840
>emb|BX052222.1|CNS09CGI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3AH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 585 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 242 tccttctccttgaacttctc 261
>emb|BX052221.1|CNS09CGH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3AH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 852 tccttctccttgaacttctc 833
>emb|BX051688.1|CNS09C1O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC29AE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 452 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 247 tccttctccttgaacttctc 266
>emb|BX051644.1|CNS09C0G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC29AC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 536 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 242 tccttctccttgaacttctc 261
>emb|BX051423.1|CNS09BUB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC28DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 873 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 231 tccttctccttgaacttctc 250
>emb|BX051422.1|CNS09BUA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC28DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 837 tccttctccttgaacttctc 818
>emb|BX051408.1|CNS09BTW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC28DA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 859 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 838 tccttctccttgaacttctc 819
>emb|BX051372.1|CNS09BSW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC28CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 824 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 240 tccttctccttgaacttctc 259
>emb|BX051371.1|CNS09BSV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC28CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 864 tccttctccttgaacttctc 845
>emb|BX050253.1|CNS09AXT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC26CE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 575 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 218 tccttctccttgaacttctc 237
>emb|BX050118.1|CNS09AU2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC26BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 536 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 221 tccttctccttgaacttctc 240
>emb|BX050089.1|CNS09AT9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC26BD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 585 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 212 tccttctccttgaacttctc 231
>emb|BX050810.1|CNS09BDA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC27CA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 900 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 229 tccttctccttgaacttctc 248
>emb|BX050809.1|CNS09BD9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC27CA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 858 tccttctccttgaacttctc 839
>emb|BX050569.1|CNS09B6L Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC27AE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 598 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 211 tccttctccttgaacttctc 230
>emb|BX031018.1|CNS08W3I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA46BB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 377 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 228 tccttctccttgaacttctc 247
>emb|BX049265.1|CNS09A6D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC25AC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 833 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 237 tccttctccttgaacttctc 256
>emb|BX048973.1|CNS099Y9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC24CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 511 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 222 tccttctccttgaacttctc 241
>emb|BX046434.1|CNS097ZQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC20AD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 975 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 221 tccttctccttgaacttctc 240
>emb|BX046433.1|CNS097ZP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC20AD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 995 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 840 tccttctccttgaacttctc 821
>emb|BX046386.1|CNS097YE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC20AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 868 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 213 tccttctccttgaacttctc 232
>emb|BX046385.1|CNS097YD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC20AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 830 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 668 tccttctccttgaacttctc 649
>emb|BX048281.1|CNS099F1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC23BE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 221 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 167 tccttctccttgaacttctc 186
>emb|BX048280.1|CNS099F0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC23BE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 875 tccttctccttgaacttctc 856
>emb|BX048092.1|CNS0999S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC23AA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 557 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 260 tccttctccttgaacttctc 279
>emb|BX047771.1|CNS0990V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC22CA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 222 tccttctccttgaacttctc 241
>emb|BX047770.1|CNS0990U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC22CA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1045 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 846 tccttctccttgaacttctc 827
>emb|BX047425.1|CNS098R9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC21CF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 878 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 243 tccttctccttgaacttctc 262
>emb|BX047424.1|CNS098R8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC21CF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1000 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 867 tccttctccttgaacttctc 848
>emb|BX047421.1|CNS098R5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC21CF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 821 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 217 tccttctccttgaacttctc 236
>emb|BX047145.1|CNS098JH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC21AG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 241 tccttctccttgaacttctc 260
>emb|BX047144.1|CNS098JG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC21AG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1002 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 861 tccttctccttgaacttctc 842
>emb|BX045784.1|CNS097HO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC2AD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 tccttctccttgaacttctc 275 |||||||||||||||||||| Sbjct: 228 tccttctccttgaacttctc 247 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,890,711 Number of Sequences: 3902068 Number of extensions: 4890711 Number of successful extensions: 90649 Number of sequences better than 10.0: 573 Number of HSP's better than 10.0 without gapping: 573 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 89892 Number of HSP's gapped (non-prelim): 757 length of query: 543 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 520 effective length of database: 17,143,297,704 effective search space: 8914514806080 effective search space used: 8914514806080 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
