ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart13c09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrins... 646 0.0
2gb|BT016583.1| Zea mays clone Contig416 mRNA sequence 230 3e-57
3gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds 222 9e-55
4gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein... 214 2e-52
5gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein... 198 1e-47
6gb|AY109332.1| Zea mays CL502_5 mRNA sequence 198 1e-47
7gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, comp... 174 2e-40
8ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA 167 4e-38
9ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group... 167 4e-38
10ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group... 167 4e-38
11dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clon... 167 4e-38
12dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clon... 167 4e-38
13dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 167 4e-38
14dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 167 4e-38
15dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 1e-35
16dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA ... 157 4e-35
17dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 149 1e-32
18dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D... 149 1e-32
19gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein... 135 2e-28
20ref|XM_466869.1| Oryza sativa (japonica cultivar-group), mRNA 129 9e-27
21dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 9e-27
22gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein... 127 4e-26
23gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence 119 9e-24
24gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrins... 107 3e-20
25ref|NM_187081.2| Oryza sativa (japonica cultivar-group), mRNA 105 1e-19
26dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clon... 105 1e-19
27gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds 100 8e-18
28gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protei... 100 8e-18
29gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putat... 92 2e-15
30gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1)... 92 2e-15
31dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin ... 88 3e-14
32gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds 86 1e-13
33ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predic... 84 5e-13
34ref|NM_187084.1| Oryza sativa (japonica cultivar-group), mRNA 82 2e-12
35ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group... 82 2e-12
36dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 2e-12
37ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channe... 80 8e-12
38gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 80 8e-12
39gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 80 8e-12
40gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 80 8e-12
41emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Co... 80 8e-12
42emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Co... 80 8e-12
43dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin,... 78 3e-11
44gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water chann... 78 3e-11
45dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd 78 3e-11
46gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence 76 1e-10
47gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-... 76 1e-10
48emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein 76 1e-10
49emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet... 76 1e-10
50dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 76 1e-10
51dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic D... 76 1e-10
52dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 1e-10
53dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 1e-10
54dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 1e-10
55gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, ... 76 1e-10
56dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ... 76 1e-10
57emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein 74 5e-10
58gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putat... 74 5e-10
59dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds 74 5e-10
60ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channe... 72 2e-09
61gb|AY081593.1| Arabidopsis thaliana water channel-like protein (... 72 2e-09
62gb|AY059948.1| Arabidopsis thaliana water channel - like protein... 72 2e-09
63dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - li... 72 2e-09
64emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
65emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
66emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
67emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
68gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete se... 72 2e-09
69gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasm... 72 2e-09
70gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds 68 3e-08
71gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, c... 68 3e-08
72gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (... 66 1e-07
73ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predic... 66 1e-07
74gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein... 66 1e-07
75gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, comple... 66 1e-07
76gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds 66 1e-07
77gb|AY170841.1| Axonopus compressus plasma membrane MIP protein m... 66 1e-07
78dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
79dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
80dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
81dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
82emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for p... 64 5e-07
83emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for p... 64 5e-07
84emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for p... 62 2e-06
85gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putat... 62 2e-06
86dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membran... 62 2e-06
87emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for p... 60 7e-06
88emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for p... 60 7e-06
89dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 60 7e-06
90gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com... 60 7e-06
91ref|XM_475029.1| Oryza sativa (japonica cultivar-group), predic... 58 3e-05
92emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for p... 58 3e-05
93emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp... 58 3e-05
94dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds 58 3e-05
95gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein... 58 3e-05
96gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein... 58 3e-05
97dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
98dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
99dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
100dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
101gb|AY103580.1| Zea mays PCO072544 mRNA sequence 58 3e-05
102gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRN... 58 3e-05
103dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membran... 58 3e-05
104gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker 56 1e-04
105gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker 56 1e-04
106gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds 56 1e-04
107dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
108dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
109dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
110dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
111gb|AY107589.1| Zea mays PCO085320 mRNA sequence 56 1e-04
112emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4,... 56 1e-04
113emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for p... 54 5e-04
114emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides m... 54 5e-04
115gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, ... 54 5e-04
116gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic pr... 52 0.002
117ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative... 52 0.002
118gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putat... 52 0.002
119gb|U56603.1|BMU56603 Bufo marinus vasopressin-insensitive water ... 52 0.002
120gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma... 52 0.002
121dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
122gb|AF020620.1| Bufo marinus aquaporin-1 homolog (AQP-t1) mRNA, c... 52 0.002
123gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic pr... 52 0.002
124dbj|AB002149.1| Nicotiana excelsior mRNA for water channel prote... 52 0.002
125ref|NM_115339.2| Arabidopsis thaliana PIP2;5/PIP2D; water channe... 50 0.007
126gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence 50 0.007
127gb|BT000670.1| Arabidopsis thaliana clone RAFL07-09-N03 (R10758)... 50 0.007
128emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel... 50 0.007
129gb|AY062981.1| Arabidopsis thaliana putative aquaporin/MIP prote... 50 0.007
130gb|AF370351.1| Arabidopsis thaliana putative aquaporin/MIP prote... 50 0.007
131emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4,... 50 0.007
132gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, ... 50 0.007
133emb|BX822631.1|CNS0A61A Arabidopsis thaliana Full-length cDNA Co... 50 0.007
134gb|AY084843.1| Arabidopsis thaliana clone 11929 mRNA, complete s... 50 0.007
135emb|AJ605575.1| Ricinus communis mRNA for aquaporin (Pip2-1 gene... 50 0.007
136emb|AJ605574.1| Ricinus communis mRNA for aquaporin (Pip1-1 gene... 50 0.007
137gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein ... 50 0.007
138gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel... 50 0.007
139gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel prot... 50 0.007
140gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA 50 0.007
141ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G0... 48 0.028
142emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrins... 48 0.028
143emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B 48 0.028
144emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, ... 48 0.028
145emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, B... 48 0.028
146gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic pr... 48 0.028
147gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative pl... 48 0.028
148gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrin... 48 0.028
149emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Co... 48 0.028
150dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane in... 48 0.028
151gb|AF255795.1|AF255795 Allium cepa aquaporin 1 (Aqp1) mRNA, comp... 48 0.028
152emb|AJ605569.1| Ricinus communis partial mRNA for putative aquap... 48 0.028
153emb|AJ605565.1| Ricinus communis partial mRNA for putative aquap... 48 0.028
154gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic pr... 48 0.028
155ref|NM_119676.2| Arabidopsis thaliana PIP3 (PLASMA MEMBRANE INTR... 46 0.11
156gb|DQ226873.1| Boechera divaricarpa isolate SLW-C-G04 mRNA sequence 46 0.11
157gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, ... 46 0.11
158emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic... 46 0.11
159gb|AF367458.1| Prunus persica clone Mip2 membrane intrinsic prot... 46 0.11
160gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map ... 46 0.11
161gb|AY081580.1| Arabidopsis thaliana plasma membrane intrinsic pr... 46 0.11
162gb|AY062803.1| Arabidopsis thaliana plasma membrane intrinsic pr... 46 0.11
163gb|AF412110.1|AF412110 Arabidopsis thaliana AT4g35100/M4E13_150 ... 46 0.11
164gb|AF003728.1|AF003728 Arabidopsis thaliana plasma membrane intr... 46 0.11
165emb|BX826680.1|CNS0A37C Arabidopsis thaliana Full-length cDNA Co... 46 0.11
166emb|BX826294.1|CNS0A39S Arabidopsis thaliana Full-length cDNA Co... 46 0.11
167emb|BX827919.1|CNS0A2ZT Arabidopsis thaliana Full-length cDNA Co... 46 0.11
168emb|BX827124.1|CNS0A2UI Arabidopsis thaliana Full-length cDNA Co... 46 0.11
169gb|AY995195.1| Phaseolus vulgaris putative aquaporin (PIP2;1) mR... 46 0.11
170dbj|AB206100.1| Mimosa pudica pip2;2 mRNA for plasma membrane in... 46 0.11
171dbj|AB206099.1| Mimosa pudica pip2;1 mRNA for plasma membrane in... 46 0.11
172gb|AY088485.1| Arabidopsis thaliana clone 7108 mRNA, complete se... 46 0.11
173dbj|D85193.1| Arabidopsis thaliana mRNA, partial cds 46 0.11
174gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, c... 46 0.11
175gb|U78297.1|ATU78297 Arabidopsis thaliana plasma membrane intrin... 46 0.11
176gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, com... 46 0.11
177gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic pr... 44 0.43
178gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (... 44 0.43
179gb|AY189973.1| Juglans regia plasma intrinsic protein 2,1 mRNA, ... 44 0.43
180emb|AJ005869.1|CAR005869 Cicer arietinum mRNA for putative trans... 44 0.43
181gb|AF367460.1| Prunus persica clone Mip3 membrane intrinsic prot... 44 0.43
182gb|U22658.1|BMU22658 Bufo marinus urinary bladder aquaporin mRNA... 44 0.43
183gb|AF386739.1|AF386739 Medicago truncatula aquaporin protein PIP... 44 0.43
184gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, ... 44 0.43
185gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein... 44 0.43
186dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane in... 44 0.43
187emb|AJ605568.1| Ricinus communis partial mRNA for putative aquap... 44 0.43
188dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membra... 44 0.43
189gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, co... 44 0.43
190gb|U62280.1|NTU62280 Nicotiana tabacum aquaporin (NT2) mRNA, com... 44 0.43
191dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membran... 44 0.43
192ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G4... 42 1.7
193gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 42 1.7
194gb|AY663794.1| Fraxinus excelsior plasma membrane intrinsic prot... 42 1.7
195gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 42 1.7
196gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 42 1.7
197gb|AY333929.1| Pringlea antiscorbutica putative transmembrane pr... 42 1.7
198emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein 42 1.7
199emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel... 42 1.7
200gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (... 42 1.7
201emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A 42 1.7
202gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma m... 42 1.7
203ref|NM_001005829.1| Xenopus tropicalis aquaporin 1 (channel-form... 42 1.7
204emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 42 1.7
205emb|AJ849324.1| Populus tremula x Populus tremuloides mRNA for p... 42 1.7
206gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205),... 42 1.7
207gb|AY671950.1| Aegiceras corniculatum aquaporin 2 (PIP2) mRNA, c... 42 1.7
208emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Co... 42 1.7
209emb|BX819664.1|CNS0A8JV Arabidopsis thaliana Full-length cDNA Co... 42 1.7
210emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Co... 42 1.7
211emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Co... 42 1.7
212dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 42 1.7
213gb|AF154641.1| Nicotiana tabacum clone PR16 mRNA sequence 42 1.7
214gb|AY084470.1| Arabidopsis thaliana clone 108944 mRNA, complete ... 42 1.7
215gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, comp... 42 1.7
216gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, c... 42 1.7
217dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membra... 42 1.7
218gb|BC075384.1| Xenopus tropicalis aquaporin 1 (channel-forming i... 42 1.7
219gb|BC084131.1| Xenopus laevis hypothetical LOC495037, mRNA (cDNA... 42 1.7
220gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 42 1.7
221gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds 42 1.7
222gb|AE000657.1| Aquifex aeolicus VF5, complete genome 42 1.7
223gb|U26537.1|MCU26537 Mesembryanthemum crystallinum major intrins... 42 1.7
224gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mip... 42 1.7
225gb|U27347.1|GMU27347 Glycine max putative water channel protein ... 42 1.7
226dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane ... 42 1.7
227dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane ... 42 1.7
228ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channe... 40 6.8
229gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 40 6.8
230gb|AY494191.1| Physcomitrella patens plasma membrane aquaporin (... 40 6.8
231gb|AC016250.5| Homo sapiens chromosome 8 clone RP11-516P9, compl... 40 6.8
232gb|CP000272.1| Burkholderia xenovorans LB400 chromosome 3, compl... 40 6.8
233emb|BX545848.23| Zebrafish DNA sequence from clone DKEY-8O19 in ... 40 6.8
234emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4,... 40 6.8
235emb|AL138650.1|ATT5N23 Arabidopsis thaliana DNA chromosome 3, BA... 40 6.8
236emb|AL049655.2|ATF28P10 Arabidopsis thaliana DNA chromosome 3, B... 40 6.8
237gb|AC025207.5| Homo sapiens chromosome 8, clone RP11-193J8, comp... 40 6.8
238emb|AL596209.13| Mouse DNA sequence from clone RP23-278F12 on ch... 40 6.8
239gb|AC083943.8| Genomic sequence for Oryza sativa, Nipponbare str... 40 6.8
240gb|AF452013.1|AF452013 Petunia x hybrida aquaporin-like protein ... 40 6.8
241gb|AY059380.1| Medicago truncatula aquaporin (PIP2-1) mRNA, comp... 40 6.8
242dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.8
243gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete s... 40 6.8
244dbj|AP004867.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.8
245dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 6.8
246dbj|AP004090.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.8
247emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 40 6.8
248emb|BX248523.8| Zebrafish DNA sequence from clone CH211-257G8 in... 40 6.8
249gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 6.8
250gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome 40 6.8
251gb|U97023.1|PVU97023 Phaseolus vulgaris putative aquaporin-1 (Mi... 40 6.8
252dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome 40 6.8
253dbj|AP003548.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 40 6.8

>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA,
            complete cds
          Length = 1283

 Score =  646 bits (326), Expect = 0.0
 Identities = 465/505 (92%), Gaps = 16/505 (3%)
 Strand = Plus / Minus

                                                                        
Query: 12   cttgcttggcggattgatgatttggatagaa-ggtggcgacgttgggtcgatcatacata 70
            ||||||||| |||||||||| || ||||||| |||||||||||||| |||||||||||||
Sbjct: 1273 cttgcttggtggattgatgacttagatagaaaggtggcgacgttggatcgatcatacata 1214

                                                                        
Query: 71   tggtcgctaaattaaaaca------ggaaaaggaatgcgggctaattaagacaagcgatc 124
            ||||||||||||| ||| |      ||||||| |||||||||||||||||||||||||||
Sbjct: 1213 tggtcgctaaatttaaatacaagtaggaaaagcaatgcgggctaattaagacaagcgatc 1154

                                                                        
Query: 125  ccatggaccgaattacaacacacggcacgcatgactgggc-acatac---gcatatgcag 180
            |||||||||||||||||| |||||||||||||||| || | || |||   ||||||||||
Sbjct: 1153 ccatggaccgaattacaagacacggcacgcatgaccggaccacgtactacgcatatgcag 1094

                                                                        
Query: 181  ctgccgacacataaataacacgaccattgcagcggcc-aactgaactgtcgagaagttgc 239
            |||||||||||||| ||||||||||||||| |||||| ||||||||||||||||||||||
Sbjct: 1093 ctgccgacacataa-taacacgaccattgcggcggccgaactgaactgtcgagaagttgc 1035

                                                                        
Query: 240  aaaagcggctttctctttggatggatggacacagcacaggtcgccattgcttcaatcttg 299
            |||||||  ||||||| |||||||||||||||| ||| |||||||||||||||| |||||
Sbjct: 1034 aaaagcgcatttctctctggatggatggacacaacacgggtcgccattgcttcagtcttg 975

                                                                        
Query: 300  catgcacatcacatggat---aactcgttacgcgttgctcctgaaggagccgagggcctt 356
            ||| || || ||||||||   |||| ||||||||||||||||||||||||||||||||||
Sbjct: 974  catacagatgacatggatgataacttgttacgcgttgctcctgaaggagccgagggcctt 915

                                                                        
Query: 357  gatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcat 416
            |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 914  gatggcgccggccctgaggatgtactggtggtagaaggccgcgatcgccgcgccgatcat 855

                                                                        
Query: 417  ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 476
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 854  ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 795

                                     
Query: 477  ggcccccaggctcctggccgggttg 501
            |||||||||||||| ||||||||||
Sbjct: 794  ggcccccaggctccgggccgggttg 770



to top

>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence
          Length = 1348

 Score =  230 bits (116), Expect = 3e-57
 Identities = 161/176 (91%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 385
           |||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||
Sbjct: 924 acgcgttgctcctgaaggagccgagggccttgatggcgccagcccggaggatgtactggt 865

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           |||||||||||||||| || ||||| |  | |||||| |||||||||||||| || || |
Sbjct: 864 ggtagaaggccgcgatggcagcgcccacgagggggcccacccagaagatccagtggtcgt 805

                                                                   
Query: 446 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
           |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 804 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttg 749



to top

>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds
          Length = 1133

 Score =  222 bits (112), Expect = 9e-55
 Identities = 160/176 (90%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 385
           |||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||
Sbjct: 872 acgcgttgctcctgaaggagccgagggccttgatggcgccagcccggaggatgtactggt 813

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           |||||||||||||||| || ||||| |  |  ||||| |||||||||||||| || || |
Sbjct: 812 ggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatccagtggtcgt 753

                                                                   
Query: 446 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
           |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 752 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttg 697



to top

>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete
           cds
          Length = 1171

 Score =  214 bits (108), Expect = 2e-52
 Identities = 159/176 (90%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 385
           ||||||||||||||||||||||||||||||||||||| || |||| ||| ||||||||||
Sbjct: 943 acgcgttgctcctgaaggagccgagggccttgatggccccagcccggaggatgtactggt 884

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           |||||||||||||||| || ||||| |  |  ||||| |||||||||||||| || || |
Sbjct: 883 ggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatccagtggtcgt 824

                                                                   
Query: 446 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
           |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 823 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttg 768



to top

>gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein ZmPIP2-2 mRNA, complete
           cds
          Length = 1268

 Score =  198 bits (100), Expect = 1e-47
 Identities = 157/176 (89%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 385
           ||||||||||||||||||||||||| |||||||||||||| |||| ||| ||||||||||
Sbjct: 996 acgcgttgctcctgaaggagccgagagccttgatggcgcccgcccggaggatgtactggt 937

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           |||||||||||||||| || ||||| |  |  ||||| |||||||| ||||| || ||||
Sbjct: 936 ggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatccagtggtcat 877

                                                                   
Query: 446 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
           |||| | ||||||||||||||||| ||||||||| |||||||||||||||||||||
Sbjct: 876 cccatggcttgtccttgttgtagacgacggcggcgcccaggctcctggccgggttg 821



to top

>gb|AY109332.1| Zea mays CL502_5 mRNA sequence
          Length = 1969

 Score =  198 bits (100), Expect = 1e-47
 Identities = 157/176 (89%)
 Strand = Plus / Minus

                                                                        
Query: 326  acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 385
            ||||||||||||||||||||||||| |||||||||||||| |||| ||| ||||||||||
Sbjct: 1646 acgcgttgctcctgaaggagccgagagccttgatggcgcccgcccggaggatgtactggt 1587

                                                                        
Query: 386  ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
            |||||||||||||||| || ||||| |  |  ||||| |||||||| ||||| || ||||
Sbjct: 1586 ggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatccagtggtcat 1527

                                                                    
Query: 446  cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
            |||| | ||||||||||||||||| ||||||||| |||||||||||||||||||||
Sbjct: 1526 cccatggcttgtccttgttgtagacgacggcggcgcccaggctcctggccgggttg 1471



 Score =  127 bits (64), Expect = 4e-26
 Identities = 109/124 (87%)
 Strand = Plus / Minus

                                                                       
Query: 378 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 437
           |||||||||||||  ||| ||||| || ||||||||||  ||||| ||||||||||||||
Sbjct: 321 gtactggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatcca 262

                                                                       
Query: 438 ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 497
            || || ||||||||||||||||||||||||||||| ||||| |||| |||||| |||||
Sbjct: 261 ttggtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaagctcctcgccgg 202

               
Query: 498 gttg 501
           ||||
Sbjct: 201 gttg 198



to top

>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds
          Length = 1328

 Score =  174 bits (88), Expect = 2e-40
 Identities = 154/176 (87%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 385
           ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||
Sbjct: 968 acgcgttgctcctgaaggagccgagggccttgatggcgccggcccggaggatgtactggt 909

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 908 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 849

                                                                   
Query: 446 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||
Sbjct: 848 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttg 793



to top

>ref|NM_187092.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1242

 Score =  167 bits (84), Expect = 4e-38
 Identities = 153/176 (86%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 385
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                                                   
Query: 446 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttg 803



to top

>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1257

 Score =  167 bits (84), Expect = 4e-38
 Identities = 153/176 (86%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 385
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 980 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 921

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 920 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 861

                                                                   
Query: 446 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||
Sbjct: 860 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttg 805



to top

>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1298

 Score =  167 bits (84), Expect = 4e-38
 Identities = 153/176 (86%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 385
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 981 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 922

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 921 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 862

                                                                   
Query: 446 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||
Sbjct: 861 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttg 806



to top

>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full
           insert sequence
          Length = 1216

 Score =  167 bits (84), Expect = 4e-38
 Identities = 153/176 (86%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 385
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                                                   
Query: 446 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttg 803



to top

>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full
           insert sequence
          Length = 1451

 Score =  167 bits (84), Expect = 4e-38
 Identities = 153/176 (86%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 385
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 572 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 513

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 512 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 453

                                                                   
Query: 446 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||
Sbjct: 452 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttg 397



to top

>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full
           insert sequence
          Length = 1242

 Score =  167 bits (84), Expect = 4e-38
 Identities = 153/176 (86%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 385
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                                                   
Query: 446 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttg 803



to top

>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full
           insert sequence
          Length = 1298

 Score =  167 bits (84), Expect = 4e-38
 Identities = 153/176 (86%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 385
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 981 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 922

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 921 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 862

                                                                   
Query: 446 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||
Sbjct: 861 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttg 806



to top

>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full
           insert sequence
          Length = 1257

 Score =  159 bits (80), Expect = 1e-35
 Identities = 152/176 (86%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 385
           ||||||||||||||| |||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 980 acgcgttgctcctgagggagccgagggctttgatggcgccggcccggaggatgtactggt 921

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 920 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 861

                                                                   
Query: 446 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||
Sbjct: 860 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttg 805



to top

>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel
           protein, partial cds
          Length = 880

 Score =  157 bits (79), Expect = 4e-35
 Identities = 133/151 (88%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 385
           |||||||||||||||||||||||||||||||||||| |||||||| ||| ||||||||||
Sbjct: 544 acgcgttgctcctgaaggagccgagggccttgatggggccggcccggaggatgtactggt 485

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 484 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccattggttgt 425

                                          
Query: 446 cccaggccttgtccttgttgtagatgacggc 476
            ||||||||| || |||||| ||||||||||
Sbjct: 424 gccaggccttctcgttgttgaagatgacggc 394



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  149 bits (75), Expect = 1e-32
 Identities = 105/115 (91%)
 Strand = Plus / Minus

                                                                            
Query: 326      acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 385
                |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 15355852 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 15355793

                                                                       
Query: 386      ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
                ||||||| |||||||| || |||||||  |  |||||||||||||||||||||||
Sbjct: 15355792 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccactg 15355738



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 381      ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
                ||||||||| |  |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 15316534 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 15316475



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 381      ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
                ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 15306498 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 15306439



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                            
Query: 438      ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 497
                |||||||  |||||||||||  ||||||||||  |||||| | || ||||||||||||||
Sbjct: 15306327 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 15306268

                    
Query: 498      gttg 501
                ||||
Sbjct: 15306267 gttg 15306264



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                          
Query: 460      ttgttgtagatgacggcggcccccaggctcctggccgggttg 501
                |||||||| ||||||||||| || |||||||| |||||||||
Sbjct: 15316356 ttgttgtacatgacggcggcgccgaggctcctcgccgggttg 15316315



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                                   
Query: 451      gccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
                ||||| || |||||| |||||||||| || || | ||||||||||||||||
Sbjct: 15355603 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttg 15355553



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                            
Query: 397      gcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
                ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 15324431 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 15324388



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 325      tacgcgttgctcctgaaggagccg 348
                ||||||||||||| ||||||||||
Sbjct: 15306551 tacgcgttgctccggaaggagccg 15306528



to top

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score =  149 bits (75), Expect = 1e-32
 Identities = 105/115 (91%)
 Strand = Plus / Minus

                                                                         
Query: 326   acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 385
             |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 62851 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 62792

                                                                    
Query: 386   ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
             ||||||| |||||||| || |||||||  |  |||||||||||||||||||||||
Sbjct: 62791 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccactg 62737



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 381   ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
             ||||||||| |  |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 23533 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 23474



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 381   ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
             ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 13497 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 13438



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                         
Query: 438   ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 497
             |||||||  |||||||||||  ||||||||||  |||||| | || ||||||||||||||
Sbjct: 13326 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 13267

                 
Query: 498   gttg 501
             ||||
Sbjct: 13266 gttg 13263



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                       
Query: 460   ttgttgtagatgacggcggcccccaggctcctggccgggttg 501
             |||||||| ||||||||||| || |||||||| |||||||||
Sbjct: 23355 ttgttgtacatgacggcggcgccgaggctcctcgccgggttg 23314



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                                
Query: 451   gccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
             ||||| || |||||| |||||||||| || || | ||||||||||||||||
Sbjct: 62602 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttg 62552



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                         
Query: 397   gcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
             ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 31430 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 31387



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 325   tacgcgttgctcctgaaggagccg 348
             ||||||||||||| ||||||||||
Sbjct: 13550 tacgcgttgctccggaaggagccg 13527



to top

>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete
           cds
          Length = 1171

 Score =  135 bits (68), Expect = 2e-28
 Identities = 128/148 (86%)
 Strand = Plus / Minus

                                                                       
Query: 354 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 413
           |||| |||||| |||||| || | |||||||||||||  ||| ||||| || ||||| ||
Sbjct: 927 cttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccaat 868

                                                                       
Query: 414 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 473
           ||  ||||| |||||||||||||| || || |||||||||||||||||||||||||||||
Sbjct: 867 cagtgggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgac 808

                                       
Query: 474 ggcggcccccaggctcctggccgggttg 501
            ||||| ||||||||||| |||||||||
Sbjct: 807 cgcggctcccaggctcctcgccgggttg 780



to top

>ref|XM_466869.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1214

 Score =  129 bits (65), Expect = 9e-27
 Identities = 122/141 (86%)
 Strand = Plus / Minus

                                                                       
Query: 360 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 419
           ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 901 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 842

                                                                       
Query: 420 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 479
           ||| |||||||||||||| || ||||||||||||||||||||||||||||| || |||| 
Sbjct: 841 gcccacccagaagatccattggtcatcccaggccttgtccttgttgtagataaccgcggt 782

                                
Query: 480 ccccaggctcctggccgggtt 500
            |||| |||||| ||||||||
Sbjct: 781 tcccaagctcctcgccgggtt 761



to top

>dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E03, full
           insert sequence
          Length = 1214

 Score =  129 bits (65), Expect = 9e-27
 Identities = 122/141 (86%)
 Strand = Plus / Minus

                                                                       
Query: 360 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 419
           ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 901 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 842

                                                                       
Query: 420 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 479
           ||| |||||||||||||| || ||||||||||||||||||||||||||||| || |||| 
Sbjct: 841 gcccacccagaagatccattggtcatcccaggccttgtccttgttgtagataaccgcggt 782

                                
Query: 480 ccccaggctcctggccgggtt 500
            |||| |||||| ||||||||
Sbjct: 781 tcccaagctcctcgccgggtt 761



to top

>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete
           cds
          Length = 1156

 Score =  127 bits (64), Expect = 4e-26
 Identities = 109/124 (87%)
 Strand = Plus / Minus

                                                                       
Query: 378 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 437
           |||||||||||||  ||| ||||| || ||||||||||  ||||| ||||||||||||||
Sbjct: 893 gtactggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatcca 834

                                                                       
Query: 438 ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 497
            || || ||||||||||||||||||||||||||||| ||||| |||| |||||| |||||
Sbjct: 833 ttggtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaagctcctcgccgg 774

               
Query: 498 gttg 501
           ||||
Sbjct: 773 gttg 770



to top

>gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence
          Length = 1215

 Score =  119 bits (60), Expect = 9e-24
 Identities = 126/148 (85%)
 Strand = Plus / Minus

                                                                       
Query: 354 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 413
           |||| |||||| |||||| || | |||||||||||||  ||| ||||| || ||||| ||
Sbjct: 935 cttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccaat 876

                                                                       
Query: 414 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 473
           ||  || || |||||||||||||| || || |||||||||||||||||||||||||||||
Sbjct: 875 cagtggacccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgac 816

                                       
Query: 474 ggcggcccccaggctcctggccgggttg 501
            ||||| |||||| |||| |||||||||
Sbjct: 815 cgcggctcccaggatcctcgccgggttg 788



to top

>gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           complete cds
          Length = 1235

 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Minus

                                                                       
Query: 360 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 419
           ||||| |||||| || | |||||||||||||  ||| ||||| || ||||||||||  ||
Sbjct: 875 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagcgg 816

                                                                       
Query: 420 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 479
            || |||||||||||||| || ||||||||||||||||| |||||||||||||| || ||
Sbjct: 815 ccccacccagaagatccattggtcatcccaggccttgtctttgttgtagatgacagcagc 756

                                 
Query: 480 ccccaggctcctggccgggttg 501
            |||| ||| || |||||||||
Sbjct: 755 tcccaagcttctcgccgggttg 734



to top

>ref|NM_187081.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1215

 Score =  105 bits (53), Expect = 1e-19
 Identities = 104/121 (85%)
 Strand = Plus / Minus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 901 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 842

                                                                       
Query: 441 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 500
           ||||  |||||||||||  ||||||||||  |||||| | || |||||||||||||||||
Sbjct: 841 atcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggtt 782

            
Query: 501 g 501
           |
Sbjct: 781 g 781



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 325 tacgcgttgctcctgaaggagccg 348
           ||||||||||||| ||||||||||
Sbjct: 954 tacgcgttgctccggaaggagccg 931



to top

>dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132K03, full
           insert sequence
          Length = 1215

 Score =  105 bits (53), Expect = 1e-19
 Identities = 104/121 (85%)
 Strand = Plus / Minus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 901 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 842

                                                                       
Query: 441 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 500
           ||||  |||||||||||  ||||||||||  |||||| | || |||||||||||||||||
Sbjct: 841 atcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggtt 782

            
Query: 501 g 501
           |
Sbjct: 781 g 781



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 325 tacgcgttgctcctgaaggagccg 348
           ||||||||||||| ||||||||||
Sbjct: 954 tacgcgttgctccggaaggagccg 931



to top

>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds
          Length = 1104

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 119/142 (83%)
 Strand = Plus / Minus

                                                                       
Query: 360 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 419
           ||||| |||||| || | ||||||||||||    || ||||| || |||||||| |  ||
Sbjct: 825 ggcgctggccctcagcacgtactggtggtacgccgcggcgatggcggcgccgatgaatgg 766

                                                                       
Query: 420 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 479
            || |||||||||||||| || ||||||||||||||||| |||||||||||||| || ||
Sbjct: 765 acccacccagaagatccagtggtcatcccaggccttgtcgttgttgtagatgacagcagc 706

                                 
Query: 480 ccccaggctcctggccgggttg 501
            |||| ||||||||||||||||
Sbjct: 705 gcccaagctcctggccgggttg 684



to top

>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete
           cds
          Length = 1207

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 119/142 (83%)
 Strand = Plus / Minus

                                                                       
Query: 360 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 419
           ||||| |||||| || | ||||||||||||    || ||||| || |||||||| |  ||
Sbjct: 880 ggcgctggccctcagcacgtactggtggtacgccgcggcgatggcggcgccgatgaatgg 821

                                                                       
Query: 420 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 479
            || |||||||||||||| || ||||||||||||||||| |||||||||||||| || ||
Sbjct: 820 acccacccagaagatccagtggtcatcccaggccttgtcgttgttgtagatgacagcagc 761

                                 
Query: 480 ccccaggctcctggccgggttg 501
            |||| ||||||||||||||||
Sbjct: 760 gcccaagctcctggccgggttg 739



to top

>gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-1
           (PIP2-1) mRNA, complete cds
          Length = 1300

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 139/170 (81%)
 Strand = Plus / Minus

                                                                       
Query: 332 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtaga 391
           |||||||||| || || || |||||||| || || || || | |||| ||||||||||||
Sbjct: 912 tgctcctgaatgacccaagagccttgatagctccagctctcaatatgaactggtggtaga 853

                                                                       
Query: 392 aggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccagg 451
           |||| || || || || || || | ||| || ||||| ||||||||||| ||||||||||
Sbjct: 852 aggctgcaatggctgcaccaatgaagggtccaacccaaaagatccactggtcatcccagg 793

                                                             
Query: 452 ccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
           |||| || ||||||||||| || || |||||||  |||||||| ||||||
Sbjct: 792 ccttctcattgttgtagataacagcagcccccaaactcctggcagggttg 743



to top

>gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1) mRNA, complete
           cds
          Length = 480

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 139/170 (81%)
 Strand = Plus / Minus

                                                                       
Query: 332 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtaga 391
           |||||||||| || || || |||||||| || || || || | |||| ||||||||||||
Sbjct: 466 tgctcctgaatgacccaagagccttgatagctccagctctcaatatgaactggtggtaga 407

                                                                       
Query: 392 aggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccagg 451
           |||| || || || || || || | ||| || ||||| ||||||||||| ||||||||||
Sbjct: 406 aggctgcaatggctgcaccaatgaagggtccaacccaaaagatccactggtcatcccagg 347

                                                             
Query: 452 ccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
           |||| || ||||||||||| || || |||||||  |||||||| ||||||
Sbjct: 346 ccttctcattgttgtagataacagcagcccccaaactcctggcagggttg 297



to top

>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete
           cds
          Length = 1343

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 122/148 (82%)
 Strand = Plus / Minus

                                                                       
Query: 354 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 413
           |||| |||||| |||||| || | |||||||||||| ||||| ||||| || || |||||
Sbjct: 913 cttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggccccgat 854

                                                                       
Query: 414 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 473
            |  || || |||||||| ||||| || |||||||||||||| || ||||||||||| ||
Sbjct: 853 gaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcac 794

                                       
Query: 474 ggcggcccccaggctcctggccgggttg 501
           ||| || || | |||||| |||||||||
Sbjct: 793 ggcagctccgaagctcctcgccgggttg 766



to top

>gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds
          Length = 1216

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 106/127 (83%)
 Strand = Plus / Minus

                                                                       
Query: 375 tatgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagat 434
           |||| |||||||||||||||| || || || || || || | ||| || ||||| |||||
Sbjct: 873 tatgaactggtggtagaaggctgcaatggctgcaccaatgaagggtccaacccaaaagat 814

                                                                       
Query: 435 ccactgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggc 494
           |||||| |||||||||||||| || ||||||||||| || || |||||||  ||||||||
Sbjct: 813 ccactggtcatcccaggccttctcattgttgtagataacagcagcccccaaactcctggc 754

                  
Query: 495 cgggttg 501
            ||||||
Sbjct: 753 agggttg 747



to top

>ref|XM_473219.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 873

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 117/142 (82%)
 Strand = Plus / Minus

                                                                       
Query: 360 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 419
           ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||| | |||
Sbjct: 837 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 778

                                                                       
Query: 420 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 479
            || |||||||||||||| || |||| ||| ||||||| || ||||||||| || || ||
Sbjct: 777 ccccacccagaagatccagtggtcatgccatgccttgtgctggttgtagatcaccgcagc 718

                                 
Query: 480 ccccaggctcctggccgggttg 501
            |||| |||||| |||||||||
Sbjct: 717 tcccaagctccttgccgggttg 696



to top

>ref|NM_187084.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 852

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 89/105 (84%)
 Strand = Plus / Minus

                                                                       
Query: 397 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 456
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 782 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 723

                                                        
Query: 457 tccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
              |||||||||| ||||||||| || |||||||| |||||||||
Sbjct: 722 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttg 678



to top

>ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group), P0475E07.134 mRNA
          Length = 619

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 89/105 (84%)
 Strand = Plus / Minus

                                                                       
Query: 397 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 456
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 340 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 281

                                                        
Query: 457 tccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
              |||||||||| ||||||||| || |||||||| |||||||||
Sbjct: 280 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttg 236



to top

>dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-132-C10, full
           insert sequence
          Length = 618

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 89/105 (84%)
 Strand = Plus / Minus

                                                                       
Query: 397 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 456
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 339 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 280

                                                        
Query: 457 tccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
              |||||||||| ||||||||| || |||||||| |||||||||
Sbjct: 279 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttg 235



to top

>ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channel AT2G39010
           (PIP2;6/PIP2E) mRNA, complete cds
          Length = 1245

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                   
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 476
           ||||||||||||||||||||||||||||| ||||| |  |||||||||||||||||
Sbjct: 845 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggc 790



to top

>gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 1201

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                   
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 476
           ||||||||||||||||||||||||||||| ||||| |  |||||||||||||||||
Sbjct: 840 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggc 785



to top

>gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 870

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                   
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 476
           ||||||||||||||||||||||||||||| ||||| |  |||||||||||||||||
Sbjct: 758 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggc 703



to top

>gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 1169

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                   
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 476
           ||||||||||||||||||||||||||||| ||||| |  |||||||||||||||||
Sbjct: 842 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggc 787



to top

>emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB75ZE10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1128

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                   
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 476
           ||||||||||||||||||||||||||||| ||||| |  |||||||||||||||||
Sbjct: 819 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggc 764



to top

>emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS74ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1160

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                   
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 476
           ||||||||||||||||||||||||||||| ||||| |  |||||||||||||||||
Sbjct: 829 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggc 774



to top

>dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin, complete cds
          Length = 1318

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 379 tactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccac 438
           ||||||||||||  ||| || || || ||||||||||  || || |||||||||||||| 
Sbjct: 944 tactggtggtaggcggcggcaatggcggcgccgatcagtggccccacccagaagatccat 885

                                              
Query: 439 tgatcatcccaggccttgtccttgttgtagatgac 473
           || |||||||||||||||||  |||||||||||||
Sbjct: 884 tggtcatcccaggccttgtcagtgttgtagatgac 850



to top

>gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water channel protein MipH (MipH)
           mRNA, complete cds
          Length = 1347

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 376 atgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatc 435
           ||||| |||||||||| ||| ||||| || || || || |  || ||||||||||| |||
Sbjct: 890 atgtattggtggtagatggcggcgatggcagccccaatgaacggtccgacccagaaaatc 831

                                              
Query: 436 cactgatcatcccaggccttgtccttgttgtagat 470
           ||||||||||||||||||||||  |||||||||||
Sbjct: 830 cactgatcatcccaggccttgttgttgttgtagat 796



to top

>dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd
          Length = 1251

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 379 tactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccac 438
           ||||||||||||  ||| || || || ||||||||||  || || |||||||||||||| 
Sbjct: 864 tactggtggtaggcggcggcaatggcggcgccgatcagtggccccacccagaagatccat 805

                                              
Query: 439 tgatcatcccaggccttgtccttgttgtagatgac 473
           || |||||||||||||||||  |||||||||||||
Sbjct: 804 tggtcatcccaggccttgtcagtgttgtagatgac 770



to top

>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence
          Length = 698

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 92/110 (83%)
 Strand = Plus / Minus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 397 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 338

                                                             
Query: 441 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcc 490
            ||| ||||||| | || || |||||| || |||||||| || |||||||
Sbjct: 337 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctcc 288



to top

>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 92/110 (83%)
 Strand = Plus / Minus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 828 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 769

                                                             
Query: 441 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcc 490
            ||| ||||||| | || || |||||| || |||||||| || |||||||
Sbjct: 768 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctcc 719



to top

>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 92/110 (83%)
 Strand = Plus / Minus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 885 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 826

                                                             
Query: 441 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcc 490
            ||| ||||||| | || || |||||| || |||||||| || |||||||
Sbjct: 825 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctcc 776



to top

>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS
          Length = 1139

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 812 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 753

                             
Query: 484 aggctcctggccgggttg 501
           ||||||||||| ||||||
Sbjct: 752 aggctcctggctgggttg 735



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 71/82 (86%)
 Strand = Plus / Minus

                                                                            
Query: 360      ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 419
                ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 25184682 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 25184623

                                      
Query: 420      gccgacccagaagatccactga 441
                ||| ||||||||||||||||||
Sbjct: 25184622 gcccacccagaagatccactga 25184601



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                           
Query: 442      tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 500
                ||||||||||||||||||||||||||||| || ||||  |||| |||||| ||||||||
Sbjct: 25184038 tcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggtt 25183980



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 442      tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
                |||| |||||| | ||||||||||||||||| ||| || || ||||||||||| ||||||
Sbjct: 27065064 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 27065005



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 79     aaattaaaacaggaaaagga 98
              ||||||||||||||||||||
Sbjct: 751943 aaattaaaacaggaaaagga 751962



to top

>dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1469H02
          Length = 136602

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 71/82 (86%)
 Strand = Plus / Minus

                                                                         
Query: 360   ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 419
             ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 85075 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 85016

                                   
Query: 420   gccgacccagaagatccactga 441
             ||| ||||||||||||||||||
Sbjct: 85015 gcccacccagaagatccactga 84994



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                        
Query: 442   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 500
             ||||||||||||||||||||||||||||| || ||||  |||| |||||| ||||||||
Sbjct: 84431 tcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggtt 84373



to top

>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full
           insert sequence
          Length = 1128

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786

                             
Query: 484 aggctcctggccgggttg 501
           ||||||||||| ||||||
Sbjct: 785 aggctcctggctgggttg 768



to top

>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full
           insert sequence
          Length = 1205

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 900 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 841

                             
Query: 484 aggctcctggccgggttg 501
           ||||||||||| ||||||
Sbjct: 840 aggctcctggctgggttg 823



to top

>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full
           insert sequence
          Length = 1136

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786

                             
Query: 484 aggctcctggccgggttg 501
           ||||||||||| ||||||
Sbjct: 785 aggctcctggctgggttg 768



to top

>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1140

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 840 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 781

                             
Query: 484 aggctcctggccgggttg 501
           ||||||||||| ||||||
Sbjct: 780 aggctcctggctgggttg 763



to top

>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel
           protein, complete cds
          Length = 1116

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 843 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 784

                             
Query: 484 aggctcctggccgggttg 501
           ||||||||||| ||||||
Sbjct: 783 aggctcctggctgggttg 766



to top

>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 100/121 (82%)
 Strand = Plus / Minus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 898 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 839

                                                                       
Query: 441 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 500
            ||   |||||| |  ||| |||||||||||| ||| || || |||||||| ||||||||
Sbjct: 838 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 779

            
Query: 501 g 501
           |
Sbjct: 778 g 778



to top

>gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-2
           (PIP2-2) mRNA, complete cds
          Length = 1171

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 480
           |||||||||||||||||||| || |||||  | || || |||||||||||||||||||| 
Sbjct: 787 ccgacccagaagatccactggtcgtcccaaactttttcattgttgtagatgacggcggcg 728

                                
Query: 481 cccaggctcctggccgggttg 501
           || | ||||||||| ||||||
Sbjct: 727 ccgaagctcctggcggggttg 707



to top

>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds
          Length = 1147

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                       
Query: 417 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 476
           |||||| |||||||||||||| || |||| |||||| | |||| |||||||||||| |||
Sbjct: 877 ggggcccacccagaagatccaatggtcattccaggcatggtccctgttgtagatgatggc 818

                                    
Query: 477 ggcccccaggctcctggccgggttg 501
            ||||| |||||||| || ||||||
Sbjct: 817 agccccaaggctcctagctgggttg 793



to top

>ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channel AT4G23400
           (PIP1;5/PIP1D) mRNA, complete cds
          Length = 1128

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 480
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 834 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 775

                               
Query: 481 cccaggctcctggccgggtt 500
           || || ||||||||||||||
Sbjct: 774 ccgagactcctggccgggtt 755



to top

>gb|AY081593.1| Arabidopsis thaliana water channel-like protein (At4g23400) mRNA,
           complete cds
          Length = 956

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 480
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 785 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 726

                               
Query: 481 cccaggctcctggccgggtt 500
           || || ||||||||||||||
Sbjct: 725 ccgagactcctggccgggtt 706



to top

>gb|AY059948.1| Arabidopsis thaliana water channel - like protein (At4g23400;
           F16G20.100) mRNA, complete cds
          Length = 1125

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 480
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 834 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 775

                               
Query: 481 cccaggctcctggccgggtt 500
           || || ||||||||||||||
Sbjct: 774 ccgagactcctggccgggtt 755



to top

>dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - like protein, partial
           cds, clone: RAFL24-17-A12
          Length = 392

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 480
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 90  ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 31

                               
Query: 481 cccaggctcctggccgggtt 500
           || || ||||||||||||||
Sbjct: 30  ccgagactcctggccgggtt 11



to top

>emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB41ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 454

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 480
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 158 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 99

                               
Query: 481 cccaggctcctggccgggtt 500
           || || ||||||||||||||
Sbjct: 98  ccgagactcctggccgggtt 79



to top

>emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB51ZF11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 710

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 480
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 417 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 358

                               
Query: 481 cccaggctcctggccgggtt 500
           || || ||||||||||||||
Sbjct: 357 ccgagactcctggccgggtt 338



to top

>emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS16ZB08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1066

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 480
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 823 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 764

                               
Query: 481 cccaggctcctggccgggtt 500
           || || ||||||||||||||
Sbjct: 763 ccgagactcctggccgggtt 744



to top

>emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS21ZB06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 480
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 798 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 739

                               
Query: 481 cccaggctcctggccgggtt 500
           || || ||||||||||||||
Sbjct: 738 ccgagactcctggccgggtt 719



to top

>gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete sequence
          Length = 1089

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 480
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 832 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 773

                               
Query: 481 cccaggctcctggccgggtt 500
           || || ||||||||||||||
Sbjct: 772 ccgagactcctggccgggtt 753



to top

>gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasma membrane
           intrinsic protein mRNA, complete cds
          Length = 1120

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgta 467
           ||||||||||||||||| |||||||| |||||||||||||||||
Sbjct: 746 acccagaagatccactggtcatcccatgccttgtccttgttgta 703



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 331 ttgctcctgaaggagccgagggccttgatggc 362
           |||||||||||||| ||||| |||||||||||
Sbjct: 839 ttgctcctgaaggatccgagagccttgatggc 808



to top

>gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds
          Length = 534

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||| ||||| || ||||||||||| |  ||||||||||||||||  ||||| || 
Sbjct: 458 acccagaatatccaatgttcatcccaggcttgatccttgttgtagatgattgcggcacca 399

                             
Query: 484 aggctcctggccgggttg 501
           ||||||||||| ||||||
Sbjct: 398 aggctcctggcggggttg 381



to top

>gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, complete cds
          Length = 867

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||| ||||| || ||||||||||| |  ||||||||||||||||  ||||| || 
Sbjct: 788 acccagaatatccaatgttcatcccaggcttgatccttgttgtagatgattgcggcacca 729

                             
Query: 484 aggctcctggccgggttg 501
           ||||||||||| ||||||
Sbjct: 728 aggctcctggcggggttg 711



to top

>gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (pip1) mRNA,
           complete cds
          Length = 1152

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           |||||||| ||||| ||||||||||| |||||||| |||||||||||||
Sbjct: 799 acccagaatatccagtgatcatcccatgccttgtctttgttgtagatga 751



to top

>ref|XM_473480.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 72/85 (84%)
 Strand = Plus / Minus

                                                                       
Query: 417 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 476
           |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 774 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 715

                                    
Query: 477 ggcccccaggctcctggccgggttg 501
            || || |||||||| || ||||||
Sbjct: 714 agcgccaaggctcctcgctgggttg 690



to top

>gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein ZmPIP2-6 mRNA, complete
           cds
          Length = 1257

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                       
Query: 397 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 456
           ||||||||||| ||||| |  ||||| ||||||||||||||||| ||   |||||| |||
Sbjct: 884 gcgatcgccgctccgatgaacgggcccacccagaagatccactggtcgctccaggctttg 825

                                                        
Query: 457 tccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
              |||||||| | ||||||||| || |||||||| |||||||||
Sbjct: 824 ctgttgttgtacacgacggcggcgccgaggctcctcgccgggttg 780



to top

>gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, complete cds
          Length = 901

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 473
           ||||||||||| ||||| || ||||||||||||||||| ||||| ||||||||
Sbjct: 771 ccgacccagaacatccaatggtcatcccaggccttgtcgttgttatagatgac 719



to top

>gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds
          Length = 1070

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||| ||||| ||||||||||| || ||||| ||||||||||| |||||||| || 
Sbjct: 746 acccagaaaatccattgatcatcccaagctttgtctttgttgtagattacggcggctccg 687

                            
Query: 484 aggctcctggccgggtt 500
           | ||| ||||| |||||
Sbjct: 686 aagcttctggcggggtt 670



to top

>gb|AY170841.1| Axonopus compressus plasma membrane MIP protein mRNA, partial cds
          Length = 423

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 99/121 (81%)
 Strand = Plus / Minus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||||| ||| || |  || ||||| || | ||||||||||||||||||||| ||
Sbjct: 384 ctggtggtagatggcggctagggcagcgccaatgaaggggccgacccagaagatccaatg 325

                                                                       
Query: 441 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 500
            |||| |||||| |  ||| |||||||||||| ||| || || |||||||| || |||||
Sbjct: 324 gtcattccaggcgtgctccctgttgtagatgatggcagcgccaaggctcctagctgggtt 265

            
Query: 501 g 501
           |
Sbjct: 264 g 264



to top

>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full
           insert sequence
          Length = 1163

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 72/85 (84%)
 Strand = Plus / Minus

                                                                       
Query: 417 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 476
           |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 851 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 792

                                    
Query: 477 ggcccccaggctcctggccgggttg 501
            || || |||||||| || ||||||
Sbjct: 791 agcgccaaggctcctcgctgggttg 767



to top

>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full
           insert sequence
          Length = 1164

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 99/121 (81%)
 Strand = Plus / Minus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||||| ||| || |  || ||||| || | |||||| |||||||||||||| ||
Sbjct: 888 ctggtggtagatggcagcaagggcagcgccaatgaaggggccaacccagaagatccaatg 829

                                                                       
Query: 441 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 500
            ||||||||||| | | || |||||||||||| ||| || || |||||||| || |||||
Sbjct: 828 gtcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggtt 769

            
Query: 501 g 501
           |
Sbjct: 768 g 768



to top

>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full
           insert sequence
          Length = 1167

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 72/85 (84%)
 Strand = Plus / Minus

                                                                       
Query: 417 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 476
           |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 854 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 795

                                    
Query: 477 ggcccccaggctcctggccgggttg 501
            || || |||||||| || ||||||
Sbjct: 794 agcgccaaggctcctcgctgggttg 770



to top

>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full
            insert sequence
          Length = 1462

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 72/85 (84%)
 Strand = Plus / Minus

                                                                        
Query: 417  ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 476
            |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 1150 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 1091

                                     
Query: 477  ggcccccaggctcctggccgggttg 501
             || || |||||||| || ||||||
Sbjct: 1090 agcgccaaggctcctcgctgggttg 1066



to top

>emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.1 gene)
          Length = 943

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 417 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           |||||| |||||||| ||||| ||||||||||||||  ||||||||||| ||||||
Sbjct: 883 ggggccaacccagaaaatccagtgatcatcccaggcgctgtccttgttgaagatga 828



to top

>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin
          Length = 1291

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                        
Query: 381  ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
            ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||||||
Sbjct: 1291 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccactg 1232



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 461 tgttgtagatgacggcggcccccaggctcctggccgggttg 501
           |||||||||||| ||| || || |||||||| |||||||||
Sbjct: 657 tgttgtagatgatggccgcgccgaggctcctcgccgggttg 617



to top

>emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.2 gene)
          Length = 1124

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 418 gggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcg 477
           ||||| |||||||||||||| || |||||||| || | ||| |||||| |||||| ||||
Sbjct: 866 gggccaacccagaagatccagtggtcatcccatgcatggtctttgttgaagatgatggcg 807

                                  
Query: 478 gcccccaggctcctggccgggtt 500
           || || || ||||| ||||||||
Sbjct: 806 gctccaagactccttgccgggtt 784



to top

>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1
           (PIP1-1) mRNA, complete cds
          Length = 1115

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||||||||| || || ||||| || | ||||||||||||||||| ||| || |||
Sbjct: 810 acccagaagatccagtggtcgtcccatgcgtggtccttgttgtagatgatggccgcaccc 751

                  
Query: 484 aggctcc 490
           |||||||
Sbjct: 750 aggctcc 744



to top

>dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membrane intrinsic protein
           2-1, complete cds
          Length = 1311

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 115/143 (80%)
 Strand = Plus / Minus

                                                                       
Query: 331 ttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtag 390
           ||||| ||||| || || || ||||||||||| || || || || ||||| |||||||||
Sbjct: 907 ttgcttctgaaagatcccagagccttgatggctcctgctctcagaatgtattggtggtag 848

                                                                       
Query: 391 aaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccag 450
           ||||| || || || || || || |  || || | |||||||||||| || |||||||| 
Sbjct: 847 aaggcagcaatggcagctccaatgaaaggtccaagccagaagatccattggtcatcccaa 788

                                  
Query: 451 gccttgtccttgttgtagatgac 473
           || ||||||||||| ||||||||
Sbjct: 787 gctttgtccttgttatagatgac 765



to top

>emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.4 gene)
          Length = 1135

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 66/78 (84%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||||||||| || |  |||||||||||||| | ||||||||| || ||||| |||
Sbjct: 771 acccagaagatccagtggtggtcccaggccttgtcttggttgtagataacagcggctccc 712

                             
Query: 484 aggctcctggccgggttg 501
           || ||||| || ||||||
Sbjct: 711 agactcctagcagggttg 694



to top

>emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.2 gene)
          Length = 978

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 66/78 (84%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||| ||||| |||||||||||||| || || |||||| ||||||| || || || 
Sbjct: 826 acccagaaaatccaatgatcatcccaggctttttcattgttgaagatgacagcagcgcca 767

                             
Query: 484 aggctcctggccgggttg 501
           | ||||||||| ||||||
Sbjct: 766 aagctcctggcagggttg 749



to top

>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 96/118 (81%)
 Strand = Plus / Minus

                                                                       
Query: 384 gtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatc 443
           ||||||||  ||||| | |||||||||||| |  || || |||||||||||||| || ||
Sbjct: 914 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 855

                                                                     
Query: 444 atcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
            ||||| ||||  | |||||||||||||| |||||| || |||  ||| |||||||||
Sbjct: 854 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttg 797



to top

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 96/118 (81%)
 Strand = Plus / Minus

                                                                       
Query: 384 gtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatc 443
           |||||||| |||||| | |||||| ||||| |  || || |||||||||||||| || ||
Sbjct: 899 gtggtagatggccgccagcgccgcaccgatgaacggaccaacccagaagatccagtggtc 840

                                                                     
Query: 444 atcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
            ||||| ||||  | |||||||||||||| |||||| || |||  ||| |||||||||
Sbjct: 839 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttg 782



to top

>ref|XM_475029.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 425 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 484
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 742 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 683

                            
Query: 485 ggctcctggccgggttg 501
            ||||| ||| ||||||
Sbjct: 682 tgctccgggcagggttg 666



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 330 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 386
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 837 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 781



to top

>emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.5 gene)
          Length = 1094

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 480
           ||||||||||||||||| || |||||||| |||||||| | |||||| || || || || 
Sbjct: 809 ccgacccagaagatccaatggtcatcccatgccttgtcttcgttgtatatcacagcagct 750

                                
Query: 481 cccaggctcctggccgggttg 501
           || | |||||| |||||||||
Sbjct: 749 ccaaagctcctagccgggttg 729



to top

>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           |||||||||||||| || ||||||||||| | |||| ||||||||||||
Sbjct: 770 acccagaagatccagtggtcatcccaggcgtggtccctgttgtagatga 722



to top

>dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds
          Length = 1278

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 426 ccagaagatccactgatcatcccaggccttgtccttgttgtagat 470
           |||||||||||| || |||||||| || |||||||||||||||||
Sbjct: 768 ccagaagatccattggtcatcccaagctttgtccttgttgtagat 724



to top

>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete
           cds
          Length = 1153

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 98/121 (80%)
 Strand = Plus / Minus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||| ||
Sbjct: 940 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 881

                                                                       
Query: 441 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 500
            ||   ||| || |  |||  ||||||||||| |||||| || |||||||| ||||||||
Sbjct: 880 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 821

            
Query: 501 g 501
           |
Sbjct: 820 g 820



to top

>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete
           cds
          Length = 1296

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 98/121 (80%)
 Strand = Plus / Minus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||| ||
Sbjct: 935 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 876

                                                                       
Query: 441 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 500
            ||   ||| || |  |||  ||||||||||| |||||| || |||||||| ||||||||
Sbjct: 875 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 816

            
Query: 501 g 501
           |
Sbjct: 815 g 815



to top

>dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-B01, full
           insert sequence
          Length = 1067

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 425 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 484
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 728 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 669

                            
Query: 485 ggctcctggccgggttg 501
            ||||| ||| ||||||
Sbjct: 668 tgctccgggcagggttg 652



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 332 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 386
           |||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 821 tgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 767



to top

>dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086E18, full
           insert sequence
          Length = 1308

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 425 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 484
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 841 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 782

                            
Query: 485 ggctcctggccgggttg 501
            ||||| ||| ||||||
Sbjct: 781 tgctccgggcagggttg 765



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 330 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 386
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 936 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 880



to top

>dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-B05, full
           insert sequence
          Length = 1309

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 425 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 484
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 835 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 776

                            
Query: 485 ggctcctggccgggttg 501
            ||||| ||| ||||||
Sbjct: 775 tgctccgggcagggttg 759



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 330 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 386
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 930 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 874



to top

>dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-B10, full
           insert sequence
          Length = 1296

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 425 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 484
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 829 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 770

                            
Query: 485 ggctcctggccgggttg 501
            ||||| ||| ||||||
Sbjct: 769 tgctccgggcagggttg 753



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 330 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 386
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 924 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 868



to top

>gb|AY103580.1| Zea mays PCO072544 mRNA sequence
          Length = 1633

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 98/121 (80%)
 Strand = Plus / Minus

                                                                        
Query: 381  ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
            ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||| ||
Sbjct: 1264 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 1205

                                                                        
Query: 441  atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 500
             ||   ||| || |  |||  ||||||||||| |||||| || |||||||| ||||||||
Sbjct: 1204 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 1145

             
Query: 501  g 501
            |
Sbjct: 1144 g 1144



to top

>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds
          Length = 1280

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 71/85 (83%)
 Strand = Plus / Minus

                                                                       
Query: 417 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 476
           ||||||||||||||||||||| || || | |||||| |  ||| |||||||||||| |||
Sbjct: 855 ggggccgacccagaagatccaatggtcgttccaggcgtgatccctgttgtagatgatggc 796

                                    
Query: 477 ggcccccaggctcctggccgggttg 501
            || || |||||||| || ||||||
Sbjct: 795 agcgccaaggctcctagctgggttg 771



to top

>dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membrane intrinsic protein
           2-2, complete cds
          Length = 1051

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                       
Query: 382 tggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactga 441
           |||||||||||||| || || || || || || | ||| || |||||||| ||||| || 
Sbjct: 874 tggtggtagaaggctgcaattgctgctccaatgaagggtcctacccagaaaatccattgg 815

                                        
Query: 442 tcatcccaggccttgtccttgttgtagat 470
           |||||||| |||||||| |||||||||||
Sbjct: 814 tcatcccaagccttgtctttgttgtagat 786



to top

>gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker
          Length = 824

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||||||
Sbjct: 288 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccactg 347



to top

>gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker
          Length = 763

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||||||
Sbjct: 489 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccactg 430



to top

>gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds
          Length = 740

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 425 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 484
           ||||||| ||||||||||||||||| | ||| |  ||||||||||| || ||||| ||||
Sbjct: 481 cccagaaaatccactgatcatcccatgtcttttttttgttgtagatcacagcggctccca 422

                           
Query: 485 ggctcctggccgggtt 500
            ||| | |||||||||
Sbjct: 421 agctacgggccgggtt 406



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                            
Query: 360      ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 419
                ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||| | |||
Sbjct: 26074829 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 26074770

                                    
Query: 420      gccgacccagaagatccact 439
                 || ||||||||||||||||
Sbjct: 26074769 ccccacccagaagatccact 26074750



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                        
Query: 330     gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 386
               |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 8906703 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 8906759



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                        
Query: 445     tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
               ||||| ||||| | || |||||||||||||||||| || | ||||| ||| ||||||
Sbjct: 8906901 tcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagggttg 8906957



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 417      ggggccgacccagaagatccactg 440
                |||||| |||||||||||||||||
Sbjct: 28021379 ggggccaacccagaagatccactg 28021356



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                            
Query: 442      tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
                ||||||||||| | | || |||||||||||| ||| || || |||||||| || ||||||
Sbjct: 28020793 tcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggttg 28020734



to top

>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1486_E07
          Length = 110494

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 442   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
             |||| |||||| | ||||||||||||||||| ||| || || ||||||||||| ||||||
Sbjct: 36713 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 36654



to top

>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0475E07
          Length = 139961

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                          
Query: 381    ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
              ||||||||| |  |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 102547 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 102488



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 381   ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
             ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 92511 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 92452



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                         
Query: 438   ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 497
             |||||||  |||||||||||  ||||||||||  |||||| | || ||||||||||||||
Sbjct: 92340 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 92281

                 
Query: 498   gttg 501
             ||||
Sbjct: 92280 gttg 92277



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                        
Query: 460    ttgttgtagatgacggcggcccccaggctcctggccgggttg 501
              |||||||| ||||||||||| || |||||||| |||||||||
Sbjct: 102369 ttgttgtacatgacggcggcgccgaggctcctcgccgggttg 102328



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                          
Query: 397    gcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
              ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 110444 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 110401



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 325   tacgcgttgctcctgaaggagccg 348
             ||||||||||||| ||||||||||
Sbjct: 92564 tacgcgttgctccggaaggagccg 92541



to top

>dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0461B08
          Length = 153743

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                          
Query: 442    tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
              |||| |||||| | ||||||||||||||||| ||| || || ||||||||||| ||||||
Sbjct: 118266 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 118207



to top

>gb|AY107589.1| Zea mays PCO085320 mRNA sequence
          Length = 569

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                       
Query: 418 gggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcg 477
           |||||||||||||| ||||| ||||| ||||| |||||   || |||||| |  ||||| 
Sbjct: 194 gggccgacccagaatatccagtgatcctcccacgcctttcgctggttgtacacaacggcc 135

                                   
Query: 478 gcccccaggctcctggccgggttg 501
           | |||||||||||| |||||||||
Sbjct: 134 ggccccaggctccttgccgggttg 111



to top

>emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019D11,
              complete sequence
          Length = 163039

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                          
Query: 360    ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 419
              ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||| | |||
Sbjct: 109156 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 109097

                                  
Query: 420    gccgacccagaagatccact 439
               || ||||||||||||||||
Sbjct: 109096 ccccacccagaagatccact 109077



to top

>emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.3 gene)
          Length = 1187

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 470
           |||||||| ||||| || |||||||| ||||| ||||||||||||||
Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagat 754



to top

>emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides mRNA for major intrinsic
           protein 1 (mip1 gene)
          Length = 1187

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 470
           |||||||| ||||| || |||||||| ||||| ||||||||||||||
Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagat 754



to top

>gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, complete cds
          Length = 909

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 470
           |||||||||||||| || |||||||| ||||| || |||||||||||
Sbjct: 740 acccagaagatccaatggtcatcccacgccttctcgttgttgtagat 694



to top

>gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1086

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 65/78 (83%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||| ||||| || |||||||| |||| ||| |||||||||||||  || || || 
Sbjct: 815 acccagaaaatccagtggtcatcccatgcctcgtctttgttgtagatgatagcagctcca 756

                             
Query: 484 aggctcctggccgggttg 501
           || |||||||| ||||||
Sbjct: 755 agactcctggcagggttg 738



to top

>ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative aquaporin
           (OSJNBa0093B11.9), mRNA
          Length = 729

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||||||||||||||| | ||| || |||  || |||||||| ||||||||| || 
Sbjct: 626 acccagaagatccactgatcgtgccaagcattgggctggttgtagacgacggcggcgccg 567

                         
Query: 484 aggctcctggccgg 497
           | |||||| |||||
Sbjct: 566 aagctcctcgccgg 553



to top

>gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-2
           (PIP1-2) mRNA, complete cds
          Length = 1154

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 65/78 (83%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||| ||||||   ||||||||||| |  || |||||||||| || ||||||||||
Sbjct: 841 acccagaaaatccacatgtcatcccaggcatgctctttgttgtagacgatggcggccccc 782

                             
Query: 484 aggctcctggccgggttg 501
           || ||||| || ||||||
Sbjct: 781 agactcctagcagggttg 764



to top

>gb|U56603.1|BMU56603 Bufo marinus vasopressin-insensitive water channel AQP-t1 mRNA,
           complete cds
          Length = 939

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 409 ccgatcatggggccgacccagaagatccactgat 442
           ||||||||||| ||||||||||||||||| ||||
Sbjct: 761 ccgatcatgggaccgacccagaagatccagtgat 728



to top

>gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1a) mRNA, complete cds
          Length = 1129

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 65/78 (83%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||| ||||||   ||||||||||| |  ||  |||||||||||| ||||||||||
Sbjct: 833 acccagaaaatccacatgtcatcccaggcatgctctctgttgtagatgatggcggccccc 774

                             
Query: 484 aggctcctggccgggttg 501
           || ||||| || ||||||
Sbjct: 773 agactcctagcagggttg 756



to top

>dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-C02, full
           insert sequence
          Length = 1232

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||||||||||||||| | ||| || |||  || |||||||| ||||||||| || 
Sbjct: 808 acccagaagatccactgatcgtgccaagcattgggctggttgtagacgacggcggcgccg 749

                         
Query: 484 aggctcctggccgg 497
           | |||||| |||||
Sbjct: 748 aagctcctcgccgg 735



to top

>gb|AF020620.1| Bufo marinus aquaporin-1 homolog (AQP-t1) mRNA, complete cds
          Length = 939

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 409 ccgatcatggggccgacccagaagatccactgat 442
           ||||||||||| ||||||||||||||||| ||||
Sbjct: 761 ccgatcatgggaccgacccagaagatccagtgat 728



to top

>gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1153

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 65/78 (83%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||||||||| || |||| ||| |||| ||| |||||||||||||  || || || 
Sbjct: 825 acccagaagatccagtggtcattccatgcctcgtctttgttgtagatgatagcagctcca 766

                             
Query: 484 aggctcctggccgggttg 501
           || |||||||| ||||||
Sbjct: 765 agactcctggcagggttg 748



to top

>dbj|AB002149.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1064

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 65/78 (83%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||||||||| ||||||||||| |||| ||| | |||| ||||||  || || || 
Sbjct: 815 acccagaagatccagtgatcatcccatgcctggtcgtggttgaagatgatagcagctcca 756

                             
Query: 484 aggctcctggccgggttg 501
           ||||||| ||| ||||||
Sbjct: 755 aggctccgggcggggttg 738



to top

>ref|NM_115339.2| Arabidopsis thaliana PIP2;5/PIP2D; water channel AT3G54820
           (PIP2;5/PIP2D) mRNA, complete cds
          Length = 1229

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 851 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 803



to top

>gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence
          Length = 1154

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 437
           ||||||||||| ||| || |  || |||||||| | |||||||||||||||||||||
Sbjct: 790 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatcca 734



to top

>gb|BT000670.1| Arabidopsis thaliana clone RAFL07-09-N03 (R10758) putative
           aquaporin/plasma membrane intrinsic protein (At3g54820)
           mRNA, complete cds
          Length = 1143

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 771 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 723



to top

>emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel protein (mipB)
          Length = 1114

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 480
           |||||||| |||| ||| || |||||||| || |||||||||||| |||||| ||| || 
Sbjct: 800 ccgacccaaaagacccaatggtcatcccaagcgttgtccttgttgaagatgatggcagct 741

                                
Query: 481 cccaggctcctggccgggttg 501
           || || ||||| || ||||||
Sbjct: 740 ccaagactccttgctgggttg 720



to top

>gb|AY062981.1| Arabidopsis thaliana putative aquaporin/MIP protein (At3g54820)
           mRNA, complete cds
          Length = 892

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 755 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 707



to top

>gb|AF370351.1| Arabidopsis thaliana putative aquaporin/MIP protein (At3g54820)
           mRNA, complete cds
          Length = 1194

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 850 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 802



to top

>emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0093G06,
             complete sequence
          Length = 127420

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 330   gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 386
             |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 91012 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 91068



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                      
Query: 445   tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
             ||||| ||||| | || |||||||||||||||||| || | ||||| ||| ||||||
Sbjct: 91210 tcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagggttg 91266



to top

>gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, complete cds
          Length = 1084

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           |||||||||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 815 acccagaagacccaatggtcatcccaagcgttgtccttgttgaagatga 767



to top

>emb|BX822631.1|CNS0A61A Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB54ZF09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 897

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 571 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 523



to top

>gb|AY084843.1| Arabidopsis thaliana clone 11929 mRNA, complete sequence
          Length = 1222

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 852 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 804



to top

>emb|AJ605575.1| Ricinus communis mRNA for aquaporin (Pip2-1 gene), clone pP5L
          Length = 1157

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||| ||||| || ||||||||  | ||||| |||||||||||||| || || || 
Sbjct: 819 acccagaaaatccaatggtcatcccacactttgtcattgttgtagatgacagcagctcca 760

                            
Query: 484 aggctcctggccgggtt 500
           | ||||||||| |||||
Sbjct: 759 aagctcctggctgggtt 743



to top

>emb|AJ605574.1| Ricinus communis mRNA for aquaporin (Pip1-1 gene), clone pP2L
          Length = 1095

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           |||||||| ||||| |||||||||||| | | |||||||||| ||||||
Sbjct: 868 acccagaaaatccaatgatcatcccagccttggtccttgttgaagatga 820



to top

>gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein (Mip1) mRNA, partial cds
          Length = 539

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                       
Query: 417 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 476
           ||||||||||||||||||||| || ||   |||||| |  ||| |||||||||||| |||
Sbjct: 280 ggggccgacccagaagatccaatggtcgctccaggcatgatccctgttgtagatgatggc 221

                                    
Query: 477 ggcccccaggctcctggccgggttg 501
            || || |||||||| || ||||||
Sbjct: 220 agcgccaaggctcctagctgggttg 196



to top

>gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel protein MipC mRNA,
           complete cds
          Length = 1066

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 476
           |||||||| ||||| ||||||||||||||||| |  | ||||||||| |||||
Sbjct: 838 acccagaaaatccaatgatcatcccaggccttctgttggttgtagatcacggc 786



to top

>gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel protein-like mRNA,
           complete cds
          Length = 1172

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           |||||||||||||| || |||| ||| |||| ||| |||||||||||||
Sbjct: 815 acccagaagatccagtggtcattccatgcctcgtctttgttgtagatga 767



to top

>gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA
          Length = 582

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 476
           |||||||| ||||| ||||||||||||||||| |  | ||||||||| |||||
Sbjct: 354 acccagaaaatccaatgatcatcccaggccttctgttggttgtagatcacggc 302



to top

>ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G01620 (PIP1C) mRNA,
           complete cds
          Length = 1251

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 908 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 857



to top

>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c
          Length = 986

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 814 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 763



to top

>emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B
          Length = 1057

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 795 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 744



to top

>emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 59
          Length = 199199

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                         
Query: 457   tccttgttgtagatgacggcggcccccaggctcctggccgggtt 500
             |||||||||||||||| ||| || || || ||||||||||||||
Sbjct: 75489 tccttgttgtagatgatggcagctccgagactcctggccgggtt 75446



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 421   ccgacccagaagatccactg 440
             ||||||||||||||||||||
Sbjct: 75658 ccgacccagaagatccactg 75639



to top

>emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, BAC clone F16G20 (ESSAII
             project)
          Length = 97006

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                         
Query: 457   tccttgttgtagatgacggcggcccccaggctcctggccgggtt 500
             |||||||||||||||| ||| || || || ||||||||||||||
Sbjct: 33957 tccttgttgtagatgatggcagctccgagactcctggccgggtt 33914



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 421   ccgacccagaagatccactg 440
             ||||||||||||||||||||
Sbjct: 34126 ccgacccagaagatccactg 34107



to top

>gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (F22L4.16) mRNA, complete cds
          Length = 1031

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 836 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 785



to top

>gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative plasma membrane
           intrinsic protein 1c (At1g01620) mRNA, complete cds
          Length = 861

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 782 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 731



to top

>gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           partial cds
          Length = 411

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 442 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
           |||| ||||||| |||| |||||||||||||| || || |||| ||| || |||||||||
Sbjct: 407 tcattccaggccctgtctttgttgtagatgacagcagctcccaagcttctcgccgggttg 348



to top

>emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZE08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 963

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 826 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 775



to top

>dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane intrinsic protein
           2;5, complete cds
          Length = 1126

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgta 467
           |||||||||||||| || |||||||| |||||| | ||||||||
Sbjct: 786 acccagaagatccaatggtcatcccaagccttgccattgttgta 743



to top

>gb|AF255795.1|AF255795 Allium cepa aquaporin 1 (Aqp1) mRNA, complete cds
          Length = 1237

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgta 467
           |||||||| ||||||||||| ||||| || || |||||||||||
Sbjct: 816 acccagaatatccactgatcgtcccaagctttatccttgttgta 773



to top

>emb|AJ605569.1| Ricinus communis partial mRNA for putative aquaporin (Pip2-1 gene),
           clone pR450-8
          Length = 452

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 425 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 484
           ||||| ||||||| || ||||||||  | ||||| |||||||||||||| || || || |
Sbjct: 445 cccagtagatccaatggtcatcccacactttgtcattgttgtagatgacagcagctccaa 386

                           
Query: 485 ggctcctggccgggtt 500
            ||||||||| |||||
Sbjct: 385 agctcctggctgggtt 370



to top

>emb|AJ605565.1| Ricinus communis partial mRNA for putative aquaporin (Pip2-2 gene),
           clone pR450-3
          Length = 452

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 435 ccactgatcatcccaggccttgtccttgttgtagat 470
           |||||| |||||||| ||||| ||||||||||||||
Sbjct: 435 ccactggtcatcccatgccttctccttgttgtagat 400



to top

>gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (At1g01620) mRNA, complete cds
          Length = 903

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 782 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 731



to top

>ref|NM_119676.2| Arabidopsis thaliana PIP3 (PLASMA MEMBRANE INTRINSIC PROTEIN 3);
           water channel AT4G35100 (PIP3) mRNA, complete cds
          Length = 1182

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 470
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 786 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 740



to top

>gb|DQ226873.1| Boechera divaricarpa isolate SLW-C-G04 mRNA sequence
          Length = 514

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 470
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 163 acccaaaagatccaatggtcatcccaagccttctcgttgttgtagat 117



to top

>gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, complete cds
          Length = 1278

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 376 atgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatc 435
           ||||||||||| ||||| || || || || || || || | ||| ||||||||||| |||
Sbjct: 937 atgtactggtgatagaatgcagctattgcggcaccaatgaagggtccgacccagaaaatc 878

                                      
Query: 436 cactgatcatcccaggccttgtccttg 462
           || || |||||||| ||||| ||||||
Sbjct: 877 cattggtcatcccatgccttatccttg 851



to top

>emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic protein 1
          Length = 1108

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 470
           |||||||||||||| || |||||||| |||| ||| | |||||||||
Sbjct: 863 acccagaagatccagtggtcatcccatgcctggtcttggttgtagat 817



to top

>gb|AF367458.1| Prunus persica clone Mip2 membrane intrinsic protein (mip2) mRNA,
           partial cds
          Length = 495

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 440 gatcatcccaggccttgtccttgttgtagat 470
           |||| |||||||| |||||||||||||||||
Sbjct: 490 gatcgtcccaggctttgtccttgttgtagat 460



to top

>gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map CIC10A06, complete
             sequence
          Length = 96827

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                    
Query: 438   ctgatcatcccaggccttgtccttgttgtagatgacggc 476
             |||||||||||| ||||| |  |||||||||||||||||
Sbjct: 65646 ctgatcatcccaagccttttgattgttgtagatgacggc 65608



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 421   ccgacccagaagatccactg 440
             ||||||||||||||||||||
Sbjct: 65741 ccgacccagaagatccactg 65722



to top

>gb|AY081580.1| Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           (At4g35100) mRNA, complete cds
          Length = 946

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 470
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 737 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 691



to top

>gb|AY062803.1| Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           (At4g35100; M4E13.150) mRNA, complete cds
          Length = 1036

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 470
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 784 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 738



to top

>gb|AF412110.1|AF412110 Arabidopsis thaliana AT4g35100/M4E13_150 mRNA, complete cds
          Length = 1026

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 470
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 786 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 740



to top

>gb|AF003728.1|AF003728 Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           mRNA, complete cds
          Length = 1030

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 470
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 765 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 719



to top

>emb|BX826680.1|CNS0A37C Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB53ZH03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1036

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 470
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 777 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 731



to top

>emb|BX826294.1|CNS0A39S Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB11ZA04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 999

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 470
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 775 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 729



to top

>emb|BX827919.1|CNS0A2ZT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH35ZA10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1019

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 470
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 774 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 728



to top

>emb|BX827124.1|CNS0A2UI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS11ZH09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 985

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 470
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 769 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 723



to top

>gb|AY995195.1| Phaseolus vulgaris putative aquaporin (PIP2;1) mRNA, complete cds
          Length = 1330

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 470
           |||||||| ||||||||||||||||||   || || |||||||||||
Sbjct: 810 acccagaaaatccactgatcatcccagattttttcattgttgtagat 764



to top

>dbj|AB206100.1| Mimosa pudica pip2;2 mRNA for plasma membrane intrinsic protein
           2;2, complete cds
          Length = 1223

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 470
           |||||||| ||||| |||||||||||   ||| ||||||||||||||
Sbjct: 819 acccagaatatccaatgatcatcccaaatcttatccttgttgtagat 773



to top

>dbj|AB206099.1| Mimosa pudica pip2;1 mRNA for plasma membrane intrinsic protein
           2;1, complete cds
          Length = 1235

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 418 gggccgacccagaagatccactgatcatcccaggccttg 456
           ||||| |||||||| ||||| ||||||||||| ||||||
Sbjct: 804 gggccaacccagaaaatccaatgatcatcccaagccttg 766



to top

>gb|AY088485.1| Arabidopsis thaliana clone 7108 mRNA, complete sequence
          Length = 1033

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 470
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 786 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 740



to top

>dbj|D85193.1| Arabidopsis thaliana mRNA, partial cds
          Length = 748

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 470
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 476 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 430



to top

>gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, complete cds
          Length = 1192

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 421 ccgacccagaagatccactgatcatcccaggcctt 455
           |||||||| || ||||| |||||||||||||||||
Sbjct: 816 ccgacccaaaatatccattgatcatcccaggcctt 782



to top

>gb|U78297.1|ATU78297 Arabidopsis thaliana plasma membrane intrinsic protein PIP3 mRNA,
           complete cds
          Length = 1046

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 470
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 784 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 738



to top

>gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, complete cds
          Length = 1071

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 418 gggccgacccagaagatccactgatcatcccaggccttg 456
           ||||| ||||||||||||||||| || ||||| ||||||
Sbjct: 777 gggccaacccagaagatccactggtcgtcccaagccttg 739



to top

>gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic protein 2-like mRNA,
           complete cds
          Length = 1277

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtc 458
           ||||||||||| ||||| || |||||||| ||||||||
Sbjct: 828 ccgacccagaaaatccagtgttcatcccacgccttgtc 791



to top

>gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (pip2) mRNA,
           complete cds
          Length = 1260

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 473
           ||||| || ||||| || |||||||||| |||||| | ||||||||||||
Sbjct: 843 acccaaaaaatccaatggtcatcccagggcttgtcttcgttgtagatgac 794



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 352 gccttgatggcgccggccctgagtatgtactggtggtaga 391
           ||||||||||| || ||||| || ||||| ||||||||||
Sbjct: 915 gccttgatggctcctgcccttaggatgtattggtggtaga 876



to top

>gb|AY189973.1| Juglans regia plasma intrinsic protein 2,1 mRNA, complete cds
          Length = 1278

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 473
           |||||||| ||||| || |||| ||| ||||||||||||  |||||||||
Sbjct: 838 acccagaaaatccattggtcattccatgccttgtccttgccgtagatgac 789



to top

>emb|AJ005869.1|CAR005869 Cicer arietinum mRNA for putative transmembrane channel protein,
           partial
          Length = 634

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 424 acccagaagatccactgatcatccca 449
           |||||||||||||| |||||||||||
Sbjct: 269 acccagaagatccaatgatcatccca 244



to top

>gb|AF367460.1| Prunus persica clone Mip3 membrane intrinsic protein (mip3) mRNA,
           partial cds
          Length = 495

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 445 tcccaggccttgtccttgttgtagat 470
           |||||||||||||| |||||||||||
Sbjct: 485 tcccaggccttgtcattgttgtagat 460



to top

>gb|U22658.1|BMU22658 Bufo marinus urinary bladder aquaporin mRNA, complete cds
          Length = 819

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 409 ccgatcatggggccgacccagaagatccactgat 442
           |||||||| || ||||||||||||||||| ||||
Sbjct: 662 ccgatcatcggaccgacccagaagatccagtgat 629



to top

>gb|AF386739.1|AF386739 Medicago truncatula aquaporin protein PIP1;1 (PIP1;1) mRNA,
           complete cds
          Length = 1244

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 424 acccagaagatccactgatcatccca 449
           |||||||||||||| |||||||||||
Sbjct: 845 acccagaagatccagtgatcatccca 820



to top

>gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, complete cds
          Length = 1101

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           ||||| |||| ||| || |||||||| || |||||||||||| |||||| ||| || || 
Sbjct: 798 acccaaaagacccaatggtcatcccaagcgttgtccttgttgaagatgatggcagctcca 739

                             
Query: 484 aggctcctggccgggttg 501
           || ||||| || ||||||
Sbjct: 738 agactccttgctgggttg 721



to top

>gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein ZmPIP1-6 mRNA, complete
           cds
          Length = 1325

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 460 ttgttgtagatgacggcggcccccaggctcctggccgggttg 501
           |||| |||||||| |||||| || ||||||||||| ||||||
Sbjct: 968 ttgtcgtagatgatggcggcgccgaggctcctggcggggttg 927



to top

>dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane intrinsic protein
           2;4, complete cds
          Length = 1263

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 460 ttgttgtagatgacggcggcccccaggctcctggccgggttg 501
           |||||||| ||||| || ||||| | ||||||||||||||||
Sbjct: 759 ttgttgtacatgactgcagccccaaagctcctggccgggttg 718



to top

>emb|AJ605568.1| Ricinus communis partial mRNA for putative aquaporin (Pip2-3 gene),
           clone pR450-4
          Length = 452

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 442 tcatcccaggccttgtccttgttgta 467
           ||||||||||||||||||| ||||||
Sbjct: 428 tcatcccaggccttgtcctggttgta 403



to top

>dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1223

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||| ||||| || ||||||||||| |    |||||||||||||| ||| || || 
Sbjct: 874 acccagaatatccagtggtcatcccaggcatgccgcttgttgtagatgatggcagcgccg 815

                             
Query: 484 aggctcctggccgggttg 501
           || |||||||| ||||||
Sbjct: 814 agactcctggctgggttg 797



to top

>gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, complete cds
          Length = 1201

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||||||||| || ||||||||||| || |  | |||| |||| || || || || 
Sbjct: 814 acccagaagatccaatggtcatcccaggctttctgttggttgaagataacagcagctccg 755

                             
Query: 484 aggctcctggccgggttg 501
           || |||||||||||||||
Sbjct: 754 agactcctggccgggttg 737



to top

>gb|U62280.1|NTU62280 Nicotiana tabacum aquaporin (NT2) mRNA, complete cds
          Length = 1049

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 424 acccagaagatccactgatcatccca 449
           |||||||||||||| |||||||||||
Sbjct: 797 acccagaagatccagtgatcatccca 772



to top

>dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membrane intrinsic protein
            1-1, complete cds
          Length = 1351

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                        
Query: 424  acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
            |||||||| | ||| || ||||||||||| |  | |||||||||||||| ||| || || 
Sbjct: 1015 acccagaaaacccagtggtcatcccaggcatgctgcttgttgtagatgatggcagcgcca 956

                              
Query: 484  aggctcctggccgggttg 501
            || |||||||| ||||||
Sbjct: 955  agactcctggctgggttg 938



to top

>ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G45960 (PIP1B) mRNA,
           complete cds
          Length = 1259

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 918 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 870



to top

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 395     ccgcgatcgccgcgccgatcatggg 419
               ||||||||||||||||||| |||||
Sbjct: 2960721 ccgcgatcgccgcgccgatgatggg 2960697



to top

>gb|AY663794.1| Fraxinus excelsior plasma membrane intrinsic protein PIP1-1 mRNA,
           complete cds
          Length = 1174

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           |||||||| ||||| ||||| ||||| || | ||| |||||||||||||
Sbjct: 801 acccagaatatccaatgatcgtcccatgcgtggtctttgttgtagatga 753



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 395   ccgcgatcgccgcgccgatcatggg 419
             ||||||||||||||||||| |||||
Sbjct: 88152 ccgcgatcgccgcgccgatgatggg 88128



to top

>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 393     ggccgcgatcgccgcgccgatcatg 417
               |||||||||||| ||||||||||||
Sbjct: 2316707 ggccgcgatcgcggcgccgatcatg 2316731



to top

>gb|AY333929.1| Pringlea antiscorbutica putative transmembrane protein mRNA,
           partial cds
          Length = 380

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 480
           ||||||||||| ||||| || || ||||| |  | ||||||||||||||| | |||||| 
Sbjct: 219 ccgacccagaaaatccaatggtcgtcccaagagtggtccttgttgtagataatggcggct 160

                                
Query: 481 cccaggctcctggccgggttg 501
           || ||||| || || ||||||
Sbjct: 159 ccaaggcttctagctgggttg 139



to top

>emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein
          Length = 1064

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 838 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 790



to top

>emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel protein (mipA)
          Length = 1104

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgtt 464
           |||||||||| ||| || |||||||| || |||||||||||
Sbjct: 816 acccagaagacccaatggtcatcccaagcgttgtccttgtt 776



to top

>gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (At2g45960) mRNA,
           complete cds
          Length = 892

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 779 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 731



to top

>emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A
          Length = 1105

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 833 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 785



to top

>gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma membrane intrinsic
           protein 1B (At2g45960) mRNA, complete cds
          Length = 1077

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 839 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 791



to top

>ref|NM_001005829.1| Xenopus tropicalis aquaporin 1 (channel-forming integral protein,
           28kDa) (aqp1), mRNA
          Length = 950

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 409 ccgatcatggggccgacccagaagatcca 437
           ||||||||||| |||||||| ||||||||
Sbjct: 704 ccgatcatgggtccgacccaaaagatcca 676



to top

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 395     ccgcgatcgccgcgccgatcatggg 419
               ||||||||||||||||||| |||||
Sbjct: 3933700 ccgcgatcgccgcgccgatgatggg 3933676



to top

>emb|AJ849324.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.1 gene)
          Length = 1295

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 424 acccagaagatccactgatcatcccaggc 452
           |||||||| ||||| ||||||||||||||
Sbjct: 780 acccagaaaatccaatgatcatcccaggc 752



to top

>gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205), mRNA sequence
          Length = 1913

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 839 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 791



to top

>gb|AY671950.1| Aegiceras corniculatum aquaporin 2 (PIP2) mRNA, complete cds
          Length = 855

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 425 cccagaagatccactgatcatccca 449
           ||||||| |||||||||||||||||
Sbjct: 754 cccagaaaatccactgatcatccca 730



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 343 gagccgagggccttgatggcgccggccctgagtatgtactggtggtagaaggccgc 398
           |||||||| ||||| || || || || | ||| ||| |||||||||||||||||||
Sbjct: 836 gagccgagagccttaatcgcccctgctcggaggatgaactggtggtagaaggccgc 781



to top

>emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS86ZH06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1084

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 819 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 771



to top

>emb|BX819664.1|CNS0A8JV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS13ZG09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 679

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 452 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 404



to top

>emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH87ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1036

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 824 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 776



to top

>emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS2ZA01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1060

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 811 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 763



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 394     gccgcgatcgccgcgccgatc 414
               |||||||||||||||||||||
Sbjct: 1116192 gccgcgatcgccgcgccgatc 1116212



to top

>gb|AF154641.1| Nicotiana tabacum clone PR16 mRNA sequence
          Length = 1100

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 331 ttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtag 390
           |||||||||||||| || || || |||||||| || || | ||| ||| |||||||||||
Sbjct: 900 ttgctcctgaaggaaccaagagctttgatggcaccagcacggaggatgaactggtggtag 841

            
Query: 391 a 391
           |
Sbjct: 840 a 840



to top

>gb|AY084470.1| Arabidopsis thaliana clone 108944 mRNA, complete sequence
          Length = 1193

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 915 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 867



to top

>gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, complete cds
          Length = 1052

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 839 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 791



to top

>gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, complete cds
          Length = 1189

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           |||||||||||||| ||||||| ||| || |  || |||||||||||||
Sbjct: 867 acccagaagatccaatgatcattccatgcgtgttcattgttgtagatga 819



to top

>dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1260

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           |||||||| ||||| || ||||||||||| |  | ||||||||||||||
Sbjct: 878 acccagaatatccagtggtcatcccaggcatgcttcttgttgtagatga 830



to top

>gb|BC075384.1| Xenopus tropicalis aquaporin 1 (channel-forming integral protein,
           28kDa), mRNA (cDNA clone MGC:89110 IMAGE:7006583),
           complete cds
          Length = 950

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 409 ccgatcatggggccgacccagaagatcca 437
           ||||||||||| |||||||| ||||||||
Sbjct: 704 ccgatcatgggtccgacccaaaagatcca 676



to top

>gb|BC084131.1| Xenopus laevis hypothetical LOC495037, mRNA (cDNA clone MGC:86220
           IMAGE:6958087), complete cds
          Length = 1283

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 409 ccgatcatggggccgacccagaagatcca 437
           ||||||||||| || ||||||||||||||
Sbjct: 810 ccgatcatgggtccaacccagaagatcca 782



to top

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 395     ccgcgatcgccgcgccgatcatggg 419
               ||||||||||||||||||| |||||
Sbjct: 3637218 ccgcgatcgccgcgccgatgatggg 3637194



to top

>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 461 tgttgtagatgacggcggcccccaggctcctggccgggttg 501
           |||||||||||| ||| || ||||||||||| || ||||||
Sbjct: 830 tgttgtagatgatggcagctcccaggctccttgcagggttg 790



to top

>gb|AE000657.1| Aquifex aeolicus VF5, complete genome
          Length = 1551335

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 79     aaattaaaacaggaaaaggaa 99
              |||||||||||||||||||||
Sbjct: 624952 aaattaaaacaggaaaaggaa 624932



to top

>gb|U26537.1|MCU26537 Mesembryanthemum crystallinum major intrinsic protein homolog
           (mipD) mRNA, complete cds
          Length = 1135

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           |||||||| ||||| || |||||||| || | | |||||||||||||||
Sbjct: 840 acccagaaaatccaatggtcatcccatgcatgggccttgttgtagatga 792



to top

>gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mipB) mRNA, complete cds
          Length = 1217

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 472
           |||||||| ||||| ||||||||||| || | | |||||||| ||||||
Sbjct: 805 acccagaaaatccagtgatcatcccaagcgtggcccttgttgaagatga 757



to top

>gb|U27347.1|GMU27347 Glycine max putative water channel protein (Pip1) mRNA, complete
           cds
          Length = 1255

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           ||||| |||||||| || |||||||||||||| |  | |||||| ||||| || || || 
Sbjct: 848 acccaaaagatccaatggtcatcccaggccttctgttggttgtacatgacagcagctcct 789

                            
Query: 484 aggctcctggccgggtt 500
           |||||||| || |||||
Sbjct: 788 aggctcctagcagggtt 772



to top

>dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane aquaporin 2c,
           complete cds
          Length = 1065

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||| ||||| || |||||||| | ||||  || ||||||||| || ||||| || 
Sbjct: 788 acccagaatatccagtggtcatcccacggcttggactcgttgtagataaccgcggctccg 729

                            
Query: 484 aggctcctggccgggtt 500
           |  ||||||||||||||
Sbjct: 728 aaactcctggccgggtt 712



to top

>dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane aquaporin 2b,
           complete cds
          Length = 1087

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 483
           |||||||| ||||| || |||||||| | ||||  || ||||||||| || ||||| || 
Sbjct: 789 acccagaaaatccagtggtcatcccacggcttggactcgttgtagataaccgcggctcca 730

                            
Query: 484 aggctcctggccgggtt 500
           |  ||||||||||||||
Sbjct: 729 aaactcctggccgggtt 713



to top

>ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channel AT5G60660
           (PIP2;4/PIP2F) mRNA, complete cds
          Length = 1139

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 56/68 (82%)
 Strand = Plus / Minus

                                                                       
Query: 409 ccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtag 468
           |||||||| || || ||||| || ||||| || || ||||||||||| || |||||||| 
Sbjct: 823 ccgatcatcggtccaacccaaaaaatccattggtcgtcccaggccttttcgttgttgtaa 764

                   
Query: 469 atgacggc 476
           || |||||
Sbjct: 763 ataacggc 756



to top

>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 393     ggccgcgatcgccgcgccga 412
               ||||||||||||||||||||
Sbjct: 1911596 ggccgcgatcgccgcgccga 1911615



to top

>gb|AY494191.1| Physcomitrella patens plasma membrane aquaporin (PIP2;1) gene,
            complete cds
          Length = 1486

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 421  ccgacccagaagatccactg 440
            ||||||||||||||||||||
Sbjct: 1380 ccgacccagaagatccactg 1361



to top

>gb|AC016250.5| Homo sapiens chromosome 8 clone RP11-516P9, complete sequence
          Length = 199569

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 82    ttaaaacaggaaaaggaatg 101
             ||||||||||||||||||||
Sbjct: 92945 ttaaaacaggaaaaggaatg 92926



to top

>gb|CP000272.1| Burkholderia xenovorans LB400 chromosome 3, complete sequence
          Length = 1471779

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 393    ggccgcgatcgccgcgccga 412
              ||||||||||||||||||||
Sbjct: 748148 ggccgcgatcgccgcgccga 748129



to top

>emb|BX545848.23| Zebrafish DNA sequence from clone DKEY-8O19 in linkage group 20 Contains
              the gene for a novel protein (zgc:63746), the gene for a
              novel protein (zgc:55614), the gene for the 5' end of a
              novel protein similar to mouse and human cyclin-dependent
              kinase (CDC2-like) 11 (CDK11), the gene for a novel protein
              similar to vertebrate mitogen-activated protein kinase
              kinase kinase 5 (MAP3K5), a novel gene and eleven CpG
              islands, complete sequence
          Length = 199986

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 76     gctaaattaaaacaggaaaa 95
              ||||||||||||||||||||
Sbjct: 129625 gctaaattaaaacaggaaaa 129606



to top

>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11,
             complete sequence
          Length = 147806

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 417   ggggccgacccagaagatccactg 440
             |||||| |||||||||||||||||
Sbjct: 28605 ggggccaacccagaagatccactg 28582



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                         
Query: 442   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 501
             ||||||||||| | | || |||||||||||| ||| || || |||||||| || ||||||
Sbjct: 28019 tcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggttg 27960



to top

>emb|AL138650.1|ATT5N23 Arabidopsis thaliana DNA chromosome 3, BAC clone T5N23
          Length = 90335

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 445   tcccaggccttgtccttgttgtagatga 472
             ||||| || |||||||||||||||||||
Sbjct: 77345 tcccaagctttgtccttgttgtagatga 77318



to top

>emb|AL049655.2|ATF28P10 Arabidopsis thaliana DNA chromosome 3, BAC clone F28P10
          Length = 90736

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 445   tcccaggccttgtccttgttgtagatga 472
             ||||| || |||||||||||||||||||
Sbjct: 83757 tcccaagctttgtccttgttgtagatga 83784



to top

>gb|AC025207.5| Homo sapiens chromosome 8, clone RP11-193J8, complete sequence
          Length = 157375

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 82     ttaaaacaggaaaaggaatg 101
              ||||||||||||||||||||
Sbjct: 143776 ttaaaacaggaaaaggaatg 143795



to top

>emb|AL596209.13| Mouse DNA sequence from clone RP23-278F12 on chromosome 11 Contains the
             3' end of the Ulk2 gene for Unc-51 like kinase 2 (C.
             elegans), the Prpsap2 gene for phosphoribosyl
             pyrophosphate synthetase-associated protein 2, the gene
             for a novel sodium/glucose cotransporter protein, the gene
             for a novel protein (2310040C09Rik), the Grap gene for
             GRB2-related adaptor protein and a CpG island, complete
             sequence
          Length = 186359

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 249   tttctctttggatggatgga 268
             ||||||||||||||||||||
Sbjct: 79799 tttctctttggatggatgga 79818



to top

>gb|AC083943.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0044A10, from chromosome 10, complete sequence
          Length = 169270

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 389   agaaggccgcgatcgccgcg 408
             ||||||||||||||||||||
Sbjct: 92267 agaaggccgcgatcgccgcg 92286



to top

>gb|AF452013.1|AF452013 Petunia x hybrida aquaporin-like protein (PIP2;2) mRNA, complete
           cds
          Length = 1165

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgta 467
           |||||||| ||||| || ||||||||||| ||||| | ||||||
Sbjct: 827 acccagaaaatccattggtcatcccaggctttgtcttggttgta 784



to top

>gb|AY059380.1| Medicago truncatula aquaporin (PIP2-1) mRNA, complete cds
          Length = 973

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 433 atccactgatcatcccaggc 452
           ||||||||||||||||||||
Sbjct: 775 atccactgatcatcccaggc 756



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 389      agaaggccgcgatcgccgcg 408
                ||||||||||||||||||||
Sbjct: 13136748 agaaggccgcgatcgccgcg 13136767



to top

>gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete sequence
          Length = 1120

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 56/68 (82%)
 Strand = Plus / Minus

                                                                       
Query: 409 ccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtag 468
           |||||||| || || ||||| || ||||| || || ||||||||||| || |||||||| 
Sbjct: 823 ccgatcatcggtccaacccaaaaaatccattggtcgtcccaggccttttcgttgttgtaa 764

                   
Query: 469 atgacggc 476
           || |||||
Sbjct: 763 ataacggc 756



to top

>dbj|AP004867.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0036E06
          Length = 137926

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 79    aaattaaaacaggaaaagga 98
             ||||||||||||||||||||
Sbjct: 30074 aaattaaaacaggaaaagga 30093



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 393     ggccgcgatcgccgcgccga 412
               ||||||||||||||||||||
Sbjct: 5135849 ggccgcgatcgccgcgccga 5135868



to top

>dbj|AP004090.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1399_H05
          Length = 147670

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 79     aaattaaaacaggaaaagga 98
              ||||||||||||||||||||
Sbjct: 108838 aaattaaaacaggaaaagga 108857



to top

>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 405     cgcgccgatcatggggccga 424
               ||||||||||||||||||||
Sbjct: 1377402 cgcgccgatcatggggccga 1377383



to top

>emb|BX248523.8| Zebrafish DNA sequence from clone CH211-257G8 in linkage group 20,
             complete sequence
          Length = 169849

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 76    gctaaattaaaacaggaaaa 95
             ||||||||||||||||||||
Sbjct: 35269 gctaaattaaaacaggaaaa 35288



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 389      agaaggccgcgatcgccgcg 408
                ||||||||||||||||||||
Sbjct: 13144088 agaaggccgcgatcgccgcg 13144107



to top

>gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome
          Length = 5528445

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 69      tatggtcgctaaattaaaac 88
               ||||||||||||||||||||
Sbjct: 4757676 tatggtcgctaaattaaaac 4757657


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,150,421
Number of Sequences: 3902068
Number of extensions: 4150421
Number of successful extensions: 74271
Number of sequences better than 10.0: 253
Number of HSP's better than 10.0 without gapping: 254
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 72862
Number of HSP's gapped (non-prelim): 1392
length of query: 501
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 479
effective length of database: 17,147,199,772
effective search space: 8213508690788
effective search space used: 8213508690788
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top