ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart13a08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein 648 0.0
2gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRN... 131 2e-27
3gb|AY170841.1| Axonopus compressus plasma membrane MIP protein m... 123 5e-25
4gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence 119 7e-24
5gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-... 119 7e-24
6emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein 119 7e-24
7gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence 109 7e-21
8gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein... 109 7e-21
9gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein... 109 7e-21
10gb|AY103580.1| Zea mays PCO072544 mRNA sequence 109 7e-21
11gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker 105 1e-19
12gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker 105 1e-19
13gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein ... 105 1e-19
14emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet... 94 4e-16
15dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 4e-16
16dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 4e-16
17dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 4e-16
18gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, ... 94 4e-16
19dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ... 94 4e-16
20ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predic... 92 2e-15
21dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon... 92 2e-15
22dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon... 92 2e-15
23dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clon... 92 2e-15
24dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon... 92 2e-15
25emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for p... 90 6e-15
26dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds 88 3e-14
27dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 84 4e-13
28dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic D... 84 4e-13
29dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic D... 84 4e-13
30emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4,... 82 2e-12
31dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
32emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp... 72 2e-09
33gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putat... 72 2e-09
34dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 70 6e-09
35emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein 64 4e-07
36gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, co... 64 4e-07
37gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com... 62 1e-06
38emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intri... 56 9e-05
39gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein... 56 9e-05
40gb|AY107675.1| Zea mays PCO112712 mRNA sequence 56 9e-05
41ref|XM_468463.1| Oryza sativa (japonica cultivar-group), mRNA 54 4e-04
42emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for p... 54 4e-04
43dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 4e-04
44dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds 54 4e-04
45emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel... 52 0.001
46ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G0... 50 0.006
47emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrins... 50 0.006
48emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B 50 0.006
49emb|AJ001292.1|CPPIPA2 Craterostigma plantagineum mRNA for major... 50 0.006
50gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic pr... 50 0.006
51gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative pl... 50 0.006
52emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Co... 50 0.006
53gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma... 50 0.006
54gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic pr... 50 0.006
55gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, c... 48 0.022
56dbj|AB002149.1| Nicotiana excelsior mRNA for water channel prote... 48 0.022
57gb|AY611006.1| Xerophyta humilis isolate HC398 PIP1 aquaporin mR... 46 0.086
58emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative pl... 46 0.086
59gb|AF452010.1|AF452010 Petunia x hybrida channel-like protein (P... 46 0.086
60gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds 46 0.086
61gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, com... 46 0.086
62ref|NM_116008.2| Arabidopsis thaliana PIP1A; water channel AT3G6... 44 0.34
63gb|BT016583.1| Zea mays clone Contig416 mRNA sequence 44 0.34
64emb|X75881.1|ATPIP1A A.thaliana mRNA for plasma membrane intrins... 44 0.34
65ref|NM_001005829.1| Xenopus tropicalis aquaporin 1 (channel-form... 44 0.34
66emb|AJ289701.1|VFA289701 Vicia faba mRNA for aquaporin (aq1 gene) 44 0.34
67gb|AY097398.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, com... 44 0.34
68gb|AY058113.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, com... 44 0.34
69gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, ... 44 0.34
70emb|BX824874.1|CNS0A5T5 Arabidopsis thaliana Full-length cDNA Co... 44 0.34
71emb|BX823595.1|CNS0A5AA Arabidopsis thaliana Full-length cDNA Co... 44 0.34
72dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane in... 44 0.34
73gb|AY088439.1| Arabidopsis thaliana clone 6690 mRNA, complete se... 44 0.34
74gb|AF266760.1|AF266760 Vicia faba plasma membrane aquaporin mRNA... 44 0.34
75emb|AJ699398.2| Chenopodium rubrum mRNA for aquaporin PIP1 (PIP1... 44 0.34
76gb|BC075384.1| Xenopus tropicalis aquaporin 1 (channel-forming i... 44 0.34
77ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predic... 42 1.3
78gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds 42 1.3
79emb|AL138758.7| Human DNA sequence from clone RP5-824O18 on chro... 42 1.3
80gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putat... 42 1.3
81gb|AC093117.2| Homo sapiens chromosome 1 clone RP11-86H7, comple... 42 1.3
82gb|AC153823.5| Mus musculus 10 BAC RP23-11M21 (Roswell Park Canc... 42 1.3
83gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protei... 42 1.3
84gb|AF188844.1|AF188844 Vitis vinifera cultivar Pinot Noir plasma... 42 1.3
85gb|AC153943.3| Mus musculus 10 BAC RP24-408O23 (Roswell Park Can... 42 1.3
86gb|AY787752.1| Hepatitis C virus isolate HVR1-12 polyprotein gen... 40 5.3
87ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G4... 40 5.3
88ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channe... 40 5.3
89ref|NM_105978.2| Arabidopsis thaliana water channel AT1G73190 mR... 40 5.3
90gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds 40 5.3
91ref|XM_521983.1| PREDICTED: Pan troglodytes similar to expressed... 40 5.3
92ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA 40 5.3
93ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group... 40 5.3
94ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group... 40 5.3
95ref|NM_001005210.1| Homo sapiens leucine rich repeat containing ... 40 5.3
96gb|AF499725.1| Thellungiella halophila plasma membrane intrinsic... 40 5.3
97gb|AC152940.2| Mus musculus BAC clone RP23-264B6 from chromosome... 40 5.3
98gb|AC126028.4| Mus musculus BAC clone RP24-542M6 from chromosome... 40 5.3
99emb|AJ001416.1|NTAQUAPOR Nicotiana tabacum mRNA for aquaporin 1 40 5.3
100gb|AC007528.5| Homo sapiens 12 BAC RP11-473N11 (Roswell Park Can... 40 5.3
101gb|AC124743.5| Mus musculus BAC clone RP23-219C1 from 1, complet... 40 5.3
102emb|CR733851.2|CNS0GT0Q Tetraodon nigroviridis full-length cDNA 40 5.3
103gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic pro... 40 5.3
104emb|AL161722.9| Human DNA sequence from clone RP11-497J7 on chro... 40 5.3
105gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 40 5.3
106emb|AL117377.18|HSJ1037B9 Human DNA sequence from clone RP5-1037... 40 5.3
107gb|AC163448.2| Mus musculus chromosome 1, clone RP24-327O21, com... 40 5.3
108emb|CR354559.6| Zebrafish DNA sequence from clone CH211-210F24 i... 40 5.3
109emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein 40 5.3
110emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel... 40 5.3
111gb|AY117339.1| Arabidopsis thaliana putative tonoplast intrinsic... 40 5.3
112gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (... 40 5.3
113emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A 40 5.3
114gb|AY064054.1| Arabidopsis thaliana putative tonoplast intrinsic... 40 5.3
115gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma m... 40 5.3
116emb|X63551.1|ATATIPARA A.thaliana gene for tonoplast intrinsic p... 40 5.3
117emb|CR847868.9| Zebrafish DNA sequence from clone DKEYP-99G4 in ... 40 5.3
118emb|BX548158.10| Zebrafish DNA sequence from clone CH211-106G4 i... 40 5.3
119gb|AC182472.3| Pan troglodytes BAC clone CH251-394C9 from chromo... 40 5.3
120dbj|AK127591.1| Homo sapiens cDNA FLJ45686 fis, clone FCBBF3012443 40 5.3
121gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map... 40 5.3
122gb|AY081593.1| Arabidopsis thaliana water channel-like protein (... 40 5.3
123gb|AC016493.14| Homo sapiens chromosome 18, clone RP11-58G13, co... 40 5.3
124gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putat... 40 5.3
125gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putat... 40 5.3
126ref|XM_944599.1| PREDICTED: Homo sapiens hypothetical protein LO... 40 5.3
127ref|XM_933141.1| PREDICTED: Homo sapiens hypothetical protein LO... 40 5.3
128gb|AC023577.6| Homo sapiens chromosome 18, clone RP11-645D5, com... 40 5.3
129gb|AY059948.1| Arabidopsis thaliana water channel - like protein... 40 5.3
130dbj|AK222086.1| Arabidopsis thaliana mRNA for aquaporin, partial... 40 5.3
131dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - li... 40 5.3
132gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 5.3
133gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205),... 40 5.3
134gb|AC010556.6|AC010556 Arabidopsis thaliana chromosome 1 BAC T18... 40 5.3
135gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, ... 40 5.3
136emb|BX818487.1|CNS0AB8P Arabidopsis thaliana Full-length cDNA Co... 40 5.3
137emb|BX817607.1|CNS0AB8S Arabidopsis thaliana Full-length cDNA Co... 40 5.3
138emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Co... 40 5.3
139emb|BX819664.1|CNS0A8JV Arabidopsis thaliana Full-length cDNA Co... 40 5.3
140emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Co... 40 5.3
141emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Co... 40 5.3
142emb|BX824209.1|CNS0A5OV Arabidopsis thaliana Full-length cDNA Co... 40 5.3
143emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Co... 40 5.3
144emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Co... 40 5.3
145emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Co... 40 5.3
146dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA ... 40 5.3
147gb|AC011500.7| Homo sapiens chromosome 19 clone CTB-60E11, compl... 40 5.3
148gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete se... 40 5.3
149gb|AC010336.8| Homo sapiens chromosome 19 clone CTD-3193O13, com... 40 5.3
150gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, comp... 40 5.3
151gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1)... 40 5.3
152dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.3
153emb|Z17399.1|ATORFB Arabidopsis thaliana PIP1b gene 40 5.3
154dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.3
155dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.3
156dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.3
157emb|AJ328109.1|HSA328109 Homo sapiens genomic sequence surroundi... 40 5.3
158dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.3
159gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, comp... 40 5.3
160dbj|AP001786.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 5.3
161gb|DQ151348.1| Petromyzon marinus clone T.D8 variable lymphocyte... 40 5.3
162gb|AF024511.1|AF024511 Nicotiana tabacum aquaporin 1 mRNA, compl... 40 5.3
163gb|U60149.1|BVU60149 Beta vulgaris plasma membrane major intrins... 40 5.3
164gb|AF004293.1|AF004293 Brassica rapa aquaporin (MOD) mRNA, compl... 40 5.3
165gb|AC172859.1| Brassica rapa subsp. pekinensis clone KBrB023K01,... 40 5.3
166gb|M84343.1|ATHATIP Arabidopsis thaliana tonoplast intrinsic pro... 40 5.3
167dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane ... 40 5.3
168dbj|AB002148.1| Nicotiana excelsior mRNA for water channel prote... 40 5.3 
>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score =  648 bits (327), Expect = 0.0
 Identities = 373/391 (95%)
 Strand = Plus / Minus

                                                                        
Query: 7    aacaactttgctggatttgcacaacaacgagcagtactacacaacaactgagcactgatg 66
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1199 aacaactttgctggatttgcacaacaacgagcagtactacacaacaactgagcactgatg 1140

                                                                        
Query: 67   agattacatacaagtcctctgtctgggttcaggggaatacagagcaagagcaagagtagc 126
            ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| 
Sbjct: 1139 agattacatacaagtcctctgtctgggttcaggtgaatacagagcaagagcaagagtagt 1080

                                                                        
Query: 127  acatcaaacttggaagacaaattggaattccacggtaacacggacgatgggaaaaaaggg 186
            |||||||||||||||||||||||||||||||||||||||| |||||||||||| | ||||
Sbjct: 1079 acatcaaacttggaagacaaattggaattccacggtaacagggacgatgggaagagaggg 1020

                                                                        
Query: 187  nnnnnnnnatcaaaaagaaattcactcaaaacacgcagtttgctcttcgggttgggatgg 246
                    |||| ||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1019 ccgcccccatcagaaagaaattcactcagaacacgcagtttgctcttcgggttgggatgg 960

                                                                        
Query: 247  catctttctttgtagcagcagcttaggacttggtcttgaatgggatcgctctgatgacca 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 959  catctttctttgtagcagcagcttaggacttggtcttgaatgggatcgctctgatgacca 900

                                                                        
Query: 307  cctggtggtaaatggcggccagcgcggcgcccatgaaggggccgacccaaaagatccagt 366
            |||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 899  cctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagt 840

                                           
Query: 367  ggtctgaccaggcgtgctccctgttgtagat 397
            |||||||||||||||||||||||||||||||
Sbjct: 839  ggtctgaccaggcgtgctccctgttgtagat 809
to top
>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds
          Length = 1280

 Score =  131 bits (66), Expect = 2e-27
 Identities = 117/134 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcg 323
           |||||||| ||| || ||||||| ||||| |||||||||| |||||||||||| ||||| 
Sbjct: 935 gcagcttaagacctgctcttgaacgggatggctctgatgatcacctggtggtagatggca 876

                                                                       
Query: 324 gccagcgcggcgcccatgaaggggccgacccaaaagatccagtggtctgaccaggcgtgc 383
           ||||| || ||||| ||||||||||||||||| |||||||| |||||   ||||||||| 
Sbjct: 875 gccagggcagcgccaatgaaggggccgacccagaagatccaatggtcgttccaggcgtga 816

                         
Query: 384 tccctgttgtagat 397
           ||||||||||||||
Sbjct: 815 tccctgttgtagat 802
to top
>gb|AY170841.1| Axonopus compressus plasma membrane MIP protein mRNA, partial cds
          Length = 423

 Score =  123 bits (62), Expect = 5e-25
 Identities = 104/118 (88%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccca 339
           ||||||| ||||| || ||||||| |||||||||||| |||||||| || || ||||| |
Sbjct: 412 tcttgaacgggatggccctgatgatcacctggtggtagatggcggctagggcagcgccaa 353

                                                                     
Query: 340 tgaaggggccgacccaaaagatccagtggtctgaccaggcgtgctccctgttgtagat 397
           |||||||||||||||| |||||||| |||||   ||||||||||||||||||||||||
Sbjct: 352 tgaaggggccgacccagaagatccaatggtcattccaggcgtgctccctgttgtagat 295
to top
>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence
          Length = 698

 Score =  119 bits (60), Expect = 7e-24
 Identities = 90/100 (90%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccca 339
           ||||||| |||||||| ||||||| |||||||||||| ||||| |||||||| ||||| |
Sbjct: 425 tcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccga 366

                                                   
Query: 340 tgaaggggccgacccaaaagatccagtggtctgaccaggc 379
           |||||||||||||||| |||||||||||||| | ||||||
Sbjct: 365 tgaaggggccgacccagaagatccagtggtcagcccaggc 326
to top
>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score =  119 bits (60), Expect = 7e-24
 Identities = 90/100 (90%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccca 339
           ||||||| |||||||| ||||||| |||||||||||| ||||| |||||||| ||||| |
Sbjct: 856 tcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccga 797

                                                   
Query: 340 tgaaggggccgacccaaaagatccagtggtctgaccaggc 379
           |||||||||||||||| |||||||||||||| | ||||||
Sbjct: 796 tgaaggggccgacccagaagatccagtggtcagcccaggc 757
to top
>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score =  119 bits (60), Expect = 7e-24
 Identities = 90/100 (90%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccca 339
           ||||||| |||||||| ||||||| |||||||||||| ||||| |||||||| ||||| |
Sbjct: 913 tcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccga 854

                                                   
Query: 340 tgaaggggccgacccaaaagatccagtggtctgaccaggc 379
           |||||||||||||||| |||||||||||||| | ||||||
Sbjct: 853 tgaaggggccgacccagaagatccagtggtcagcccaggc 814
to top
>gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence
          Length = 1154

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcg 323
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||| ||||| 
Sbjct: 834 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 775

                                                          
Query: 324 gccagcgcggcgcccatgaaggggccgacccaaaagatccagtggtc 370
           ||||| |||||||| ||||||||||||||||| |||||||| |||||
Sbjct: 774 gccagggcggcgccgatgaaggggccgacccagaagatccaatggtc 728
to top
>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete
           cds
          Length = 1153

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcg 323
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||| ||||| 
Sbjct: 984 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 925

                                                          
Query: 324 gccagcgcggcgcccatgaaggggccgacccaaaagatccagtggtc 370
           ||||| |||||||| ||||||||||||||||| |||||||| |||||
Sbjct: 924 gccagggcggcgccgatgaaggggccgacccagaagatccaatggtc 878
to top
>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete
           cds
          Length = 1296

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcg 323
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||| ||||| 
Sbjct: 979 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 920

                                                          
Query: 324 gccagcgcggcgcccatgaaggggccgacccaaaagatccagtggtc 370
           ||||| |||||||| ||||||||||||||||| |||||||| |||||
Sbjct: 919 gccagggcggcgccgatgaaggggccgacccagaagatccaatggtc 873
to top
>gb|AY103580.1| Zea mays PCO072544 mRNA sequence
          Length = 1633

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                        
Query: 264  gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcg 323
            |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||| ||||| 
Sbjct: 1308 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 1249

                                                           
Query: 324  gccagcgcggcgcccatgaaggggccgacccaaaagatccagtggtc 370
            ||||| |||||||| ||||||||||||||||| |||||||| |||||
Sbjct: 1248 gccagggcggcgccgatgaaggggccgacccagaagatccaatggtc 1202
to top
>gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker
          Length = 824

 Score =  105 bits (53), Expect = 1e-19
 Identities = 89/101 (88%)
 Strand = Plus / Plus

                                                                       
Query: 264 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcg 323
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||| ||||| 
Sbjct: 244 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 303

                                                    
Query: 324 gccagcgcggcgcccatgaaggggccgacccaaaagatcca 364
           ||||| |||||||| ||||||||||||||||| ||||||||
Sbjct: 304 gccagggcggcgccgatgaaggggccgacccagaagatcca 344
to top
>gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker
          Length = 763

 Score =  105 bits (53), Expect = 1e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcg 323
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||| ||||| 
Sbjct: 533 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 474

                                                    
Query: 324 gccagcgcggcgcccatgaaggggccgacccaaaagatcca 364
           ||||| |||||||| ||||||||||||||||| ||||||||
Sbjct: 473 gccagggcggcgccgatgaaggggccgacccagaagatcca 433
to top
>gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein (Mip1) mRNA, partial cds
          Length = 539

 Score =  105 bits (53), Expect = 1e-19
 Identities = 113/133 (84%)
 Strand = Plus / Minus

                                                                       
Query: 265 cagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcgg 324
           ||||||| ||| || ||||||| ||||| || ||||||| |||||||||||| ||||| |
Sbjct: 359 cagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggcag 300

                                                                       
Query: 325 ccagcgcggcgcccatgaaggggccgacccaaaagatccagtggtctgaccaggcgtgct 384
           |||| || || || ||||||||||||||||| |||||||| |||||   |||||| || |
Sbjct: 299 ccagggcagcaccaatgaaggggccgacccagaagatccaatggtcgctccaggcatgat 240

                        
Query: 385 ccctgttgtagat 397
           |||||||||||||
Sbjct: 239 ccctgttgtagat 227
to top
>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS
          Length = 1139

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 110/131 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggcc 326
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||| ||||| |||
Sbjct: 896 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 837

                                                                       
Query: 327 agcgcggcgcccatgaaggggccgacccaaaagatccagtggtctgaccaggcgtgctcc 386
           || || ||||| | |||||| || ||||| |||||||| |||||   |||||| || |||
Sbjct: 836 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 777

                      
Query: 387 ctgttgtagat 397
            ||||||||||
Sbjct: 776 ttgttgtagat 766
to top
>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full
           insert sequence
          Length = 1128

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 110/131 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggcc 326
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||| ||||| |||
Sbjct: 929 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 870

                                                                       
Query: 327 agcgcggcgcccatgaaggggccgacccaaaagatccagtggtctgaccaggcgtgctcc 386
           || || ||||| | |||||| || ||||| |||||||| |||||   |||||| || |||
Sbjct: 869 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 810

                      
Query: 387 ctgttgtagat 397
            ||||||||||
Sbjct: 809 ttgttgtagat 799
to top
>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full
           insert sequence
          Length = 1205

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 110/131 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggcc 326
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||| ||||| |||
Sbjct: 984 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 925

                                                                       
Query: 327 agcgcggcgcccatgaaggggccgacccaaaagatccagtggtctgaccaggcgtgctcc 386
           || || ||||| | |||||| || ||||| |||||||| |||||   |||||| || |||
Sbjct: 924 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 865

                      
Query: 387 ctgttgtagat 397
            ||||||||||
Sbjct: 864 ttgttgtagat 854
to top
>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full
           insert sequence
          Length = 1136

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 110/131 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggcc 326
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||| ||||| |||
Sbjct: 929 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 870

                                                                       
Query: 327 agcgcggcgcccatgaaggggccgacccaaaagatccagtggtctgaccaggcgtgctcc 386
           || || ||||| | |||||| || ||||| |||||||| |||||   |||||| || |||
Sbjct: 869 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 810

                      
Query: 387 ctgttgtagat 397
            ||||||||||
Sbjct: 809 ttgttgtagat 799
to top
>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1140

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 110/131 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggcc 326
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||| ||||| |||
Sbjct: 924 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 865

                                                                       
Query: 327 agcgcggcgcccatgaaggggccgacccaaaagatccagtggtctgaccaggcgtgctcc 386
           || || ||||| | |||||| || ||||| |||||||| |||||   |||||| || |||
Sbjct: 864 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 805

                      
Query: 387 ctgttgtagat 397
            ||||||||||
Sbjct: 804 ttgttgtagat 794
to top
>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel
           protein, complete cds
          Length = 1116

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 110/131 (83%)
 Strand = Plus / Minus

                                                                       
Query: 267 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggcc 326
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||| ||||| |||
Sbjct: 927 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 868

                                                                       
Query: 327 agcgcggcgcccatgaaggggccgacccaaaagatccagtggtctgaccaggcgtgctcc 386
           || || ||||| | |||||| || ||||| |||||||| |||||   |||||| || |||
Sbjct: 867 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 808

                      
Query: 387 ctgttgtagat 397
            ||||||||||
Sbjct: 807 ttgttgtagat 797
to top
>ref|XM_473480.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 100/118 (84%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccca 339
           |||||||||| || || |||||||||||||||||||| ||||| || || || ||||| |
Sbjct: 838 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 779

                                                                     
Query: 340 tgaaggggccgacccaaaagatccagtggtctgaccaggcgtgctccctgttgtagat 397
           |||||||||| ||||| |||||||| |||||   |||||| ||  |||||||||||||
Sbjct: 778 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagat 721
to top
>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full
           insert sequence
          Length = 1163

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 100/118 (84%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccca 339
           |||||||||| || || |||||||||||||||||||| ||||| || || || ||||| |
Sbjct: 915 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 856

                                                                     
Query: 340 tgaaggggccgacccaaaagatccagtggtctgaccaggcgtgctccctgttgtagat 397
           |||||||||| ||||| |||||||| |||||   |||||| ||  |||||||||||||
Sbjct: 855 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagat 798
to top
>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full
           insert sequence
          Length = 1164

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 100/118 (84%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccca 339
           |||||||||| || || |||||||||||||||||||| ||||| || || || ||||| |
Sbjct: 916 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 857

                                                                     
Query: 340 tgaaggggccgacccaaaagatccagtggtctgaccaggcgtgctccctgttgtagat 397
           |||||||||| ||||| |||||||| |||||   |||||| ||  |||||||||||||
Sbjct: 856 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagat 799
to top
>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full
           insert sequence
          Length = 1167

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 100/118 (84%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccca 339
           |||||||||| || || |||||||||||||||||||| ||||| || || || ||||| |
Sbjct: 918 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 859

                                                                     
Query: 340 tgaaggggccgacccaaaagatccagtggtctgaccaggcgtgctccctgttgtagat 397
           |||||||||| ||||| |||||||| |||||   |||||| ||  |||||||||||||
Sbjct: 858 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagat 801
to top
>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full
            insert sequence
          Length = 1462

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 100/118 (84%)
 Strand = Plus / Minus

                                                                        
Query: 280  tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccca 339
            |||||||||| || || |||||||||||||||||||| ||||| || || || ||||| |
Sbjct: 1214 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 1155

                                                                      
Query: 340  tgaaggggccgacccaaaagatccagtggtctgaccaggcgtgctccctgttgtagat 397
            |||||||||| ||||| |||||||| |||||   |||||| ||  |||||||||||||
Sbjct: 1154 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagat 1097
to top
>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin
          Length = 1291

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 54/57 (94%)
 Strand = Plus / Minus

                                                                     
Query: 308  ctggtggtaaatggcggccagcgcggcgcccatgaaggggccgacccaaaagatcca 364
            ||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||
Sbjct: 1291 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 1235



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 33/33 (100%)
 Strand = Plus / Minus

                                            
Query: 365 gtggtctgaccaggcgtgctccctgttgtagat 397
           |||||||||||||||||||||||||||||||||
Sbjct: 680 gtggtctgaccaggcgtgctccctgttgtagat 648
to top
>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds
          Length = 1147

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 89/104 (85%)
 Strand = Plus / Minus

                                                                       
Query: 294 gctctgatgaccacctggtggtaaatggcggccagcgcggcgcccatgaaggggccgacc 353
           |||||||||| |||||||||||| | ||| ||||| |||||||| | ||||||||| |||
Sbjct: 927 gctctgatgatcacctggtggtagacggctgccagggcggcgccaacgaaggggcccacc 868

                                                       
Query: 354 caaaagatccagtggtctgaccaggcgtgctccctgttgtagat 397
           || |||||||| |||||   |||||| || ||||||||||||||
Sbjct: 867 cagaagatccaatggtcattccaggcatggtccctgttgtagat 824
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                            
Query: 267      gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggcc 326
                ||||| ||| || |||||||||||||||| ||||||| |||||||||||| ||||| |||
Sbjct: 27065653 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 27065594

                                                      
Query: 327      agcgcggcgcccatgaaggggccgacccaaaagatcca 364
                || || ||||| | |||||| || ||||| ||||||||
Sbjct: 27065593 agggcagcgccaacgaagggaccaacccagaagatcca 27065556
to top
>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1486_E07
          Length = 110494

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                         
Query: 267   gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggcc 326
             ||||| ||| || |||||||||||||||| ||||||| |||||||||||| ||||| |||
Sbjct: 37302 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 37243

                                                   
Query: 327   agcgcggcgcccatgaaggggccgacccaaaagatcca 364
             || || ||||| | |||||| || ||||| ||||||||
Sbjct: 37242 agggcagcgccaacgaagggaccaacccagaagatcca 37205
to top
>dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0461B08
          Length = 153743

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                          
Query: 267    gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggcc 326
              ||||| ||| || |||||||||||||||| ||||||| |||||||||||| ||||| |||
Sbjct: 118855 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 118796

                                                    
Query: 327    agcgcggcgcccatgaaggggccgacccaaaagatcca 364
              || || ||||| | |||||| || ||||| ||||||||
Sbjct: 118795 agggcagcgccaacgaagggaccaacccagaagatcca 118758
to top
>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11,
             complete sequence
          Length = 147806

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                         
Query: 280   tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccca 339
             |||||||||| || || |||||||||||||||||||| ||||| || || || ||||| |
Sbjct: 28669 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 28610

                                      
Query: 340   tgaaggggccgacccaaaagatcca 364
             |||||||||| ||||| ||||||||
Sbjct: 28609 tgaaggggccaacccagaagatcca 28585
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                            
Query: 280      tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccca 339
                |||||||||| || || |||||||||||||||||||| ||||| || || || ||||| |
Sbjct: 28021443 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 28021384

                                         
Query: 340      tgaaggggccgacccaaaagatcca 364
                |||||||||| ||||| ||||||||
Sbjct: 28021383 tgaaggggccaacccagaagatcca 28021359
to top
>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 102/124 (82%)
 Strand = Plus / Minus

                                                                       
Query: 274 acttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcgg 333
           ||||| ||||||||||||| |||||||| ||||||   ||||| |  || ||||  || |
Sbjct: 847 acttgttcttgaatgggatagctctgatcaccaccacatggtacagagctgccaatgctg 788

                                                                       
Query: 334 cgcccatgaaggggccgacccaaaagatccagtggtctgaccaggcgtgctccctgttgt 393
           |||| ||||| || || ||||| ||||||||||||||   ||||||||| ||||||||||
Sbjct: 787 cgccaatgaatggtccaacccagaagatccagtggtcatcccaggcgtggtccctgttgt 728

               
Query: 394 agat 397
           ||||
Sbjct: 727 agat 724
to top
>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1
           (PIP1-1) mRNA, complete cds
          Length = 1115

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 102/124 (82%)
 Strand = Plus / Minus

                                                                       
Query: 274 acttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcgg 333
           |||||| |||||| || || ||||||||||||||||||||||| |  || || || ||||
Sbjct: 887 acttggacttgaagggaatggctctgatgaccacctggtggtataaagctgctagtgcgg 828

                                                                       
Query: 334 cgcccatgaaggggccgacccaaaagatccagtggtctgaccaggcgtgctccctgttgt 393
           | || ||||| || || ||||| ||||||||||||||   ||| ||||| ||| ||||||
Sbjct: 827 ccccaatgaatggtcccacccagaagatccagtggtcgtcccatgcgtggtccttgttgt 768

               
Query: 394 agat 397
           ||||
Sbjct: 767 agat 764
to top
>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccca 339
           ||||||| |||||||| ||||| ||||||  |||||| || || |||||||| ||||| |
Sbjct: 945 tcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgccga 886

                                          
Query: 340 tgaaggggccgacccaaaagatccagtggtc 370
           |||| || || ||||| ||||||||||||||
Sbjct: 885 tgaacggtcccacccagaagatccagtggtc 855
to top
>emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein
          Length = 1179

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccca 339
           |||||||||| || || ||||| ||| ||||||||||||||||  | || ||  | ||||
Sbjct: 930 tcttgaatggaattgccctgataaccccctggtggtaaatggcaacaagggcccccccca 871

                                           
Query: 340 tgaaggggccgacccaaaagatccagtggtct 371
           | ||||||||||||||||| ||||| ||||||
Sbjct: 870 ttaaggggccgacccaaaaaatccaatggtct 839
to top
>gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1179

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccca 339
           |||||||||| || || ||||| ||| ||||||||||||||||  | || ||  | ||||
Sbjct: 930 tcttgaatggaattgccctgataaccccctggtggtaaatggcaacaagggcccccccca 871

                                           
Query: 340 tgaaggggccgacccaaaagatccagtggtct 371
           | ||||||||||||||||| ||||| ||||||
Sbjct: 870 ttaaggggccgacccaaaaaatccaatggtct 839
to top
>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 76/91 (83%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccca 339
           ||||||| ||||| || ||||| ||||||  |||||| ||||| |||||||| || || |
Sbjct: 930 tcttgaaggggatggccctgatcaccaccacgtggtagatggccgccagcgccgcaccga 871

                                          
Query: 340 tgaaggggccgacccaaaagatccagtggtc 370
           |||| || || ||||| ||||||||||||||
Sbjct: 870 tgaacggaccaacccagaagatccagtggtc 840
to top
>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene)
          Length = 1364

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                       
Query: 311 gtggtaaatggcggccagcgcggcgcccatgaaggggccgacccaaaagatccagtggtc 370
           |||||| |||||||| || || || || ||||||||||| ||||| ||||||||||||||
Sbjct: 906 gtggtagatggcggcaagagcagcaccgatgaaggggccaacccagaagatccagtggtc 847
to top
>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete
           cds
          Length = 1338

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                       
Query: 311 gtggtaaatggcggccagcgcggcgcccatgaaggggccgacccaaaagatccagtggtc 370
           |||||| |||||||| || || || || ||||||||||| ||||| ||||||||||||||
Sbjct: 897 gtggtagatggcggcaagagcagcaccgatgaaggggccaacccagaagatccagtggtc 838
to top
>gb|AY107675.1| Zea mays PCO112712 mRNA sequence
          Length = 791

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                       
Query: 311 gtggtaaatggcggccagcgcggcgcccatgaaggggccgacccaaaagatccagtggtc 370
           |||||| |||||||| || || || || ||||||||||| ||||| ||||||||||||||
Sbjct: 330 gtggtagatggcggcaagagcagcaccgatgaaggggccaacccagaagatccagtggtc 271
to top
>ref|XM_468463.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1319

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 75/91 (82%)
 Strand = Plus / Minus

                                                                        
Query: 280  tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccca 339
            ||||||| ||||| |||||||| ||||||  |||||| ||||| ||||| || || || |
Sbjct: 1008 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 949

                                           
Query: 340  tgaaggggccgacccaaaagatccagtggtc 370
            |||| || || ||||| || |||||||||||
Sbjct: 948  tgaacggaccaacccagaaaatccagtggtc 918
to top
>emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.2 gene)
          Length = 1124

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 75/91 (82%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccca 339
           ||||||| || || ||||||||||| | ||||||||| |  ||||| || || || || |
Sbjct: 931 tcttgaaaggaatggctctgatgactatctggtggtagacagcggcaagagcagctccaa 872

                                          
Query: 340 tgaaggggccgacccaaaagatccagtggtc 370
           |||| ||||| ||||| ||||||||||||||
Sbjct: 871 tgaaagggccaacccagaagatccagtggtc 841
to top
>dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086K14, full
            insert sequence
          Length = 1318

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 75/91 (82%)
 Strand = Plus / Minus

                                                                        
Query: 280  tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccca 339
            ||||||| ||||| |||||||| ||||||  |||||| ||||| ||||| || || || |
Sbjct: 1007 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 948

                                           
Query: 340  tgaaggggccgacccaaaagatccagtggtc 370
            |||| || || ||||| || |||||||||||
Sbjct: 947  tgaacggaccaacccagaaaatccagtggtc 917
to top
>dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds
          Length = 1403

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 75/91 (82%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccca 339
           ||||||| ||||| |||||||| ||||||  |||||| ||||| ||||| || || || |
Sbjct: 985 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 926

                                          
Query: 340 tgaaggggccgacccaaaagatccagtggtc 370
           |||| || || ||||| || |||||||||||
Sbjct: 925 tgaacggaccaacccagaaaatccagtggtc 895
to top
>emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel protein (mipB)
          Length = 1114

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 74/90 (82%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgcccat 340
           |||||||||||| ||||||||||| | |  ||||||||  || || ||||| || || ||
Sbjct: 867 cttgaatgggatggctctgatgactatcacgtggtaaagagcagcaagcgcagcaccgat 808

                                         
Query: 341 gaaggggccgacccaaaagatccagtggtc 370
           ||| || ||||||||||||| ||| |||||
Sbjct: 807 gaatggtccgacccaaaagacccaatggtc 778
to top
>ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G01620 (PIP1C) mRNA,
           complete cds
          Length = 1251

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 94/117 (80%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgcccat 340
           ||||||||| || ||||||||||| |  ||||||||||  || || || || || || ||
Sbjct: 975 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 916

                                                                    
Query: 341 gaaggggccgacccaaaagatccagtggtctgaccaggcgtgctccctgttgtagat 397
           ||| || |||||||| || |||||||||||   ||| ||||| ||| ||||||||||
Sbjct: 915 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagat 859
to top
>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c
          Length = 986

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 94/117 (80%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgcccat 340
           ||||||||| || ||||||||||| |  ||||||||||  || || || || || || ||
Sbjct: 881 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 822

                                                                    
Query: 341 gaaggggccgacccaaaagatccagtggtctgaccaggcgtgctccctgttgtagat 397
           ||| || |||||||| || |||||||||||   ||| ||||| ||| ||||||||||
Sbjct: 821 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagat 765
to top
>emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B
          Length = 1057

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 94/117 (80%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgcccat 340
           ||||||||| || ||||||||||| |  ||||||||||  || || || || || || ||
Sbjct: 862 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 803

                                                                    
Query: 341 gaaggggccgacccaaaagatccagtggtctgaccaggcgtgctccctgttgtagat 397
           ||| || |||||||| || |||||||||||   ||| ||||| ||| ||||||||||
Sbjct: 802 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagat 746
to top
>emb|AJ001292.1|CPPIPA2 Craterostigma plantagineum mRNA for major intrinsic protein PIPa2
          Length = 1189

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 79/97 (81%)
 Strand = Plus / Minus

                                                                       
Query: 274 acttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcgg 333
           |||||| ||||||||| || || || || || |||  ||||||||  ||||| ||||| |
Sbjct: 927 acttggacttgaatggaatggcccttatcacaaccacgtggtaaagtgcggcgagcgctg 868

                                                
Query: 334 cgcccatgaaggggccgacccaaaagatccagtggtc 370
           |||| ||||| || ||||||||||| | |||||||||
Sbjct: 867 cgccgatgaatggtccgacccaaaatacccagtggtc 831
to top
>gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (F22L4.16) mRNA, complete cds
          Length = 1031

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 94/117 (80%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgcccat 340
           ||||||||| || ||||||||||| |  ||||||||||  || || || || || || ||
Sbjct: 903 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 844

                                                                    
Query: 341 gaaggggccgacccaaaagatccagtggtctgaccaggcgtgctccctgttgtagat 397
           ||| || |||||||| || |||||||||||   ||| ||||| ||| ||||||||||
Sbjct: 843 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagat 787
to top
>gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative plasma membrane
           intrinsic protein 1c (At1g01620) mRNA, complete cds
          Length = 861

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 94/117 (80%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgcccat 340
           ||||||||| || ||||||||||| |  ||||||||||  || || || || || || ||
Sbjct: 849 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 790

                                                                    
Query: 341 gaaggggccgacccaaaagatccagtggtctgaccaggcgtgctccctgttgtagat 397
           ||| || |||||||| || |||||||||||   ||| ||||| ||| ||||||||||
Sbjct: 789 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagat 733
to top
>emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZE08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 963

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 94/117 (80%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgcccat 340
           ||||||||| || ||||||||||| |  ||||||||||  || || || || || || ||
Sbjct: 893 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 834

                                                                    
Query: 341 gaaggggccgacccaaaagatccagtggtctgaccaggcgtgctccctgttgtagat 397
           ||| || |||||||| || |||||||||||   ||| ||||| ||| ||||||||||
Sbjct: 833 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagat 777
to top
>gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1a) mRNA, complete cds
          Length = 1129

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 97/121 (80%)
 Strand = Plus / Minus

                                                                       
Query: 277 tggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgc 336
           |||||||||||||||| |||||||| || | ||||||||| | ||| || || || || |
Sbjct: 907 tggtcttgaatgggatggctctgattactatctggtggtacaaggcagcaagagcagctc 848

                                                                       
Query: 337 ccatgaaggggccgacccaaaagatccagtggtctgaccaggcgtgctccctgttgtaga 396
           | |||||||| || ||||| || |||||   |||   |||||| ||||| ||||||||||
Sbjct: 847 caatgaagggtcccacccagaaaatccacatgtcatcccaggcatgctctctgttgtaga 788

            
Query: 397 t 397
           |
Sbjct: 787 t 787
to top
>gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (At1g01620) mRNA, complete cds
          Length = 903

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 94/117 (80%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgcccat 340
           ||||||||| || ||||||||||| |  ||||||||||  || || || || || || ||
Sbjct: 849 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 790

                                                                    
Query: 341 gaaggggccgacccaaaagatccagtggtctgaccaggcgtgctccctgttgtagat 397
           ||| || |||||||| || |||||||||||   ||| ||||| ||| ||||||||||
Sbjct: 789 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagat 733
to top
>gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, complete cds
          Length = 1189

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 281 cttgaatgggatcgctctgatgaccacctggtggta 316
           |||||||||||| |||||||| || |||||||||||
Sbjct: 937 cttgaatgggatggctctgatcacaacctggtggta 902
to top
>dbj|AB002149.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1064

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 276 ttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcg 335
           |||||||||||||| || ||||||||||  | |||||||||||  || || || || || 
Sbjct: 890 ttggtcttgaatggaatggctctgatgattatctggtggtaaactgcagcgagagcagct 831

                                           
Query: 336 cccatgaaggggccgacccaaaagatccagtg 367
           || ||||| || || ||||| |||||||||||
Sbjct: 830 ccaatgaatggtccaacccagaagatccagtg 799
to top
>gb|AY611006.1| Xerophyta humilis isolate HC398 PIP1 aquaporin mRNA, partial cds
          Length = 502

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 282 ttgaatgggatcgctctgatgaccacctggtggta 316
           ||||| ||||| ||||||||||| |||||||||||
Sbjct: 176 ttgaaggggattgctctgatgacgacctggtggta 142
to top
>emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative plasma membrane intrinsic
           protein (pip1a gene)
          Length = 1139

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 278 ggtcttgaatgggatcgctctgatgaccacctggtggta 316
           |||||||||||| || ||||||||||| | |||||||||
Sbjct: 874 ggtcttgaatggaattgctctgatgactatctggtggta 836
to top
>gb|AF452010.1|AF452010 Petunia x hybrida channel-like protein (PIP1;1) mRNA, complete cds
          Length = 1160

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 284 gaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgcccatgaa 343
           |||||| || ||||||||||  | |||||||||||  || || || || || || |||||
Sbjct: 933 gaatggaatggctctgatgattatctggtggtaaactgcagcaagtgcagctccaatgaa 874

                                      
Query: 344 ggggccgacccaaaagatccagtggtc 370
            || || ||||||||||||||||||||
Sbjct: 873 tggtccaacccaaaagatccagtggtc 847
to top
>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 282 ttgaatgggatcgctctgatgaccacctggtggta 316
           ||||| ||||| ||||||||||| |||||||||||
Sbjct: 936 ttgaaggggattgctctgatgacgacctggtggta 902
to top
>gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, complete cds
          Length = 1071

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtaaatggcggccagcgcggcgcccatgaaggggccgacccaaaagatccagtg 367
           |||||||||||  | |||||  |||||||| ||||| ||||| ||||| |||||||| ||
Sbjct: 814 ctggtggtaaaccgtggccacggcggcgccgatgaacgggccaacccagaagatccactg 755

              
Query: 368 gtc 370
           |||
Sbjct: 754 gtc 752
to top
>ref|NM_116008.2| Arabidopsis thaliana PIP1A; water channel AT3G61430 (PIP1A) mRNA,
            complete cds
          Length = 1254

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 73/90 (81%)
 Strand = Plus / Minus

                                                                        
Query: 281  cttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgcccat 340
            |||||| ||||| ||||||||||| |||   |||||||  || || || || || || ||
Sbjct: 1032 cttgaaggggatggctctgatgacaaccacatggtaaagagcagcaagtgcagctccaat 973

                                          
Query: 341  gaaggggccgacccaaaagatccagtggtc 370
            ||||||||| |||||||| | |||||||||
Sbjct: 972  gaaggggccaacccaaaacacccagtggtc 943
to top
>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence
          Length = 1348

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 333 gcgcccatgaaggggccgacccaaaagatccagtggtc 370
           ||||||| || |||||| ||||| ||||||||||||||
Sbjct: 844 gcgcccacgagggggcccacccagaagatccagtggtc 807
to top
>emb|X75881.1|ATPIP1A A.thaliana mRNA for plasma membrane intrinsic protein 1a
          Length = 1107

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 73/90 (81%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgcccat 340
           |||||| ||||| ||||||||||| |||   |||||||  || || || || || || ||
Sbjct: 900 cttgaaggggatggctctgatgacaaccacatggtaaagagcagcaagtgcagctccaat 841

                                         
Query: 341 gaaggggccgacccaaaagatccagtggtc 370
           ||||||||| |||||||| | |||||||||
Sbjct: 840 gaaggggccaacccaaaacacccagtggtc 811
to top
>ref|NM_001005829.1| Xenopus tropicalis aquaporin 1 (channel-forming integral protein,
           28kDa) (aqp1), mRNA
          Length = 950

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 348 ccgacccaaaagatccagtggt 369
           ||||||||||||||||||||||
Sbjct: 692 ccgacccaaaagatccagtggt 671
to top
>emb|AJ289701.1|VFA289701 Vicia faba mRNA for aquaporin (aq1 gene)
          Length = 995

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 73/90 (81%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgcccat 340
           |||||| ||||| ||||||||||| |||   |||||||  || || || || || || ||
Sbjct: 936 cttgaaggggatggctctgatgacaaccacatggtaaagagcagcaagtgcagctccaat 877

                                         
Query: 341 gaaggggccgacccaaaagatccagtggtc 370
           ||||||||| |||||||| | |||||||||
Sbjct: 876 gaaggggccaacccaaaacacccagtggtc 847
to top
>gb|AY097398.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, complete cds
          Length = 861

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 73/90 (81%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgcccat 340
           |||||| ||||| ||||||||||| |||   |||||||  || || || || || || ||
Sbjct: 849 cttgaaggggatggctctgatgacaaccacatggtaaagagcagcaagtgcagctccaat 790

                                         
Query: 341 gaaggggccgacccaaaagatccagtggtc 370
           ||||||||| |||||||| | |||||||||
Sbjct: 789 gaaggggccaacccaaaacacccagtggtc 760
to top
>gb|AY058113.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, complete cds
          Length = 1092

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 73/90 (81%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgcccat 340
           |||||| ||||| ||||||||||| |||   |||||||  || || || || || || ||
Sbjct: 916 cttgaaggggatggctctgatgacaaccacatggtaaagagcagcaagtgcagctccaat 857

                                         
Query: 341 gaaggggccgacccaaaagatccagtggtc 370
           ||||||||| |||||||| | |||||||||
Sbjct: 856 gaaggggccaacccaaaacacccagtggtc 827
to top
>gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, complete cds
          Length = 1101

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 73/90 (81%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgcccat 340
           |||||||||||| ||||||||||| | |  ||||||||  || || ||||| || || ||
Sbjct: 868 cttgaatgggatggctctgatgactatcacgtggtaaagagcagcaagcgcagcaccgat 809

                                         
Query: 341 gaaggggccgacccaaaagatccagtggtc 370
           ||| || || |||||||||| ||| |||||
Sbjct: 808 gaatggtccaacccaaaagacccaatggtc 779
to top
>emb|BX824874.1|CNS0A5T5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH79ZH01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 946

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 73/90 (81%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgcccat 340
           |||||| ||||| ||||||||||| |||   |||||||  || || || || || || ||
Sbjct: 787 cttgaaggggatggctctgatgacaaccacatggtaaagagcagcaagtgcagctccaat 728

                                         
Query: 341 gaaggggccgacccaaaagatccagtggtc 370
           ||||||||| |||||||| | |||||||||
Sbjct: 727 gaaggggccaacccaaaacacccagtggtc 698
to top
>emb|BX823595.1|CNS0A5AA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS55ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1059

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 73/90 (81%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgcccat 340
           |||||| ||||| ||||||||||| |||   |||||||  || || || || || || ||
Sbjct: 895 cttgaaggggatggctctgatgacaaccacatggtaaagagcagcaagtgcagctccaat 836

                                         
Query: 341 gaaggggccgacccaaaagatccagtggtc 370
           ||||||||| |||||||| | |||||||||
Sbjct: 835 gaaggggccaacccaaaacacccagtggtc 806
to top
>dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane intrinsic protein
           2;4, complete cds
          Length = 1263

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 309 tggtggtaaatggcggccagcgcggcgcccatgaaggggccgacccaaaagatccagtgg 368
           |||||||||||||| || |  || || || ||||| || || ||||||||||||||||||
Sbjct: 837 tggtggtaaatggcagctatggcagcaccaatgaaaggtcccacccaaaagatccagtgg 778

             
Query: 369 tc 370
           ||
Sbjct: 777 tc 776
to top
>gb|AY088439.1| Arabidopsis thaliana clone 6690 mRNA, complete sequence
          Length = 1234

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 73/90 (81%)
 Strand = Plus / Minus

                                                                        
Query: 281  cttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgcccat 340
            |||||| ||||| ||||||||||| |||   |||||||  || || || || || || ||
Sbjct: 1032 cttgaaggggatggctctgatgacaaccacatggtaaagagcagcaagtgcagctccaat 973

                                          
Query: 341  gaaggggccgacccaaaagatccagtggtc 370
            ||||||||| |||||||| | |||||||||
Sbjct: 972  gaaggggccaacccaaaacacccagtggtc 943
to top
>gb|AF266760.1|AF266760 Vicia faba plasma membrane aquaporin mRNA, complete cds
          Length = 920

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 73/90 (81%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgcccat 340
           |||||| ||||| ||||||||||| |||   |||||||  || || || || || || ||
Sbjct: 895 cttgaaggggatggctctgatgacaaccacatggtaaagagcagcaagtgcagctccaat 836

                                         
Query: 341 gaaggggccgacccaaaagatccagtggtc 370
           ||||||||| |||||||| | |||||||||
Sbjct: 835 gaaggggccaacccaaaacacccagtggtc 806
to top
>emb|AJ699398.2| Chenopodium rubrum mRNA for aquaporin PIP1 (PIP1 gene)
          Length = 1163

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggta 316
           ||||| |||||||||||| |||||||| || | |||||||||
Sbjct: 969 cttggacttgaatgggatggctctgataacaatctggtggta 928
to top
>gb|BC075384.1| Xenopus tropicalis aquaporin 1 (channel-forming integral protein,
           28kDa), mRNA (cDNA clone MGC:89110 IMAGE:7006583),
           complete cds
          Length = 950

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 348 ccgacccaaaagatccagtggt 369
           ||||||||||||||||||||||
Sbjct: 692 ccgacccaaaagatccagtggt 671
to top
>ref|XM_473219.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 873

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 330 gcggcgcccatgaaggggccgacccaaaagatccagtggtc 370
           |||||||| |||| ||| || ||||| ||||||||||||||
Sbjct: 794 gcggcgccgatgaggggccccacccagaagatccagtggtc 754
to top
>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds
          Length = 1104

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 330 gcggcgcccatgaaggggccgacccaaaagatccagtggtc 370
           |||||||| ||||| || || ||||| ||||||||||||||
Sbjct: 782 gcggcgccgatgaatggacccacccagaagatccagtggtc 742
to top
>emb|AL138758.7| Human DNA sequence from clone RP5-824O18 on chromosome 1p11.2-13.1
             Contains the 3' end of the ABCD3 gene for ATP-binding
             cassette sub-family D (ALD) member 3, the F3 gene for
             coagulation factor III (thromboplastin, tissue factor), a
             novel gene and a CpG island, complete sequence
          Length = 108205

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 198   aaaaagaaattcactcaaaac 218
             |||||||||||||||||||||
Sbjct: 83524 aaaaagaaattcactcaaaac 83504
to top
>gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-3
           (PIP1-3) mRNA, complete cds
          Length = 1159

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 69/85 (81%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccca 339
           |||||||||| || ||||||||||| | ||| ||||| ||||| || || || || || |
Sbjct: 909 tcttgaatggaatggctctgatgactatctgatggtacatggcagcaagagcagctccaa 850

                                    
Query: 340 tgaaggggccgacccaaaagatcca 364
           |||| || || ||||| ||||||||
Sbjct: 849 tgaaaggtcccacccagaagatcca 825
to top
>gb|AC093117.2| Homo sapiens chromosome 1 clone RP11-86H7, complete sequence
          Length = 200426

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 198   aaaaagaaattcactcaaaac 218
             |||||||||||||||||||||
Sbjct: 62382 aaaaagaaattcactcaaaac 62362
to top
>gb|AC153823.5| Mus musculus 10 BAC RP23-11M21 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 210101

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 127   acatcaaacttggaagacaaa 147
             |||||||||||||||||||||
Sbjct: 24157 acatcaaacttggaagacaaa 24177
to top
>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete
           cds
          Length = 1207

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 330 gcggcgcccatgaaggggccgacccaaaagatccagtggtc 370
           |||||||| ||||| || || ||||| ||||||||||||||
Sbjct: 837 gcggcgccgatgaatggacccacccagaagatccagtggtc 797
to top
>gb|AF188844.1|AF188844 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1b) mRNA, complete cds
          Length = 1119

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 69/85 (81%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccca 339
           |||||||||| || ||||||||||| | ||| ||||| ||||| || || || || || |
Sbjct: 910 tcttgaatggaatggctctgatgactatctgctggtacatggcagcaagagcagctccaa 851

                                    
Query: 340 tgaaggggccgacccaaaagatcca 364
           |||| || || ||||| ||||||||
Sbjct: 850 tgaacggtcccacccagaagatcca 826
to top
>gb|AC153943.3| Mus musculus 10 BAC RP24-408O23 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 171960

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 127    acatcaaacttggaagacaaa 147
              |||||||||||||||||||||
Sbjct: 121183 acatcaaacttggaagacaaa 121203
to top
>gb|AY787752.1| Hepatitis C virus isolate HVR1-12 polyprotein gene, partial cds
          Length = 369

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 342 aaggggccgacccaaaagatccag 365
           ||||||||| ||||||||||||||
Sbjct: 56  aaggggccgtcccaaaagatccag 79
to top
>ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G45960 (PIP1B) mRNA,
           complete cds
          Length = 1259

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 988 cttgaatgggatggctctgatgac 965
to top
>ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channel AT4G23400
           (PIP1;5/PIP1D) mRNA, complete cds
          Length = 1128

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 77/96 (80%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 907 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 848

                                               
Query: 335 gcccatgaaggggccgacccaaaagatccagtggtc 370
            || ||||| || |||||||| |||||||| |||||
Sbjct: 847 accaatgaatggaccgacccagaagatccaatggtc 812
to top
>ref|NM_105978.2| Arabidopsis thaliana water channel AT1G73190 mRNA, complete cds
          Length = 1612

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 339 atgaaggggccgacccaaaagatccagtggtc 370
           ||||| || ||||||||| |||||||||||||
Sbjct: 907 atgaatggtccgacccaatagatccagtggtc 876
to top
>gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds
          Length = 1216

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 339 atgaaggggccgacccaaaagatccagtggtc 370
           |||||||| || |||||||||||||| |||||
Sbjct: 836 atgaagggtccaacccaaaagatccactggtc 805
to top
>ref|XM_521983.1| PREDICTED: Pan troglodytes similar to expressed sequence AI841794
           (LOC466584), mRNA
          Length = 1269

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 15  tgctggatttgcacaacaac 34
           ||||||||||||||||||||
Sbjct: 407 tgctggatttgcacaacaac 426
to top
>ref|NM_187092.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1242

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 330 gcggcgcccatgaaggggccgacccaaaagatccagtggt 369
           |||||||| | ||| ||||||||||| |||||||| ||||
Sbjct: 901 gcggcgccgacgaacgggccgacccagaagatccaatggt 862
to top
>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1257

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 330 gcggcgcccatgaaggggccgacccaaaagatccagtggt 369
           |||||||| | ||| ||||||||||| |||||||| ||||
Sbjct: 903 gcggcgccgacgaacgggccgacccagaagatccaatggt 864
to top
>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1298

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 330 gcggcgcccatgaaggggccgacccaaaagatccagtggt 369
           |||||||| | ||| ||||||||||| |||||||| ||||
Sbjct: 904 gcggcgccgacgaacgggccgacccagaagatccaatggt 865
to top
>ref|NM_001005210.1| Homo sapiens leucine rich repeat containing 55 (LRRC55), mRNA
          Length = 3797

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 15  tgctggatttgcacaacaac 34
           ||||||||||||||||||||
Sbjct: 554 tgctggatttgcacaacaac 573
to top
>gb|AF499725.1| Thellungiella halophila plasma membrane intrinsic protein 1B-like
           protein mRNA, complete cds
          Length = 833

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 671 cttgaatgggattgctctgatgac 648
to top
>gb|AC152940.2| Mus musculus BAC clone RP23-264B6 from chromosome 15, complete sequence
          Length = 224704

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 198   aaaaagaaattcactcaaaa 217
             ||||||||||||||||||||
Sbjct: 94982 aaaaagaaattcactcaaaa 94963
to top
>gb|AC126028.4| Mus musculus BAC clone RP24-542M6 from chromosome 15, complete sequence
          Length = 168344

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 198   aaaaagaaattcactcaaaa 217
             ||||||||||||||||||||
Sbjct: 12511 aaaaagaaattcactcaaaa 12530
to top
>emb|AJ001416.1|NTAQUAPOR Nicotiana tabacum mRNA for aquaporin 1
          Length = 1204

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 351 acccaaaagatccagtggtc 370
           ||||||||||||||||||||
Sbjct: 854 acccaaaagatccagtggtc 835
to top
>gb|AC007528.5| Homo sapiens 12 BAC RP11-473N11 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 188451

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 106    cagagcaagagcaagagtag 125
              ||||||||||||||||||||
Sbjct: 155822 cagagcaagagcaagagtag 155841
to top
>gb|AC124743.5| Mus musculus BAC clone RP23-219C1 from 1, complete sequence
          Length = 220167

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 198    aaaaagaaattcactcaaaa 217
              ||||||||||||||||||||
Sbjct: 188243 aaaaagaaattcactcaaaa 188224
to top
>emb|CR733851.2|CNS0GT0Q Tetraodon nigroviridis full-length cDNA
          Length = 502

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 358 agatccagtggtctgaccag 377
           ||||||||||||||||||||
Sbjct: 365 agatccagtggtctgaccag 384
to top
>gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic protein 1-like
           protein mRNA, partial cds
          Length = 474

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 351 acccaaaagatccagtggtc 370
           ||||||||||||||||||||
Sbjct: 440 acccaaaagatccagtggtc 421
to top
>emb|AL161722.9| Human DNA sequence from clone RP11-497J7 on chromosome X Contains a
              melanoma antigen family B 4 pseudogene and a nuclear
              transcription factor Y, gamma (NFYC) pseudogene, complete
              sequence
          Length = 154594

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 198    aaaaagaaattcactcaaaa 217
              ||||||||||||||||||||
Sbjct: 104634 aaaaagaaattcactcaaaa 104653
to top
>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 318    atggcggccagcgcggcgcc 337
              ||||||||||||||||||||
Sbjct: 310344 atggcggccagcgcggcgcc 310363
to top
>emb|AL117377.18|HSJ1037B9 Human DNA sequence from clone RP5-1037B9 on chromosome 20p12.1-13
             Contains STSs, GSSs and a putative CpG island, complete
             sequence
          Length = 82183

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 126   cacatcaaacttggaagaca 145
             ||||||||||||||||||||
Sbjct: 72891 cacatcaaacttggaagaca 72872
to top
>gb|AC163448.2| Mus musculus chromosome 1, clone RP24-327O21, complete sequence
          Length = 150247

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 198   aaaaagaaattcactcaaaa 217
             ||||||||||||||||||||
Sbjct: 67631 aaaaagaaattcactcaaaa 67650
to top
>emb|CR354559.6| Zebrafish DNA sequence from clone CH211-210F24 in linkage group 17,
             complete sequence
          Length = 54604

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 200   aaagaaattcactcaaaaca 219
             ||||||||||||||||||||
Sbjct: 16871 aaagaaattcactcaaaaca 16890
to top
>emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein
          Length = 1064

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 908 cttgaatgggatggctctgatgac 885
to top
>emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel protein (mipA)
          Length = 1104

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 886 cttgaatgggatggctctgatgac 863
to top
>gb|AY117339.1| Arabidopsis thaliana putative tonoplast intrinsic protein alpha-TIP
           (At1g73190) mRNA, complete cds
          Length = 838

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 339 atgaaggggccgacccaaaagatccagtggtc 370
           ||||| || ||||||||| |||||||||||||
Sbjct: 698 atgaatggtccgacccaatagatccagtggtc 667
to top
>gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (At2g45960) mRNA,
           complete cds
          Length = 892

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 849 cttgaatgggatggctctgatgac 826
to top
>emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A
          Length = 1105

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 903 cttgaatgggatggctctgatgac 880
to top
>gb|AY064054.1| Arabidopsis thaliana putative tonoplast intrinsic protein alpha-TIP
           (At1g73190) mRNA, complete cds
          Length = 998

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 339 atgaaggggccgacccaaaagatccagtggtc 370
           ||||| || ||||||||| |||||||||||||
Sbjct: 732 atgaatggtccgacccaatagatccagtggtc 701
to top
>gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma membrane intrinsic
           protein 1B (At2g45960) mRNA, complete cds
          Length = 1077

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 909 cttgaatgggatggctctgatgac 886
to top
>emb|X63551.1|ATATIPARA A.thaliana gene for tonoplast intrinsic protein alpha-TIP(Ara)
          Length = 1842

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 339  atgaaggggccgacccaaaagatccagtggtc 370
            ||||| || ||||||||| |||||||||||||
Sbjct: 1469 atgaatggtccgacccaatagatccagtggtc 1438
to top
>emb|CR847868.9| Zebrafish DNA sequence from clone DKEYP-99G4 in linkage group 8,
             complete sequence
          Length = 147399

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 199   aaaagaaattcactcaaaac 218
             ||||||||||||||||||||
Sbjct: 93607 aaaagaaattcactcaaaac 93588
to top
>emb|BX548158.10| Zebrafish DNA sequence from clone CH211-106G4 in linkage group 8,
             complete sequence
          Length = 190936

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 199   aaaagaaattcactcaaaac 218
             ||||||||||||||||||||
Sbjct: 14723 aaaagaaattcactcaaaac 14742
to top
>gb|AC182472.3| Pan troglodytes BAC clone CH251-394C9 from chromosome 19, complete
              sequence
          Length = 165954

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 247    catctttctttgtagcagcagctt 270
              |||||||| |||||||||||||||
Sbjct: 108793 catctttcattgtagcagcagctt 108770
to top
>dbj|AK127591.1| Homo sapiens cDNA FLJ45686 fis, clone FCBBF3012443
          Length = 3797

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 15  tgctggatttgcacaacaac 34
           ||||||||||||||||||||
Sbjct: 554 tgctggatttgcacaacaac 573
to top
>gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map CIC02E07, complete
             sequence
          Length = 101647

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 281   cttgaatgggatcgctctgatgac 304
             |||||||||||| |||||||||||
Sbjct: 15226 cttgaatgggatggctctgatgac 15249
to top
>gb|AY081593.1| Arabidopsis thaliana water channel-like protein (At4g23400) mRNA,
           complete cds
          Length = 956

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 77/96 (80%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 858 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 799

                                               
Query: 335 gcccatgaaggggccgacccaaaagatccagtggtc 370
            || ||||| || |||||||| |||||||| |||||
Sbjct: 798 accaatgaatggaccgacccagaagatccaatggtc 763
to top
>gb|AC016493.14| Homo sapiens chromosome 18, clone RP11-58G13, complete sequence
          Length = 163936

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 136    ttggaagacaaattggaatt 155
              ||||||||||||||||||||
Sbjct: 159892 ttggaagacaaattggaatt 159873
to top
>gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-1
           (PIP2-1) mRNA, complete cds
          Length = 1300

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 339 atgaaggggccgacccaaaagatccagtggtc 370
           |||||||| || |||||||||||||| |||||
Sbjct: 832 atgaagggtccaacccaaaagatccactggtc 801
to top
>gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-2
           (PIP1-2) mRNA, complete cds
          Length = 1154

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 281 cttgaatgggatcgctctgatgaccacctggtggta 316
           |||||||||||| |||||||| || | |||||||||
Sbjct: 911 cttgaatgggatggctctgattactatctggtggta 876
to top
>ref|XM_944599.1| PREDICTED: Homo sapiens hypothetical protein LOC651325 (LOC651325),
            mRNA
          Length = 1350

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 320  ggcggccagcgcggcgccca 339
            ||||||||||||||||||||
Sbjct: 1011 ggcggccagcgcggcgccca 992
to top
>ref|XM_933141.1| PREDICTED: Homo sapiens hypothetical protein LOC645781 (LOC645781),
            mRNA
          Length = 1350

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 320  ggcggccagcgcggcgccca 339
            ||||||||||||||||||||
Sbjct: 1011 ggcggccagcgcggcgccca 992
to top
>gb|AC023577.6| Homo sapiens chromosome 18, clone RP11-645D5, complete sequence
          Length = 166503

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 136   ttggaagacaaattggaatt 155
             ||||||||||||||||||||
Sbjct: 50150 ttggaagacaaattggaatt 50131
to top
>gb|AY059948.1| Arabidopsis thaliana water channel - like protein (At4g23400;
           F16G20.100) mRNA, complete cds
          Length = 1125

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 77/96 (80%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 907 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 848

                                               
Query: 335 gcccatgaaggggccgacccaaaagatccagtggtc 370
            || ||||| || |||||||| |||||||| |||||
Sbjct: 847 accaatgaatggaccgacccagaagatccaatggtc 812
to top
>dbj|AK222086.1| Arabidopsis thaliana mRNA for aquaporin, partial cds, clone:
           RAFL22-84-C08
          Length = 318

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 111 cttgaatgggatggctctgatgac 88
to top
>dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - like protein, partial
           cds, clone: RAFL24-17-A12
          Length = 392

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 77/96 (80%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 163 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 104

                                               
Query: 335 gcccatgaaggggccgacccaaaagatccagtggtc 370
            || ||||| || |||||||| |||||||| |||||
Sbjct: 103 accaatgaatggaccgacccagaagatccaatggtc 68
to top
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 330     gcggcgcccatgaaggggcc 349
               ||||||||||||||||||||
Sbjct: 3728151 gcggcgcccatgaaggggcc 3728132
to top
>gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205), mRNA sequence
          Length = 1913

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 909 cttgaatgggatggctctgatgac 886
to top
>gb|AC010556.6|AC010556 Arabidopsis thaliana chromosome 1 BAC T18K17 genomic sequence, complete
             sequence
          Length = 70836

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 339   atgaaggggccgacccaaaagatccagtggtc 370
             ||||| || ||||||||| |||||||||||||
Sbjct: 44645 atgaatggtccgacccaatagatccagtggtc 44676
to top
>gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, complete cds
          Length = 1084

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 885 cttgaatgggatggctctgatgac 862
to top
>emb|BX818487.1|CNS0AB8P Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL81ZG06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 967

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 339 atgaaggggccgacccaaaagatccagtggtc 370
           ||||| || ||||||||| |||||||||||||
Sbjct: 717 atgaatggtccgacccaatagatccagtggtc 686
to top
>emb|BX817607.1|CNS0AB8S Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL32ZD08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 924

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 339 atgaaggggccgacccaaaagatccagtggtc 370
           ||||| || ||||||||| |||||||||||||
Sbjct: 715 atgaatggtccgacccaatagatccagtggtc 684
to top
>emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS86ZH06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1084

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 889 cttgaatgggatggctctgatgac 866
to top
>emb|BX819664.1|CNS0A8JV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS13ZG09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 679

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 522 cttgaatgggatggctctgatgac 499
to top
>emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH87ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1036

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 894 cttgaatgggatggctctgatgac 871
to top
>emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS2ZA01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1060

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 881 cttgaatgggatggctctgatgac 858
to top
>emb|BX824209.1|CNS0A5OV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH30ZB01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1026

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 339 atgaaggggccgacccaaaagatccagtggtc 370
           ||||||||||| |||||||| | |||||||||
Sbjct: 816 atgaaggggccaacccaaaacacccagtggtc 785
to top
>emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB41ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 454

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 77/96 (80%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 231 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 172

                                               
Query: 335 gcccatgaaggggccgacccaaaagatccagtggtc 370
            || ||||| || |||||||| |||||||| |||||
Sbjct: 171 accaatgaatggaccgacccagaagatccaatggtc 136
to top
>emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB51ZF11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 710

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 77/96 (80%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 490 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 431

                                               
Query: 335 gcccatgaaggggccgacccaaaagatccagtggtc 370
            || ||||| || |||||||| |||||||| |||||
Sbjct: 430 accaatgaatggaccgacccagaagatccaatggtc 395
to top
>emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS21ZB06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 77/96 (80%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 871 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 812

                                               
Query: 335 gcccatgaaggggccgacccaaaagatccagtggtc 370
            || ||||| || |||||||| |||||||| |||||
Sbjct: 811 accaatgaatggaccgacccagaagatccaatggtc 776
to top
>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel
           protein, partial cds
          Length = 880

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 330 gcggcgcccatgaaggggccgacccaaaagatccagtggt 369
           |||||||| | ||| ||||||||||| |||||||| ||||
Sbjct: 467 gcggcgccgacgaacgggccgacccagaagatccattggt 428
to top
>gb|AC011500.7| Homo sapiens chromosome 19 clone CTB-60E11, complete sequence
          Length = 200430

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 247    catctttctttgtagcagcagctt 270
              |||||||| |||||||||||||||
Sbjct: 139931 catctttcattgtagcagcagctt 139908
to top
>gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete sequence
          Length = 1089

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 77/96 (80%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 905 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 846

                                               
Query: 335 gcccatgaaggggccgacccaaaagatccagtggtc 370
            || ||||| || |||||||| |||||||| |||||
Sbjct: 845 accaatgaatggaccgacccagaagatccaatggtc 810
to top
>gb|AC010336.8| Homo sapiens chromosome 19 clone CTD-3193O13, complete sequence
          Length = 160770

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 320   ggcggccagcgcggcgccca 339
             ||||||||||||||||||||
Sbjct: 99042 ggcggccagcgcggcgccca 99023
to top
>gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, complete cds
          Length = 1052

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 909 cttgaatgggatggctctgatgac 886
to top
>gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1) mRNA, complete
           cds
          Length = 480

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 339 atgaaggggccgacccaaaagatccagtggtc 370
           |||||||| || |||||||||||||| |||||
Sbjct: 386 atgaagggtccaacccaaaagatccactggtc 355
to top
>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full
           insert sequence
          Length = 1216

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 330 gcggcgcccatgaaggggccgacccaaaagatccagtggt 369
           |||||||| | ||| ||||||||||| |||||||| ||||
Sbjct: 901 gcggcgccgacgaacgggccgacccagaagatccaatggt 862
to top
>emb|Z17399.1|ATORFB Arabidopsis thaliana PIP1b gene
          Length = 2773

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 281  cttgaatgggatcgctctgatgac 304
            |||||||||||| |||||||||||
Sbjct: 1547 cttgaatgggatggctctgatgac 1524
to top
>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full
           insert sequence
          Length = 1451

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 330 gcggcgcccatgaaggggccgacccaaaagatccagtggt 369
           |||||||| | ||| ||||||||||| |||||||| ||||
Sbjct: 495 gcggcgccgacgaacgggccgacccagaagatccaatggt 456
to top
>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full
           insert sequence
          Length = 1242

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 330 gcggcgcccatgaaggggccgacccaaaagatccagtggt 369
           |||||||| | ||| ||||||||||| |||||||| ||||
Sbjct: 901 gcggcgccgacgaacgggccgacccagaagatccaatggt 862
to top
>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full
           insert sequence
          Length = 1257

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 330 gcggcgcccatgaaggggccgacccaaaagatccagtggt 369
           |||||||| | ||| ||||||||||| |||||||| ||||
Sbjct: 903 gcggcgccgacgaacgggccgacccagaagatccaatggt 864
to top
>emb|AJ328109.1|HSA328109 Homo sapiens genomic sequence surrounding NotI site, clone
           NL4-DO24RS
          Length = 728

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 320 ggcggccagcgcggcgccca 339
           ||||||||||||||||||||
Sbjct: 246 ggcggccagcgcggcgccca 227
to top
>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full
           insert sequence
          Length = 1298

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 330 gcggcgcccatgaaggggccgacccaaaagatccagtggt 369
           |||||||| | ||| ||||||||||| |||||||| ||||
Sbjct: 904 gcggcgccgacgaacgggccgacccagaagatccaatggt 865
to top
>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds
          Length = 1328

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 330 gcggcgcccatgaaggggccgacccaaaagatccagtggt 369
           |||||||| | ||| ||||||||||| |||||||| ||||
Sbjct: 891 gcggcgccgacgaacgggccgacccagaagatccaatggt 852
to top
>dbj|AP001786.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-176J24, complete
             sequences
          Length = 171744

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 15    tgctggatttgcacaacaac 34
             ||||||||||||||||||||
Sbjct: 92890 tgctggatttgcacaacaac 92909
to top
>gb|DQ151348.1| Petromyzon marinus clone T.D8 variable lymphocyte receptor
           diversity region (VLR) mRNA, partial cds
          Length = 534

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 15  tgctggatttgcacaacaac 34
           ||||||||||||||||||||
Sbjct: 263 tgctggatttgcacaacaac 282
to top
>gb|AF024511.1|AF024511 Nicotiana tabacum aquaporin 1 mRNA, complete cds
          Length = 1158

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 351 acccaaaagatccagtggtc 370
           ||||||||||||||||||||
Sbjct: 854 acccaaaagatccagtggtc 835
to top
>gb|U60149.1|BVU60149 Beta vulgaris plasma membrane major intrinsic protein 3 mRNA,
           complete cds
          Length = 1292

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 339 atgaaggggccgacccaaaagatccagtggtc 370
           |||||||| || ||||| ||||||||||||||
Sbjct: 878 atgaagggtcccacccagaagatccagtggtc 847
to top
>gb|AF004293.1|AF004293 Brassica rapa aquaporin (MOD) mRNA, complete cds
          Length = 900

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 867 cttgaatgggatggctctgatgac 844
to top
>gb|AC172859.1| Brassica rapa subsp. pekinensis clone KBrB023K01, complete sequence
          Length = 102061

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 334   cgcccatgaaggggccgacccaaaagatccagtggt 369
             |||| |||||||| || |||||| ||||||||||||
Sbjct: 90569 cgccaatgaagggcccaacccaatagatccagtggt 90534
to top
>gb|M84343.1|ATHATIP Arabidopsis thaliana tonoplast intrinsic protein (alpha-TIP) gene,
            complete cds
          Length = 1842

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 339  atgaaggggccgacccaaaagatccagtggtc 370
            ||||| || ||||||||| |||||||||||||
Sbjct: 1469 atgaatggtccgacccaatagatccagtggtc 1438
to top
>dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane aquaporin 1b,
           complete cds
          Length = 1053

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 870 cttgaatgggatggctctgatgac 847
to top
>dbj|AB002148.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1116

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 351 acccaaaagatccagtggtc 370
           ||||||||||||||||||||
Sbjct: 847 acccaaaagatccagtggtc 828


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,771,385
Number of Sequences: 3902068
Number of extensions: 3771385
Number of successful extensions: 78954
Number of sequences better than 10.0: 168
Number of HSP's better than 10.0 without gapping: 158
Number of HSP's successfully gapped in prelim test: 10
Number of HSP's that attempted gapping in prelim test: 78630
Number of HSP's gapped (non-prelim): 313
length of query: 397
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 375
effective length of database: 17,147,199,772
effective search space: 6430199914500
effective search space used: 6430199914500
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top