ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart12h08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT009279.1| Triticum aestivum clone wlk8.pk0021.b11:fis, full... 617 e-173
2dbj|AK060205.1| Oryza sativa (japonica cultivar-group) cDNA clon... 408 e-111
3dbj|AK072535.1| Oryza sativa (japonica cultivar-group) cDNA clon... 402 e-109
4ref|XM_479974.1| Oryza sativa (japonica cultivar-group), mRNA 400 e-108
5dbj|AK069187.1| Oryza sativa (japonica cultivar-group) cDNA clon... 400 e-108
6gb|BT016988.1| Zea mays clone EK07D2304D07.c mRNA sequence 315 8e-83
7gb|M76685.1|MZEORP2A Zea mays tryptophan synthase beta-subunit (... 315 8e-83
8gb|AY104030.1| Zea mays PCO122526 mRNA sequence 289 4e-75
9gb|M76684.1|MZEORP1A Zea mays tryptophan synthase beta-subunit (... 289 4e-75
10dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 228 1e-56
11dbj|AP003896.3| Oryza sativa (japonica cultivar-group) genomic D... 228 1e-56
12dbj|AP005620.3| Oryza sativa (japonica cultivar-group) genomic D... 228 1e-56
13gb|AY555143.1| Zea may BAC clone c573L14, complete sequence 167 4e-38
14gb|AY555142.1| Zea mays BAC clone c573F08, complete sequence 163 7e-37
15gb|AF466200.2| Sorghum bicolor putative protein kinase gene, par... 151 3e-33
16dbj|AB003491.1| Oryza sativa mRNA for tryptophan synthase B, com... 82 2e-12
17ref|NM_118841.2| Arabidopsis thaliana TSB2 (TRYPTOPHAN SYNTHASE ... 68 3e-08
18gb|BT003144.1| Arabidopsis thaliana At4g27070 mRNA, complete cds 68 3e-08
19gb|AY084334.1| Arabidopsis thaliana clone 104687 mRNA, complete ... 68 3e-08
20ref|NM_124862.3| Arabidopsis thaliana TSB1 (TRYPTOPHAN SYNTHASE ... 64 5e-07
21gb|AY133620.1| Arabidopsis thaliana AT5g54810/MBG8_7 mRNA, compl... 64 5e-07
22dbj|AK221396.1| Arabidopsis thaliana mRNA for tryptophan synthas... 64 5e-07
23gb|AF367264.1|AF367264 Arabidopsis thaliana AT5g54810/MBG8_7 mRN... 64 5e-07
24emb|BX831233.1|CNS0A1P3 Arabidopsis thaliana Full-length cDNA Co... 64 5e-07
25emb|BX829760.1|CNS0A1C2 Arabidopsis thaliana Full-length cDNA Co... 64 5e-07
26emb|BX829703.1|CNS0A1IO Arabidopsis thaliana Full-length cDNA Co... 64 5e-07
27emb|BX831477.1|CNS0A0OO Arabidopsis thaliana Full-length cDNA Co... 64 5e-07
28emb|BX831093.1|CNS0A0PA Arabidopsis thaliana Full-length cDNA Co... 64 5e-07
29gb|AY087382.1| Arabidopsis thaliana clone 34783 mRNA, complete s... 64 5e-07
30gb|AY761528.1| Sorghum bicolor clone 51836 unknown sequence 64 5e-07
31gb|AY761527.1| Sorghum bicolor clone 50744 unknown sequence 64 5e-07
32gb|AY761526.1| Sorghum bicolor clone 213900 unknown sequence 64 5e-07
33gb|AY761525.1| Sorghum arundinaceum clone LWA88 unknown sequence 64 5e-07
34gb|AY761524.1| Sorghum x drummondii clone LWA71 unknown sequence 64 5e-07
35gb|AY761523.1| Sorghum arundinaceum clone LWA42 unknown sequence 64 5e-07
36gb|AY761522.1| Sorghum arundinaceum clone LWA28 unknown sequence 64 5e-07
37gb|AY761521.1| Sorghum arundinaceum clone LWA13b unknown sequence 64 5e-07
38gb|AY761520.1| Sorghum arundinaceum clone LWA13a unknown sequence 64 5e-07
39gb|AY761519.1| Sorghum arundinaceum clone LWA22 unknown sequence 64 5e-07
40gb|AY761518.1| Sorghum bicolor clone 257595 unknown sequence 64 5e-07
41gb|AY761517.1| Sorghum bicolor clone 221540 unknown sequence 64 5e-07
42gb|AY761516.1| Sorghum bicolor clone 221655 unknown sequence 64 5e-07
43gb|AY761515.1| Sorghum bicolor clone 221607 unknown sequence 64 5e-07
44gb|AY761514.1| Sorghum bicolor clone 22913 unknown sequence 64 5e-07
45gb|AY761513.1| Sorghum bicolor clone BTx623 unknown sequence 64 5e-07
46gb|AY761512.1| Sorghum bicolor clone 287624 unknown sequence 64 5e-07
47gb|AY761511.1| Sorghum bicolor clone 510906 unknown sequence 64 5e-07
48gb|AY761510.1| Sorghum bicolor clone 267523 unknown sequence 64 5e-07
49gb|AY761509.1| Sorghum bicolor clone 267525 unknown sequence 64 5e-07
50gb|AY761508.1| Sorghum bicolor clone 510985 unknown sequence 64 5e-07
51gb|AY761507.1| Sorghum bicolor clone 77034 unknown sequence 64 5e-07
52gb|AY761506.1| Sorghum bicolor clone 83707 unknown sequence 64 5e-07
53gb|AY761505.1| Sorghum bicolor clone 87088 unknown sequence 64 5e-07
54gb|AY761504.1| Sorghum bicolor clone 55751 unknown sequence 64 5e-07
55gb|AY761503.1| Sorghum bicolor clone 51365 unknown sequence 64 5e-07
56gb|AY761502.1| Sorghum bicolor clone 51032 unknown sequence 64 5e-07
57gb|AY761501.1| Sorghum bicolor clone 51397 unknown sequence 64 5e-07
58gb|AY761500.1| Sorghum bicolor clone 50875 unknown sequence 64 5e-07
59gb|AY761499.1| Sorghum bicolor clone RTx430 unknown sequence 64 5e-07
60gb|AY761498.1| Sorghum bicolor clone 152702 unknown sequence 64 5e-07
61gb|AE006013.1| Caulobacter crescentus CB15 section 339 of 359 of... 58 3e-05
62gb|M19129.1|CCRTRPFBA C.crescentus trpFBA operon genes encoding ... 58 3e-05
63emb|X13299.1|PPTRPAB P. putida trpB and trpA genes for tryptopha... 56 1e-04
64gb|CP000095.1| Prochlorococcus marinus str. NATL2A, complete genome 50 0.007
65emb|BX834018.1|CNS0A0KQ Arabidopsis thaliana Full-length cDNA Co... 50 0.007
66dbj|BA000039.2| Thermosynechococcus elongatus BP-1 DNA, complete... 50 0.007
67gb|AF042320.1|AF042320 Camptotheca acuminata tryptophan synthase... 50 0.007
68gb|CP000109.1| Thiomicrospira crunogena XCL-2, complete genome 48 0.028
69ref|XM_454431.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E10637g ... 48 0.028
70gb|U53153.1| Caenorhabditis elegans cosmid T19A5, complete sequence 48 0.028
71emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 48 0.028
72emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 48 0.028
73gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome 46 0.11
74emb|CR543861.1| Acinetobacter sp. ADP1 complete genome 46 0.11
75dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome 46 0.11
76dbj|AB005232.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 46 0.11
77gb|M23872.1|ATHTRPB A.thaliana tryptophan synthase beta subunit ... 46 0.11
78gb|M58444.1|ACCTRPFB A.calcoaceticus trpFB operon 46 0.11
79gb|AC130666.9| Mus musculus chromosome 5, clone RP24-79O7, compl... 44 0.44
80gb|AC124565.2| Mus musculus BAC clone RP23-143I23 from 16, compl... 44 0.44
81emb|BX569695.1| Synechococcus sp. WH8102 complete genome; segmen... 44 0.44
82gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 44 0.44
83dbj|AB178644.1| Polygonum tinctorium mRNA for tryptophan synthas... 44 0.44
84dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete g... 44 0.44
85gb|AF047024.1|AF047024 Chlamydomonas reinhardtii tryptophan synt... 44 0.44
86gb|CP000112.1| Desulfovibrio desulfuricans G20, complete genome 42 1.8
87ref|XM_637643.1| Dictyostelium discoideum hypothetical protein (... 42 1.8
88gb|AE014825.1| Plasmodium falciparum 3D7 chromosome 14 section 1... 42 1.8
89gb|AY246079.1| Escherichia coli strain DAEC192 tryptophan syntha... 42 1.8
90gb|AY246059.1| Escherichia coli strain DAEC19 tryptophan synthas... 42 1.8
91gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 42 1.8
92gb|AC116977.2| Dictyostelium discoideum chromosome 2 map 5515173... 42 1.8
93gb|AY132993.1| Escherichia coli strain ECOR47 tryptophan synthas... 42 1.8
94emb|BX321874.2| Human DNA sequence from clone RP11-496M10 on chr... 42 1.8
95emb|AL592144.5| Human DNA sequence from clone RP11-476B1 on chro... 42 1.8
96emb|AL590644.14| Human DNA sequence from clone RP11-380J14 on ch... 42 1.8
97emb|CR626927.1| Bacteroides fragilis NCTC 9343, complete genome 42 1.8
98emb|AJ549502.2|HSA549502 Homo sapiens peptidylarginine deiminase... 42 1.8
99dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome 42 1.8
100dbj|AP006841.1| Bacteroides fragilis YCH46 DNA, complete genome 42 1.8
101dbj|AP001754.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 42 1.8
102emb|BX072569.6| Zebrafish DNA sequence from clone CH211-184B9 in... 42 1.8
103gb|M15826.1|PSETRPAB P.aeruginosa trpA and trpB genes, encoding ... 42 1.8
104dbj|AP001065.1| Homo sapiens genomic DNA, chromosome 21, clone:K... 42 1.8
105gb|AC129545.5| Mus musculus chromosome 1, clone RP23-264E23, com... 40 6.9
106gb|AC147027.4| Pan troglodytes BAC clone RP43-92F2 from 7, compl... 40 6.9
107gb|AF275271.2| Schizosaccharomyces octosporus mitochondrion, com... 40 6.9
108gb|AC161021.4| Pan troglodytes BAC clone CH251-2N24 from chromos... 40 6.9
109gb|AC165344.3| Mus musculus BAC clone RP23-390P7 from chromosome... 40 6.9
110gb|AC167141.2| Mus musculus BAC clone RP23-313L4 from chromosome... 40 6.9
111gb|AC138093.7| Mus musculus chromosome 16, clone RP24-559J21, co... 40 6.9
112gb|AC116106.18| Mus musculus chromosome 16, clone RP23-23D5, com... 40 6.9
113gb|AC122901.4| Mus musculus BAC clone RP23-40D21 from chromosome... 40 6.9
114gb|AC141329.4| Mus musculus BAC clone RP23-63G7 from chromosome ... 40 6.9
115gb|AF450245.1| Mus musculus clone BAC199M11, complete sequence 40 6.9
116gb|AC129602.3| Mus musculus BAC clone RP23-37L24 from 16, comple... 40 6.9
117ref|XM_949018.1| Theileria annulata strain Ankara hypothetical p... 40 6.9
118gb|AC002564.1| Homo sapiens BAC clone CTB-164L14 from 7, complet... 40 6.9
119gb|AE014822.1| Plasmodium falciparum 3D7 chromosome 14 section 7... 40 6.9
120emb|AL109657.8|HSDJ842G6 Human DNA sequence from clone RP5-842G6... 40 6.9
121gb|AC161606.5| Mus musculus BAC clone RP23-232M18 from chromosom... 40 6.9
122emb|AL161566.2|ATCHRIV66 Arabidopsis thaliana DNA chromosome 4, ... 40 6.9
123emb|AL035680.1|ATT24A18 Arabidopsis thaliana DNA chromosome 4, B... 40 6.9
124emb|CR382384.18| Zebrafish DNA sequence from clone CH211-15B7 in... 40 6.9
125emb|BX950179.6| Zebrafish DNA sequence from clone DKEY-27P23 in ... 40 6.9
126gb|AC183768.2| Pan troglodytes BAC clone CH251-337F15 from chrom... 40 6.9
127gb|AC117395.5| Homo sapiens 3 BAC RP11-651P23 (Roswell Park Canc... 40 6.9
128gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome 40 6.9
129gb|AC109482.3| Homo sapiens chromosome 5 clone RP11-492A10, comp... 40 6.9
130dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete g... 40 6.9
131gb|BC056428.1| Mus musculus vezatin, adherens junctions transmem... 40 6.9
132ref|NM_172538.2| Mus musculus vezatin, adherens junctions transm... 40 6.9
133emb|BX530089.9| Zebrafish DNA sequence from clone CH211-129M12 i... 40 6.9
134gb|AY562383.1| Leptorhynchoides thecatus mitochondrion, complete... 40 6.9
135dbj|AK036017.1| Mus musculus 16 days neonate cerebellum cDNA, RI... 40 6.9
136dbj|AK031848.1| Mus musculus adult male medulla oblongata cDNA, ... 40 6.9
137emb|BX255919.15| Zebrafish DNA sequence from clone DKEY-259P11 i... 40 6.9
138dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
139dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
140gb|AC084882.2|AC084882 Homo sapiens chromosome 15 clone RP11-408... 40 6.9
141gb|AC078846.2|AC078846 Homo sapiens chromosome 7 clone RP11-448A... 40 6.9
142gb|AC025761.5|AC025761 Homo sapiens chromosome 5 clone CTB-109C2... 40 6.9
143gb|AC005104.1| Homo sapiens BAC clone CTA-442F18 from 2, complet... 40 6.9
144dbj|AP006435.1| Sus scrofa CC chemokine receptor genes (CCR3, C... 40 6.9
145dbj|AP006185.1| Sus scrofa CC chemokine receptor genes (CCR2, CC... 40 6.9
146gb|AC066615.7|AC066615 Homo sapiens chromosome 15 clone RP11-90J... 40 6.9
147gb|AC084321.37| Mus musculus strain C57BL/6J chromosome 7 clone ... 40 6.9
148gb|BC020913.1| Homo sapiens, clone IMAGE:4733200, mRNA 40 6.9
149gb|AC009477.4| Homo sapiens BAC clone RP11-209H16 from 2, comple... 40 6.9
150gb|AF435978.1| Clostridium cellulovorans hypothetical protein ge... 40 6.9
151dbj|AP003629.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
152emb|BX510933.4| Zebrafish DNA sequence from clone CH211-271G16 i... 40 6.9
153dbj|AP005071.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
154dbj|BS000174.1| Pan troglodytes chromosome 22 clone:PTB-137B16, ... 40 6.9
155emb|BX469897.6| Zebrafish DNA sequence from clone CH211-39F22 in... 40 6.9
156dbj|AB102786.1| Cycloclasticus sp. A5 orf1, phnA1b, phnA1, phnA2... 40 6.9
157emb|AJ328899.1|HSA328899 Homo sapiens genomic sequence surroundi... 40 6.9
158gb|AC156636.2| Mus musculus BAC clone RP24-401F19 from chromosom... 40 6.9
159dbj|AP001705.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 6.9
160gb|U77666.1|BRU77666 Brassica rapa pollen coat protein homolog (... 40 6.9
161emb|CT030234.9| M.truncatula DNA sequence from clone MTH2-22I15 ... 40 6.9
162gb|AE015451.1| Pseudomonas putida KT2440 complete genome 40 6.9
163dbj|AP000239.2| Homo sapiens genomic DNA, chromosome 21q, clone:... 40 6.9
164gb|AF042321.1|AF042321 Camptotheca acuminata tryptophan synthase... 40 6.9
165gb|AC116952.4| Mus musculus BAC clone RP23-104A7 from 14, comple... 40 6.9
166emb|AL928821.6| Zebrafish DNA sequence from clone CH211-127N10, ... 40 6.9
167emb|X96607.1|MMIGHALP M.musculus IgH 3' alpha enhancer DNA 40 6.9
168gb|AY753561.1| Mus musculus vezatin isoform 2.4 mRNA, complete c... 40 6.9
169gb|M81620.1|ATHTRPSB A.thaliana tryptophan synthase beta-subunit... 40 6.9
170gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome 40 6.9
171dbj|AP000199.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2... 40 6.9
172dbj|AP000095.1| Homo sapiens genomic DNA of 21q22.1, GART and AM... 40 6.9

>gb|BT009279.1| Triticum aestivum clone wlk8.pk0021.b11:fis, full insert mRNA
           sequence
          Length = 619

 Score =  617 bits (311), Expect = e-173
 Identities = 335/343 (97%)
 Strand = Plus / Minus

                                                                       
Query: 170 cggagctctagacatcaaggtacttgctggctgtgtggacatccttgtctcctcttccac 229
           ||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 cggagttctagacttcaaggtacttgctggctgtgtggacatccttgtctcctcttccac 322

                                                                       
Query: 230 tgcagttcagaaccaccctcacaccatccggcagtgttgggcagagcttctccaggtaag 289
           ||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 321 tgcagttgagaaccaccctcacaccatccggtagtgttgggcagagcttctccaggtaag 262

                                                                       
Query: 290 ccagggcgtgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttga 349
           |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 261 ccagcgcgtgggatgtctccagggcagggatgatgccctccagccgagaggtgcgcttga 202

                                                                       
Query: 350 aagcatccaatgcctcctggtctgtcacactatcatattcagcacgtccaatatccctca 409
           |||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 aagcgtccaatgcctcctgatctgtcacactatcatattcagcacgtccaatatccctca 142

                                                                       
Query: 410 agaaactatgctcaggtccaacacctgggtaatccaacccagcactgatggagtggggct 469
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 141 agaaactatgctcaggtccaacacctgggtaatccaacccagcactgatggagtggggct 82

                                                      
Query: 470 caatcacttgtccatcagcatcctgcaatacataactcagaga 512
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 81  caatcacttgtccatcagcatcctgcaatacataactcagaga 39



 Score =  145 bits (73), Expect = 2e-31
 Identities = 115/124 (92%), Gaps = 5/124 (4%)
 Strand = Plus / Minus

                                                                       
Query: 4   ggcacacaacgagcctttatttataccaagtttaacatacaacatatttttatt-acata 62
           |||||| ||||||||||||||||  ||||||||| ||||||||||||||||||| | |||
Sbjct: 594 ggcacaaaacgagcctttattta--ccaagtttagcatacaacatatttttatttagata 537

                                                                       
Query: 63  taaattcaaaaaaccaaactaaattagcttatagaccaaccgacttccaggattatttgt 122
            |||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 536 -aaattcaacaaaccaaactaaattagct-atagaccaaccgacttccaggattatttgt 479

               
Query: 123 accc 126
           ||||
Sbjct: 478 accc 475



to top

>dbj|AK060205.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-002-A05, full
           insert sequence
          Length = 1183

 Score =  408 bits (206), Expect = e-111
 Identities = 299/330 (90%)
 Strand = Plus / Minus

                                                                       
Query: 179 agacatcaaggtacttgctggctgtgtggacatccttgtctcctcttccactgcagttca 238
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 952 agacatcaaggtacttgctggctgtgtggacatccttgtctcctcttccactgcagttca 893

                                                                       
Query: 239 gaaccaccctcacaccatccggcagtgttgggcagagcttctccaggtaagccagggcgt 298
             ||||||||||| || || ||||| ||||||||||||||||||||||| || || || |
Sbjct: 892 ccaccaccctcacgccgtcgggcagcgttgggcagagcttctccaggtaggcgagcgcat 833

                                                                       
Query: 299 gggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagcatcca 358
           |||| |||||||| |||||||||||||| ||||||||||||  |||||||||||||||||
Sbjct: 832 gggacgtctccagagcagggatgatgccctccagccgagagacgcgcttgaaagcatcca 773

                                                                       
Query: 359 atgcctcctggtctgtcacactatcatattcagcacgtccaatatccctcaagaaactat 418
            ||||||||| ||||||||||| |||||||||||||||||||||||| |||| || ||||
Sbjct: 772 gtgcctcctgatctgtcacactgtcatattcagcacgtccaatatccttcaaaaagctat 713

                                                                       
Query: 419 gctcaggtccaacacctgggtaatccaacccagcactgatggagtggggctcaatcactt 478
           ||||||| |||||||| ||||| |||| ||||||||| ||||||||||| ||||| ||||
Sbjct: 712 gctcaggcccaacaccagggtagtccagcccagcactaatggagtggggttcaataactt 653

                                         
Query: 479 gtccatcagcatcctgcaatacataactca 508
           |||||||| |||||||||| ||||| ||||
Sbjct: 652 gtccatcatcatcctgcaacacatagctca 623



to top

>dbj|AK072535.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023133G14, full
            insert sequence
          Length = 1700

 Score =  402 bits (203), Expect = e-109
 Identities = 299/331 (90%)
 Strand = Plus / Minus

                                                                        
Query: 178  tagacatcaaggtacttgctggctgtgtggacatccttgtctcctcttccactgcagttc 237
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1470 tagacatcaaggtacttgctggctgtgtggacatccttgtctcctcttccactgcagttc 1411

                                                                        
Query: 238  agaaccaccctcacaccatccggcagtgttgggcagagcttctccaggtaagccagggcg 297
            |  ||||||||||| || || ||||| ||||||||||||||||||||||| || || || 
Sbjct: 1410 accaccaccctcacgccgtcgggcagcgttgggcagagcttctccaggtaggcgagcgca 1351

                                                                        
Query: 298  tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagcatcc 357
            ||||| |||||||| |||||||||||||| ||||||||||||  ||||||||||||||||
Sbjct: 1350 tgggacgtctccagagcagggatgatgccctccagccgagagacgcgcttgaaagcatcc 1291

                                                                        
Query: 358  aatgcctcctggtctgtcacactatcatattcagcacgtccaatatccctcaagaaacta 417
            | ||||||||| |||||||| || |||||||||||||||||||||||| |||| || |||
Sbjct: 1290 agtgcctcctgatctgtcacgctgtcatattcagcacgtccaatatccttcaaaaagcta 1231

                                                                        
Query: 418  tgctcaggtccaacacctgggtaatccaacccagcactgatggagtggggctcaatcact 477
            |||||||| |||||||| ||||| |||| ||||||||| ||||||||||| ||||| |||
Sbjct: 1230 tgctcaggcccaacaccagggtagtccagcccagcactaatggagtggggttcaataact 1171

                                           
Query: 478  tgtccatcagcatcctgcaatacataactca 508
            ||||||||| |||||||||| ||||| ||||
Sbjct: 1170 tgtccatcatcatcctgcaacacatagctca 1140



to top

>ref|XM_479974.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1700

 Score =  400 bits (202), Expect = e-108
 Identities = 298/330 (90%)
 Strand = Plus / Minus

                                                                        
Query: 179  agacatcaaggtacttgctggctgtgtggacatccttgtctcctcttccactgcagttca 238
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1469 agacatcaaggtacttgctggctgtgtggacatccttgtctcctcttccactgcagttca 1410

                                                                        
Query: 239  gaaccaccctcacaccatccggcagtgttgggcagagcttctccaggtaagccagggcgt 298
              ||||||||||| || || ||||| ||||||||||||||||||||||| || || || |
Sbjct: 1409 ccaccaccctcacgccgtcgggcagcgttgggcagagcttctccaggtaggcgagcgcat 1350

                                                                        
Query: 299  gggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagcatcca 358
            |||| |||||||| |||||||||||||| ||||||||||||  |||||||||||||||||
Sbjct: 1349 gggacgtctccagagcagggatgatgccctccagccgagagacgcgcttgaaagcatcca 1290

                                                                        
Query: 359  atgcctcctggtctgtcacactatcatattcagcacgtccaatatccctcaagaaactat 418
             ||||||||| |||||||| || |||||||||||||||||||||||| |||| || ||||
Sbjct: 1289 gtgcctcctgatctgtcacgctgtcatattcagcacgtccaatatccttcaaaaagctat 1230

                                                                        
Query: 419  gctcaggtccaacacctgggtaatccaacccagcactgatggagtggggctcaatcactt 478
            ||||||| |||||||| ||||| |||| ||||||||| ||||||||||| ||||| ||||
Sbjct: 1229 gctcaggcccaacaccagggtagtccagcccagcactaatggagtggggttcaataactt 1170

                                          
Query: 479  gtccatcagcatcctgcaatacataactca 508
            |||||||| |||||||||| ||||| ||||
Sbjct: 1169 gtccatcatcatcctgcaacacatagctca 1140



to top

>dbj|AK069187.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023009G22, full
           insert sequence
          Length = 1027

 Score =  400 bits (202), Expect = e-108
 Identities = 298/330 (90%)
 Strand = Plus / Minus

                                                                       
Query: 179 agacatcaaggtacttgctggctgtgtggacatccttgtctcctcttccactgcagttca 238
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 666 agacatcaaggtacttgctggctgtgtggacatccttgtctcctcttccactgcagttca 607

                                                                       
Query: 239 gaaccaccctcacaccatccggcagtgttgggcagagcttctccaggtaagccagggcgt 298
             ||||||||||| || || ||||| ||||||||||||||||||||||| || || || |
Sbjct: 606 ccaccaccctcacgccgtcgggcagcgttgggcagagcttctccaggtaggcgagcgcat 547

                                                                       
Query: 299 gggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagcatcca 358
           |||| |||||||| |||||||||||||| ||||||||||||  |||||||||||||||||
Sbjct: 546 gggacgtctccagagcagggatgatgccctccagccgagagacgcgcttgaaagcatcca 487

                                                                       
Query: 359 atgcctcctggtctgtcacactatcatattcagcacgtccaatatccctcaagaaactat 418
            ||||||||| |||||||| || |||||||||||||||||||||||| |||| || ||||
Sbjct: 486 gtgcctcctgatctgtcacgctgtcatattcagcacgtccaatatccttcaaaaagctat 427

                                                                       
Query: 419 gctcaggtccaacacctgggtaatccaacccagcactgatggagtggggctcaatcactt 478
           ||||||| |||||||| ||||| |||| ||||||||| ||||||||||| ||||| ||||
Sbjct: 426 gctcaggcccaacaccagggtagtccagcccagcactaatggagtggggttcaataactt 367

                                         
Query: 479 gtccatcagcatcctgcaatacataactca 508
           |||||||| |||||||||| ||||| ||||
Sbjct: 366 gtccatcatcatcctgcaacacatagctca 337



to top

>gb|BT016988.1| Zea mays clone EK07D2304D07.c mRNA sequence
          Length = 989

 Score =  315 bits (159), Expect = 8e-83
 Identities = 279/319 (87%)
 Strand = Plus / Plus

                                                                       
Query: 178 tagacatcaaggtacttgctggctgtgtggacatccttgtctcctcttccactgcagttc 237
           ||||| || |||||||||||||| ||||| || |||||||||||||  || |||||||||
Sbjct: 234 tagacgtccaggtacttgctggcggtgtgcacgtccttgtctcctcgcccgctgcagttc 293

                                                                       
Query: 238 agaaccaccctcacaccatccggcagtgttgggcagagcttctccaggtaagccagggcg 297
           |  ||||||||||| || |||| |||||| |||||||||||||| ||||| ||||| |||
Sbjct: 294 accaccaccctcacgccgtccgccagtgtcgggcagagcttctcaaggtaggccagcgcg 353

                                                                       
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagcatcc 357
           ||||| ||||||||||||||||||||||| |||| ||||||   ||||||||||||||||
Sbjct: 354 tgggaggtctccagggcagggatgatgccctccaaccgagacacgcgcttgaaagcatcc 413

                                                                       
Query: 358 aatgcctcctggtctgtcacactatcatattcagcacgtccaatatccctcaagaaacta 417
           | |||||||||||| ||||||||||| ||||| ||||||||||| ||| |||||||||| 
Sbjct: 414 agtgcctcctggtcagtcacactatcgtattcggcacgtccaatgtccttcaagaaactg 473

                                                                       
Query: 418 tgctcaggtccaacacctgggtaatccaacccagcactgatggagtggggctcaatcact 477
           ||||| |||||||| || |||||||| | ||||||||||||||||||||| || || |||
Sbjct: 474 tgctcgggtccaacgccagggtaatcgagcccagcactgatggagtggggttcgataact 533

                              
Query: 478 tgtccatcagcatcctgca 496
           ||||| ||| |||||||||
Sbjct: 534 tgtccgtcatcatcctgca 552



to top

>gb|M76685.1|MZEORP2A Zea mays tryptophan synthase beta-subunit (TSB2) mRNA, complete cds
          Length = 1540

 Score =  315 bits (159), Expect = 8e-83
 Identities = 279/319 (87%)
 Strand = Plus / Minus

                                                                        
Query: 178  tagacatcaaggtacttgctggctgtgtggacatccttgtctcctcttccactgcagttc 237
            ||||| || |||||||||||||| ||||| || |||||||||||||  || |||||||||
Sbjct: 1333 tagacgtccaggtacttgctggcggtgtgcacgtccttgtctcctcgcccgctgcagttc 1274

                                                                        
Query: 238  agaaccaccctcacaccatccggcagtgttgggcagagcttctccaggtaagccagggcg 297
            |  ||||||||||| || |||| |||||| |||||||||||||| ||||| ||||| |||
Sbjct: 1273 accaccaccctcacgccgtccgccagtgtcgggcagagcttctcaaggtaggccagcgcg 1214

                                                                        
Query: 298  tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagcatcc 357
            ||||| ||||||||||||||||||||||| |||| ||||||   ||||||||||||||||
Sbjct: 1213 tgggaggtctccagggcagggatgatgccctccaaccgagacacgcgcttgaaagcatcc 1154

                                                                        
Query: 358  aatgcctcctggtctgtcacactatcatattcagcacgtccaatatccctcaagaaacta 417
            | |||||||||||| ||||||||||| ||||| ||||||||||| ||| |||||||||| 
Sbjct: 1153 agtgcctcctggtcagtcacactatcgtattcggcacgtccaatgtccttcaagaaactg 1094

                                                                        
Query: 418  tgctcaggtccaacacctgggtaatccaacccagcactgatggagtggggctcaatcact 477
            ||||| |||||||| || |||||||| | ||||||||||||||||||||| || || |||
Sbjct: 1093 tgctcgggtccaacgccagggtaatcgagcccagcactgatggagtggggttcgataact 1034

                               
Query: 478  tgtccatcagcatcctgca 496
            ||||| ||| |||||||||
Sbjct: 1033 tgtccgtcatcatcctgca 1015



to top

>gb|AY104030.1| Zea mays PCO122526 mRNA sequence
          Length = 1434

 Score =  289 bits (146), Expect = 4e-75
 Identities = 269/310 (86%)
 Strand = Plus / Minus

                                                                        
Query: 176  tctagacatcaaggtacttgctggctgtgtggacatccttgtctcctcttccactgcagt 235
            ||||||| || |||||||||||||| ||||| || |||||||| ||||  ||||||||||
Sbjct: 1219 tctagacgtccaggtacttgctggcggtgtgcacgtccttgtcgcctcgcccactgcagt 1160

                                                                        
Query: 236  tcagaaccaccctcacaccatccggcagtgttgggcagagcttctccaggtaagccaggg 295
            |||| ||||||||||| || |||||||| || ||||| |||||||||||||| || || |
Sbjct: 1159 tcagcaccaccctcacgccgtccggcagggtcgggcacagcttctccaggtaggcgagcg 1100

                                                                        
Query: 296  cgtgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagcat 355
            ||||||| ||||||||||| ||||||||||| ||||| || |||  ||||||||||||||
Sbjct: 1099 cgtgggaggtctccagggccgggatgatgccctccagacgggagacgcgcttgaaagcat 1040

                                                                        
Query: 356  ccaatgcctcctggtctgtcacactatcatattcagcacgtccaatatccctcaagaaac 415
            ||| ||||||||| || ||||| || ||||||||||| ||||| || ||| |||||||||
Sbjct: 1039 ccagtgcctcctgatcagtcacgctgtcatattcagcgcgtccgatgtccttcaagaaac 980

                                                                        
Query: 416  tatgctcaggtccaacacctgggtaatccaacccagcactgatggagtggggctcaatca 475
            | |||||||||||||| || ||||||||||  ||||||||||||||||||||||| || |
Sbjct: 979  tgtgctcaggtccaacgccagggtaatccagtccagcactgatggagtggggctcgataa 920

                      
Query: 476  cttgtccatc 485
            |||| |||||
Sbjct: 919  cttgcccatc 910



to top

>gb|M76684.1|MZEORP1A Zea mays tryptophan synthase beta-subunit (TSB1) mRNA, complete cds
          Length = 1382

 Score =  289 bits (146), Expect = 4e-75
 Identities = 269/310 (86%)
 Strand = Plus / Minus

                                                                        
Query: 176  tctagacatcaaggtacttgctggctgtgtggacatccttgtctcctcttccactgcagt 235
            ||||||| || ||||||||||| || ||||| || |||||||| ||||  ||||||||||
Sbjct: 1171 tctagacgtccaggtacttgctagcggtgtgcacgtccttgtcgcctcgcccactgcagt 1112

                                                                        
Query: 236  tcagaaccaccctcacaccatccggcagtgttgggcagagcttctccaggtaagccaggg 295
            |||| ||||||||||| || |||||||| || ||||| |||||||||||||| || || |
Sbjct: 1111 tcagcaccaccctcacgccgtccggcagggtcgggcacagcttctccaggtaggcgagcg 1052

                                                                        
Query: 296  cgtgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagcat 355
            ||||||| ||||||||||| ||||||||||| ||||| || |||  ||||||||||||||
Sbjct: 1051 cgtgggaggtctccagggccgggatgatgccctccagacgggagacgcgcttgaaagcat 992

                                                                        
Query: 356  ccaatgcctcctggtctgtcacactatcatattcagcacgtccaatatccctcaagaaac 415
            ||| ||||||||| || ||||| || ||||||||||| ||||| || ||| |||||||||
Sbjct: 991  ccagtgcctcctgatcagtcacgctgtcatattcagcgcgtccgatgtccttcaagaaac 932

                                                                        
Query: 416  tatgctcaggtccaacacctgggtaatccaacccagcactgatggagtggggctcaatca 475
            |||||||||||||||| || ||||||||||  ||||||||||||||||||||||| || |
Sbjct: 931  tatgctcaggtccaacgccagggtaatccagtccagcactgatggagtggggctcgataa 872

                      
Query: 476  cttgtccatc 485
            |||| |||||
Sbjct: 871  cttgcccatc 862



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score =  228 bits (115), Expect = 1e-56
 Identities = 160/175 (91%)
 Strand = Plus / Minus

                                                                           
Query: 179     agacatcaaggtacttgctggctgtgtggacatccttgtctcctcttccactgcagttca 238
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2026475 agacatcaaggtacttgctggctgtgtggacatccttgtctcctcttccactgcagttca 2026416

                                                                           
Query: 239     gaaccaccctcacaccatccggcagtgttgggcagagcttctccaggtaagccagggcgt 298
                 ||||||||||| || || ||||| ||||||||||||||||||||||| || || || |
Sbjct: 2026415 ccaccaccctcacgccgtcgggcagcgttgggcagagcttctccaggtaggcgagcgcat 2026356

                                                                      
Query: 299     gggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
               |||| |||||||| |||||||||||||| ||||||||||||  ||||||||||||
Sbjct: 2026355 gggacgtctccagagcagggatgatgccctccagccgagagacgcgcttgaaagc 2026301



 Score =  105 bits (53), Expect = 1e-19
 Identities = 83/93 (89%)
 Strand = Plus / Minus

                                                                           
Query: 353     catccaatgcctcctggtctgtcacactatcatattcagcacgtccaatatccctcaaga 412
               |||||| ||||||||| |||||||| || |||||||||||||||||||||||| |||| |
Sbjct: 2025569 catccagtgcctcctgatctgtcacgctgtcatattcagcacgtccaatatccttcaaaa 2025510

                                                
Query: 413     aactatgctcaggtccaacacctgggtaatcca 445
               | ||||||||||| |||||||| ||||| ||||
Sbjct: 2025509 agctatgctcaggcccaacaccagggtagtcca 2025477



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                           
Query: 446     acccagcactgatggagtggggctcaatcacttgtccatcagcatcctgcaatacataac 505
               |||||||||| ||||||||||| ||||| |||||||||||| |||||||||| ||||| |
Sbjct: 2025395 acccagcactaatggagtggggttcaataacttgtccatcatcatcctgcaacacatagc 2025336

                  
Query: 506     tca 508
               |||
Sbjct: 2025335 tca 2025333



to top

>dbj|AP003896.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1613_G04
          Length = 135357

 Score =  228 bits (115), Expect = 1e-56
 Identities = 160/175 (91%)
 Strand = Plus / Minus

                                                                         
Query: 179   agacatcaaggtacttgctggctgtgtggacatccttgtctcctcttccactgcagttca 238
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20005 agacatcaaggtacttgctggctgtgtggacatccttgtctcctcttccactgcagttca 19946

                                                                         
Query: 239   gaaccaccctcacaccatccggcagtgttgggcagagcttctccaggtaagccagggcgt 298
               ||||||||||| || || ||||| ||||||||||||||||||||||| || || || |
Sbjct: 19945 ccaccaccctcacgccgtcgggcagcgttgggcagagcttctccaggtaggcgagcgcat 19886

                                                                    
Query: 299   gggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
             |||| |||||||| |||||||||||||| ||||||||||||  ||||||||||||
Sbjct: 19885 gggacgtctccagagcagggatgatgccctccagccgagagacgcgcttgaaagc 19831



 Score =  105 bits (53), Expect = 1e-19
 Identities = 83/93 (89%)
 Strand = Plus / Minus

                                                                         
Query: 353   catccaatgcctcctggtctgtcacactatcatattcagcacgtccaatatccctcaaga 412
             |||||| ||||||||| |||||||| || |||||||||||||||||||||||| |||| |
Sbjct: 19099 catccagtgcctcctgatctgtcacgctgtcatattcagcacgtccaatatccttcaaaa 19040

                                              
Query: 413   aactatgctcaggtccaacacctgggtaatcca 445
             | ||||||||||| |||||||| ||||| ||||
Sbjct: 19039 agctatgctcaggcccaacaccagggtagtcca 19007



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                         
Query: 446   acccagcactgatggagtggggctcaatcacttgtccatcagcatcctgcaatacataac 505
             |||||||||| ||||||||||| ||||| |||||||||||| |||||||||| ||||| |
Sbjct: 18925 acccagcactaatggagtggggttcaataacttgtccatcatcatcctgcaacacatagc 18866

                
Query: 506   tca 508
             |||
Sbjct: 18865 tca 18863



to top

>dbj|AP005620.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0680F05
          Length = 185495

 Score =  228 bits (115), Expect = 1e-56
 Identities = 160/175 (91%)
 Strand = Plus / Minus

                                                                          
Query: 179    agacatcaaggtacttgctggctgtgtggacatccttgtctcctcttccactgcagttca 238
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 151673 agacatcaaggtacttgctggctgtgtggacatccttgtctcctcttccactgcagttca 151614

                                                                          
Query: 239    gaaccaccctcacaccatccggcagtgttgggcagagcttctccaggtaagccagggcgt 298
                ||||||||||| || || ||||| ||||||||||||||||||||||| || || || |
Sbjct: 151613 ccaccaccctcacgccgtcgggcagcgttgggcagagcttctccaggtaggcgagcgcat 151554

                                                                     
Query: 299    gggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
              |||| |||||||| |||||||||||||| ||||||||||||  ||||||||||||
Sbjct: 151553 gggacgtctccagagcagggatgatgccctccagccgagagacgcgcttgaaagc 151499



 Score =  105 bits (53), Expect = 1e-19
 Identities = 83/93 (89%)
 Strand = Plus / Minus

                                                                          
Query: 353    catccaatgcctcctggtctgtcacactatcatattcagcacgtccaatatccctcaaga 412
              |||||| ||||||||| |||||||| || |||||||||||||||||||||||| |||| |
Sbjct: 150767 catccagtgcctcctgatctgtcacgctgtcatattcagcacgtccaatatccttcaaaa 150708

                                               
Query: 413    aactatgctcaggtccaacacctgggtaatcca 445
              | ||||||||||| |||||||| ||||| ||||
Sbjct: 150707 agctatgctcaggcccaacaccagggtagtcca 150675



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                          
Query: 446    acccagcactgatggagtggggctcaatcacttgtccatcagcatcctgcaatacataac 505
              |||||||||| ||||||||||| ||||| |||||||||||| |||||||||| ||||| |
Sbjct: 150593 acccagcactaatggagtggggttcaataacttgtccatcatcatcctgcaacacatagc 150534

                 
Query: 506    tca 508
              |||
Sbjct: 150533 tca 150531



to top

>gb|AY555143.1| Zea may BAC clone c573L14, complete sequence
          Length = 144792

 Score =  167 bits (84), Expect = 4e-38
 Identities = 153/176 (86%)
 Strand = Plus / Plus

                                                                         
Query: 178   tagacatcaaggtacttgctggctgtgtggacatccttgtctcctcttccactgcagttc 237
             ||||| || |||||||||||||| ||||| || |||||||||||||  || |||||||||
Sbjct: 72762 tagacgtccaggtacttgctggcggtgtgcacgtccttgtctcctcgcccgctgcagttc 72821

                                                                         
Query: 238   agaaccaccctcacaccatccggcagtgttgggcagagcttctccaggtaagccagggcg 297
             |  ||||||||||| || |||| |||||| |||||||||||||| ||||| ||||| |||
Sbjct: 72822 accaccaccctcacgccgtccgccagtgtcgggcagagcttctcaaggtaggccagcgcg 72881

                                                                     
Query: 298   tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
             ||||| ||||||||||||||||||||||| |||| ||||||   ||||||||||||
Sbjct: 72882 tgggaggtctccagggcagggatgatgccctccaaccgagacacgcgcttgaaagc 72937



 Score =  101 bits (51), Expect = 2e-18
 Identities = 81/91 (89%)
 Strand = Plus / Plus

                                                                         
Query: 353   catccaatgcctcctggtctgtcacactatcatattcagcacgtccaatatccctcaaga 412
             |||||| |||||||||||| ||||||||||| ||||| ||||||||||| ||| ||||||
Sbjct: 73441 catccagtgcctcctggtcagtcacactatcgtattcggcacgtccaatgtccttcaaga 73500

                                            
Query: 413   aactatgctcaggtccaacacctgggtaatc 443
             |||| ||||| |||||||| || ||||||||
Sbjct: 73501 aactgtgctcgggtccaacgccagggtaatc 73531



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                                
Query: 446   acccagcactgatggagtggggctcaatcacttgtccatcagcatcctgca 496
             |||||||||||||||||||||| || || |||||||| ||| |||||||||
Sbjct: 73625 acccagcactgatggagtggggttcgataacttgtccgtcatcatcctgca 73675



to top

>gb|AY555142.1| Zea mays BAC clone c573F08, complete sequence
          Length = 181627

 Score =  163 bits (82), Expect = 7e-37
 Identities = 154/178 (86%)
 Strand = Plus / Plus

                                                                         
Query: 176   tctagacatcaaggtacttgctggctgtgtggacatccttgtctcctcttccactgcagt 235
             ||||||| || |||||||||||||| ||||| || |||||||| ||||  ||||||||||
Sbjct: 78208 tctagacgtccaggtacttgctggcggtgtgcacgtccttgtcgcctcgcccactgcagt 78267

                                                                         
Query: 236   tcagaaccaccctcacaccatccggcagtgttgggcagagcttctccaggtaagccaggg 295
             |||| ||||||||||| || |||||||| || ||||| |||||||||||||| || || |
Sbjct: 78268 tcagcaccaccctcacgccgtccggcagggtcgggcacagcttctccaggtaggcgagcg 78327

                                                                       
Query: 296   cgtgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
             ||||||| ||||||||||| ||||||||||| ||||| || |||  ||||||||||||
Sbjct: 78328 cgtgggaggtctccagggccgggatgatgccctccagacgggagacgcgcttgaaagc 78385



 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 81/93 (87%)
 Strand = Plus / Plus

                                                                         
Query: 353   catccaatgcctcctggtctgtcacactatcatattcagcacgtccaatatccctcaaga 412
             |||||| ||||||||| || ||||| || ||||||||||| ||||| || ||| ||||||
Sbjct: 79090 catccagtgcctcctgatcagtcacgctgtcatattcagcgcgtccgatgtccttcaaga 79149

                                              
Query: 413   aactatgctcaggtccaacacctgggtaatcca 445
             |||| |||||||||||||| || ||||||||||
Sbjct: 79150 aactgtgctcaggtccaacgccagggtaatcca 79182



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                     
Query: 446   acccagcactgatggagtggggctcaatcacttgtccatc 485
             ||||||||||||||||||||||||| || ||||| |||||
Sbjct: 79256 acccagcactgatggagtggggctcgataacttgcccatc 79295



to top

>gb|AF466200.2| Sorghum bicolor putative protein kinase gene, partial cds; putative
             Cf-2, fertilization-independent endosperm proteins,
             hypothetical protein, putative non-LTR retroelement
             reverse transcriptase, OCL5 protein, tryptophan synthase
             beta-subunit, hypothetical proteins, putative AP
             endonuclease, putative RNA polymerase II complex component
             SRB7, putative beta-1,3-glucanase, hypothetical protein,
             TNP2-like protein, hypothetical protein, putative
             phosphate/phosphoenolpyruvate translocator, putative
             protein, hypothetical proteins, putative
             galactosyltransferase family, hypothetical protein,
             putative cytochrome P450 family, putative lipid transfer
             protein, putative photoreceptor-interacting protein, and
             hypothetical protein genes, complete cds; and hypothetical
             protein gene, partial cds
          Length = 202197

 Score =  151 bits (76), Expect = 3e-33
 Identities = 151/176 (85%)
 Strand = Plus / Plus

                                                                         
Query: 178   tagacatcaaggtacttgctggctgtgtggacatccttgtctcctcttccactgcagttc 237
             ||||| || |||||||||||||| ||||| || ||||||||||||| |||||||||||||
Sbjct: 67562 tagacgtccaggtacttgctggcggtgtgcacgtccttgtctcctcgtccactgcagttc 67621

                                                                         
Query: 238   agaaccaccctcacaccatccggcagtgttgggcagagcttctccaggtaagccagggcg 297
             |  ||||| ||||| || || ||||| || |||||||||||||| ||||| || || || 
Sbjct: 67622 accaccactctcacgccgtctggcagggtcgggcagagcttctcgaggtaggcgagcgca 67681

                                                                     
Query: 298   tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
             ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 67682 tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 67737



 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 81/93 (87%)
 Strand = Plus / Plus

                                                                         
Query: 353   catccaatgcctcctggtctgtcacactatcatattcagcacgtccaatatccctcaaga 412
             |||||| ||||||||| || ||||| || || ||||||||||||||||| ||| ||||||
Sbjct: 68445 catccagtgcctcctgatcagtcacgctgtcgtattcagcacgtccaatgtccttcaaga 68504

                                              
Query: 413   aactatgctcaggtccaacacctgggtaatcca 445
             |||| ||||| ||||||||||| ||||| ||||
Sbjct: 68505 aactgtgctcgggtccaacaccagggtagtcca 68537



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                                
Query: 446   acccagcactgatggagtggggctcaatcacttgtccatcagcatcctgca 496
             |||||||||||||||||||||| ||||| |||||||||||| | |||||||
Sbjct: 68620 acccagcactgatggagtggggttcaataacttgtccatcatcgtcctgca 68670



to top

>dbj|AB003491.1| Oryza sativa mRNA for tryptophan synthase B, complete cds
          Length = 1413

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                        
Query: 377  cactatcatattcagcacgtccaatatccctcaagaaactatgctcaggtccaacacctg 436
            ||||||| |||||||| ||||| || ||  | | |||||| ||||| ||||| || || |
Sbjct: 1213 cactatcgtattcagcccgtcccatgtctttaacgaaactgtgctcgggtccgactccgg 1154

                                                                        
Query: 437  ggtaatccaacccagcactgatggagtggggctcaatcacttgtccatcagcatcctgca 496
            |||| |||||||||||||| |||||||| || ||||| |||||||||||| |||| ||||
Sbjct: 1153 ggtagtccaacccagcactaatggagtgtggttcaatgacttgtccatcatcatcttgca 1094

             
Query: 497  a 497
            |
Sbjct: 1093 a 1093



to top

>ref|NM_118841.2| Arabidopsis thaliana TSB2 (TRYPTOPHAN SYNTHASE BETA-SUBUNIT);
            tryptophan synthase AT4G27070 (TSB2) mRNA, complete cds
          Length = 1698

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                        
Query: 411  gaaactatgctcaggtccaacacctgggtaatccaacccagcactgatggagtggggctc 470
            |||||||||||||||||| || || ||||| ||||| || |||||||||||||| || ||
Sbjct: 1264 gaaactatgctcaggtccgactccagggtagtccaatccggcactgatggagtgtggttc 1205

                                      
Query: 471  aatcacttgtccatcagcatcctgca 496
            ||| | ||| |||||| |||| ||||
Sbjct: 1204 aatgatttggccatcatcatcttgca 1179



to top

>gb|BT003144.1| Arabidopsis thaliana At4g27070 mRNA, complete cds
          Length = 1428

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                        
Query: 411  gaaactatgctcaggtccaacacctgggtaatccaacccagcactgatggagtggggctc 470
            |||||||||||||||||| || || ||||| ||||| || |||||||||||||| || ||
Sbjct: 1194 gaaactatgctcaggtccgactccagggtagtccaatccggcactgatggagtgtggttc 1135

                                      
Query: 471  aatcacttgtccatcagcatcctgca 496
            ||| | ||| |||||| |||| ||||
Sbjct: 1134 aatgatttggccatcatcatcttgca 1109



to top

>gb|AY084334.1| Arabidopsis thaliana clone 104687 mRNA, complete sequence
          Length = 1677

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                        
Query: 411  gaaactatgctcaggtccaacacctgggtaatccaacccagcactgatggagtggggctc 470
            |||||||||||||||||| || || ||||| ||||| || |||||||||||||| || ||
Sbjct: 1243 gaaactatgctcaggtccgactccagggtagtccaatccggcactgatggagtgtggttc 1184

                                      
Query: 471  aatcacttgtccatcagcatcctgca 496
            ||| | ||| |||||| |||| ||||
Sbjct: 1183 aatgatttggccatcatcatcttgca 1158



to top

>ref|NM_124862.3| Arabidopsis thaliana TSB1 (TRYPTOPHAN SYNTHASE BETA-SUBUNIT)
            AT5G54810 (TSB1) mRNA, complete cds
          Length = 1657

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 74/88 (84%)
 Strand = Plus / Minus

                                                                        
Query: 409  aagaaactatgctcaggtccaacacctgggtaatccaacccagcactgatggagtggggc 468
            |||||||| ||||| ||||| || || ||||| ||||| || |||||||||||||| || 
Sbjct: 1228 aagaaactgtgctcgggtccgactccagggtagtccaatcctgcactgatggagtgtggt 1169

                                        
Query: 469  tcaatcacttgtccatcagcatcctgca 496
            ||||| | |||||||||| |||| ||||
Sbjct: 1168 tcaatgatttgtccatcatcatcttgca 1141



to top

>gb|AY133620.1| Arabidopsis thaliana AT5g54810/MBG8_7 mRNA, complete cds
          Length = 1413

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 74/88 (84%)
 Strand = Plus / Minus

                                                                        
Query: 409  aagaaactatgctcaggtccaacacctgggtaatccaacccagcactgatggagtggggc 468
            |||||||| ||||| ||||| || || ||||| ||||| || |||||||||||||| || 
Sbjct: 1181 aagaaactgtgctcgggtccgactccagggtagtccaatcctgcactgatggagtgtggt 1122

                                        
Query: 469  tcaatcacttgtccatcagcatcctgca 496
            ||||| | |||||||||| |||| ||||
Sbjct: 1121 tcaatgatttgtccatcatcatcttgca 1094



to top

>dbj|AK221396.1| Arabidopsis thaliana mRNA for tryptophan synthase beta chain 1
           precursor, complete cds, clone: RAFL25-45-M24
          Length = 581

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 74/88 (84%)
 Strand = Plus / Minus

                                                                       
Query: 409 aagaaactatgctcaggtccaacacctgggtaatccaacccagcactgatggagtggggc 468
           |||||||| ||||| ||||| || || ||||| ||||| || |||||||||||||| || 
Sbjct: 234 aagaaactgtgctcgggtccgactccagggtagtccaatcctgcactgatggagtgtggt 175

                                       
Query: 469 tcaatcacttgtccatcagcatcctgca 496
           ||||| | |||||||||| |||| ||||
Sbjct: 174 tcaatgatttgtccatcatcatcttgca 147



to top

>gb|AF367264.1|AF367264 Arabidopsis thaliana AT5g54810/MBG8_7 mRNA, complete cds
          Length = 1649

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 74/88 (84%)
 Strand = Plus / Minus

                                                                        
Query: 409  aagaaactatgctcaggtccaacacctgggtaatccaacccagcactgatggagtggggc 468
            |||||||| ||||| ||||| || || ||||| ||||| || |||||||||||||| || 
Sbjct: 1224 aagaaactgtgctcgggtccgactccagggtagtccaatcctgcactgatggagtgtggt 1165

                                        
Query: 469  tcaatcacttgtccatcagcatcctgca 496
            ||||| | |||||||||| |||| ||||
Sbjct: 1164 tcaatgatttgtccatcatcatcttgca 1137



to top

>emb|BX831233.1|CNS0A1P3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS6ZE08 of Adult vegetative tissue of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1638

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 74/88 (84%)
 Strand = Plus / Minus

                                                                        
Query: 409  aagaaactatgctcaggtccaacacctgggtaatccaacccagcactgatggagtggggc 468
            |||||||| ||||| ||||| || || ||||| ||||| || |||||||||||||| || 
Sbjct: 1209 aagaaactgtgctcgggtccgactccagggtagtccaatcctgcactgatggagtgtggt 1150

                                        
Query: 469  tcaatcacttgtccatcagcatcctgca 496
            ||||| | |||||||||| |||| ||||
Sbjct: 1149 tcaatgatttgtccatcatcatcttgca 1122



to top

>emb|BX829760.1|CNS0A1C2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB34ZF04 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1532

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 74/88 (84%)
 Strand = Plus / Minus

                                                                        
Query: 409  aagaaactatgctcaggtccaacacctgggtaatccaacccagcactgatggagtggggc 468
            |||||||| ||||| ||||| || || ||||| ||||| || |||||||||||||| || 
Sbjct: 1211 aagaaactgtgctcgggtccgactccagggtagtccaatcctgcactgatggagtgtggt 1152

                                        
Query: 469  tcaatcacttgtccatcagcatcctgca 496
            ||||| | |||||||||| |||| ||||
Sbjct: 1151 tcaatgatttgtccatcatcatcttgca 1124



to top

>emb|BX829703.1|CNS0A1IO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB2ZH10 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1584

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 74/88 (84%)
 Strand = Plus / Minus

                                                                        
Query: 409  aagaaactatgctcaggtccaacacctgggtaatccaacccagcactgatggagtggggc 468
            |||||||| ||||| ||||| || || ||||| ||||| || |||||||||||||| || 
Sbjct: 1210 aagaaactgtgctcgggtccgactccagggtagtccaatcctgcactgatggagtgtggt 1151

                                        
Query: 469  tcaatcacttgtccatcagcatcctgca 496
            ||||| | |||||||||| |||| ||||
Sbjct: 1150 tcaatgatttgtccatcatcatcttgca 1123



to top

>emb|BX831477.1|CNS0A0OO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS95ZD02 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1544

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 74/88 (84%)
 Strand = Plus / Minus

                                                                        
Query: 409  aagaaactatgctcaggtccaacacctgggtaatccaacccagcactgatggagtggggc 468
            |||||||| ||||| ||||| || || ||||| ||||| || |||||||||||||| || 
Sbjct: 1171 aagaaactgtgctcgggtccgactccagggtagtccaatcctgcactgatggagtgtggt 1112

                                        
Query: 469  tcaatcacttgtccatcagcatcctgca 496
            ||||| | |||||||||| |||| ||||
Sbjct: 1111 tcaatgatttgtccatcatcatcttgca 1084



to top

>emb|BX831093.1|CNS0A0PA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS57ZA09 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1481

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 74/88 (84%)
 Strand = Plus / Minus

                                                                        
Query: 409  aagaaactatgctcaggtccaacacctgggtaatccaacccagcactgatggagtggggc 468
            |||||||| ||||| ||||| || || ||||| ||||| || |||||||||||||| || 
Sbjct: 1093 aagaaactgtgctcgggtccgactccagggtagtccaatcctgcactgatggagtgtggt 1034

                                        
Query: 469  tcaatcacttgtccatcagcatcctgca 496
            ||||| | |||||||||| |||| ||||
Sbjct: 1033 tcaatgatttgtccatcatcatcttgca 1006



to top

>gb|AY087382.1| Arabidopsis thaliana clone 34783 mRNA, complete sequence
          Length = 1555

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 74/88 (84%)
 Strand = Plus / Minus

                                                                        
Query: 409  aagaaactatgctcaggtccaacacctgggtaatccaacccagcactgatggagtggggc 468
            |||||||| ||||| ||||| || || ||||| ||||| || |||||||||||||| || 
Sbjct: 1230 aagaaactgtgctcgggtccgactccagggtagtccaatcctgcactgatggagtgtggt 1171

                                        
Query: 469  tcaatcacttgtccatcagcatcctgca 496
            ||||| | |||||||||| |||| ||||
Sbjct: 1170 tcaatgatttgtccatcatcatcttgca 1143



to top

>gb|AY761528.1| Sorghum bicolor clone 51836 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761527.1| Sorghum bicolor clone 50744 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761526.1| Sorghum bicolor clone 213900 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761525.1| Sorghum arundinaceum clone LWA88 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761524.1| Sorghum x drummondii clone LWA71 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761523.1| Sorghum arundinaceum clone LWA42 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761522.1| Sorghum arundinaceum clone LWA28 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761521.1| Sorghum arundinaceum clone LWA13b unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761520.1| Sorghum arundinaceum clone LWA13a unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761519.1| Sorghum arundinaceum clone LWA22 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761518.1| Sorghum bicolor clone 257595 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761517.1| Sorghum bicolor clone 221540 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761516.1| Sorghum bicolor clone 221655 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761515.1| Sorghum bicolor clone 221607 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761514.1| Sorghum bicolor clone 22913 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761513.1| Sorghum bicolor clone BTx623 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761512.1| Sorghum bicolor clone 287624 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761511.1| Sorghum bicolor clone 510906 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761510.1| Sorghum bicolor clone 267523 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761509.1| Sorghum bicolor clone 267525 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761508.1| Sorghum bicolor clone 510985 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761507.1| Sorghum bicolor clone 77034 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761506.1| Sorghum bicolor clone 83707 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761505.1| Sorghum bicolor clone 87088 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761504.1| Sorghum bicolor clone 55751 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761503.1| Sorghum bicolor clone 51365 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761502.1| Sorghum bicolor clone 51032 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761501.1| Sorghum bicolor clone 51397 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761500.1| Sorghum bicolor clone 50875 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761499.1| Sorghum bicolor clone RTx430 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AY761498.1| Sorghum bicolor clone 152702 unknown sequence
          Length = 744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 298 tgggatgtctccagggcagggatgatgccttccagccgagaggtgcgcttgaaagc 353
           ||||| ||||||||||||||||||||||| ||||| ||||||   |||||||||||
Sbjct: 5   tgggaggtctccagggcagggatgatgccctccagacgagagacacgcttgaaagc 60



to top

>gb|AE006013.1| Caulobacter crescentus CB15 section 339 of 359 of the complete genome
          Length = 13369

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                         
Query: 289  gccagggcgtgggatgtctccagggcagggatgatgccttccagc 333
            |||||||||||||  | ||||||||| ||||||||||||||||||
Sbjct: 3547 gccagggcgtgggccggctccagggccgggatgatgccttccagc 3591



to top

>gb|M19129.1|CCRTRPFBA C.crescentus trpFBA operon genes encoding tryptophan biosynthetic
            enzymes trpA, trpB and trpF, complete cds
          Length = 3562

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 289  gccagggcgtgggatgtctccagggcagggatgatgccttccagc 333
            |||||||||||||  | ||||||||| ||||||||||||||||||
Sbjct: 2284 gccagggcgtgggccggctccagggccgggatgatgccttccagc 2240



to top

>emb|X13299.1|PPTRPAB P. putida trpB and trpA genes for tryptophan synthase (EC 4.2.1.20)
          Length = 2270

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 289  gccagggcgtgggatgtctccagggcagggatgatgccttccag 332
            ||||||||||||||  | |||||||| |||||||||||||||||
Sbjct: 1219 gccagggcgtgggagctttccagggccgggatgatgccttccag 1176



to top

>gb|CP000095.1| Prochlorococcus marinus str. NATL2A, complete genome
          Length = 1842899

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                           
Query: 383     catattcagcacgtccaatatccctcaagaaactatgctcaggtccaacacctgggtaat 442
               ||||||||||||||||||| ||  | ||| |||||||||| || ||||| ||||| ||||
Sbjct: 1495082 catattcagcacgtccaatttcttttaagtaactatgctccggcccaacccctggataat 1495141

                
Query: 443     c 443
               |
Sbjct: 1495142 c 1495142



to top

>emb|BX834018.1|CNS0A0KQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTSIL90ZC07 of Silique of strain col-0 of Arabidopsis
            thaliana (thale cress)
          Length = 1527

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                        
Query: 409  aagaaactatgctcaggtccaacacctgggtaatccaacccagcactgatggagtggggc 468
            |||||||| ||||| ||||| || || ||||| ||||| || |||||||||||||| || 
Sbjct: 1173 aagaaactgtgctcgggtccgactccagggtagtccaatcctgcactgatggagtgtggt 1114

                 
Query: 469  tcaat 473
            |||||
Sbjct: 1113 tcaat 1109



to top

>dbj|BA000039.2| Thermosynechococcus elongatus BP-1 DNA, complete genome
          Length = 2593857

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                           
Query: 448     ccagcactgatggagtggggctcaatcacttgtccatcagcatcctgcaatacataactc 507
               ||||| || |||||||||| ||||| ||| || ||||| ||||||||||||| ||| |||
Sbjct: 2590473 ccagcgctaatggagtgggcctcaaccacctgaccatcggcatcctgcaatagatagctc 2590532

                
Query: 508     a 508
               |
Sbjct: 2590533 a 2590533



to top

>gb|AF042320.1|AF042320 Camptotheca acuminata tryptophan synthase beta subunit mRNA, complete
            cds
          Length = 1706

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 100/125 (80%)
 Strand = Plus / Minus

                                                                        
Query: 384  atattcagcacgtccaatatccctcaagaaactatgctcaggtccaacacctgggtaatc 443
            ||||||||||||||| |||||  |||  || || ||||| || ||||| || ||||| ||
Sbjct: 1239 atattcagcacgtcctatatctttcagaaagctgtgctctggcccaactccagggtagtc 1180

                                                                        
Query: 444  caacccagcactgatggagtggggctcaatcacttgtccatcagcatcctgcaatacata 503
            ||  || ||||||||||| || |||||||| | ||| || ||| ||||||| |||| |||
Sbjct: 1179 caggcctgcactgatggaatgaggctcaattatttgcccgtcatcatcctgtaataaata 1120

                 
Query: 504  actca 508
             ||||
Sbjct: 1119 gctca 1115



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 197  tggctgtgtggacatccttgtctcctcttccactgcagtt 236
            ||||||| || || |||||||| ||||| |||||||||||
Sbjct: 1426 tggctgtatgaacgtccttgtcacctctgccactgcagtt 1387



to top

>gb|CP000109.1| Thiomicrospira crunogena XCL-2, complete genome
          Length = 2427734

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                  
Query: 417    atgctcaggtccaacacctgggtaatccaacccagc 452
              ||||||||| || ||||| |||||||||||||||||
Sbjct: 876046 atgctcaggaccgacacccgggtaatccaacccagc 876011



to top

>ref|XM_454431.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E10637g predicted mRNA
          Length = 2130

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 421  tcaggtccaacacctgggtaatccaacccagc 452
            ||||| |||||||||||||||||||| |||||
Sbjct: 1829 tcaggaccaacacctgggtaatccaaaccagc 1798



to top

>gb|U53153.1| Caenorhabditis elegans cosmid T19A5, complete sequence
          Length = 30722

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 31   aagtttaacatacaacatattttt 54
            ||||||||||||||||||||||||
Sbjct: 8306 aagtttaacatacaacatattttt 8329



to top

>emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 2234072

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 421    tcaggtccaacacctgggtaatccaacccagc 452
              ||||| |||||||||||||||||||| |||||
Sbjct: 940071 tcaggaccaacacctgggtaatccaaaccagc 940040



to top

>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 289   gccagggcgtgggatgtctccagggcagggatgatgccttccag 332
             ||||||||||||||  | ||||| || |||||||||||||||||
Sbjct: 39341 gccagggcgtgggagctttccagcgccgggatgatgccttccag 39384



to top

>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome
          Length = 3059876

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 409    aagaaactatgctcaggtccaacacctgggtaatc 443
              ||||| ||||||||||| |||||||| ||||||||
Sbjct: 573969 aagaagctatgctcaggaccaacaccagggtaatc 573935



to top

>emb|CR543861.1| Acinetobacter sp. ADP1 complete genome
          Length = 3598621

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                             
Query: 415    ctatgctcaggtccaacacctgggtaatcca 445
              ||||||||||| |||||||| ||||||||||
Sbjct: 626304 ctatgctcagggccaacaccagggtaatcca 626274



to top

>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome
          Length = 4659019

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                          
Query: 281     ccaggtaagccagggcgtgggatgtctccagggcagggatgat 323
               |||||||||| | ||| ||||  ||||||||||||||||||||
Sbjct: 2938676 ccaggtaagcaaaggcatgggccgtctccagggcagggatgat 2938634



to top

>dbj|AB005232.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBG8
          Length = 80315

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                
Query: 446   acccagcactgatggagtggggctcaatcacttgtccatcagcatcctgca 496
             |||| |||||||||||||| || ||||| | |||||||||| |||| ||||
Sbjct: 24265 accctgcactgatggagtgtggttcaatgatttgtccatcatcatcttgca 24315



to top

>gb|M23872.1|ATHTRPB A.thaliana tryptophan synthase beta subunit (trpB) gene, complete cds
          Length = 4225

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 446  acccagcactgatggagtggggctcaatcacttgtccatcagcatcctgca 496
            |||| |||||||||||||| || ||||| | |||||||||| |||| ||||
Sbjct: 2993 accctgcactgatggagtgtggttcaatgatttgtccatcatcatcttgca 2943



to top

>gb|M58444.1|ACCTRPFB A.calcoaceticus trpFB operon
          Length = 2217

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 415  ctatgctcaggtccaacacctgggtaatcca 445
            ||||||||||| |||||||| ||||||||||
Sbjct: 1875 ctatgctcagggccaacaccagggtaatcca 1845



to top

>gb|AC130666.9| Mus musculus chromosome 5, clone RP24-79O7, complete sequence
          Length = 172995

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 40    atacaacatatttttattacat 61
             ||||||||||||||||||||||
Sbjct: 88223 atacaacatatttttattacat 88202



to top

>gb|AC124565.2| Mus musculus BAC clone RP23-143I23 from 16, complete sequence
          Length = 177251

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 354   atccaatgcctcctggtctgtcacac 379
             ||||||||||||||||||| ||||||
Sbjct: 86112 atccaatgcctcctggtctttcacac 86137



to top

>emb|BX569695.1| Synechococcus sp. WH8102 complete genome; segment 7/7
          Length = 344615

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 55/66 (83%)
 Strand = Plus / Plus

                                                                         
Query: 268   gggcagagcttctccaggtaagccagggcgtgggatgtctccagggcagggatgatgcct 327
             |||||||||| ||||||  | || | ||||||||  ||||||||||| || |||||||| 
Sbjct: 86374 gggcagagctgctccagccaggcgaaggcgtgggcagtctccagggcgggaatgatgccc 86433

                   
Query: 328   tccagc 333
             ||||||
Sbjct: 86434 tccagc 86439



to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 307   tccagggcagggatgatgccttccag 332
             |||||||| |||||||||||||||||
Sbjct: 38461 tccagggccgggatgatgccttccag 38486



to top

>dbj|AB178644.1| Polygonum tinctorium mRNA for tryptophan synthase beta subunit,
            complete cds
          Length = 1696

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                        
Query: 252  accatccggcagtgttgggcagagcttctccaggtaagccagggcgtgggatgtctccag 311
            ||||||||  || ||||| |||||||||||||  || ||||  ||||| |||||||||| 
Sbjct: 1369 accatccgcgagggttggacagagcttctccaaataggccaatgcgtgagatgtctccaa 1310

                              
Query: 312  ggcagggatgatgccttc 329
             ||||| || ||||||||
Sbjct: 1309 agcaggaattatgccttc 1292



to top

>dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete genome
          Length = 3147090

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                     
Query: 289     gccagggcgtgggatgtctccagggcagggatgatgcc 326
               ||||| |||||||| | ||||||||||| |||||||||
Sbjct: 3058724 gccagagcgtgggaggactccagggcagcgatgatgcc 3058687



to top

>gb|AF047024.1|AF047024 Chlamydomonas reinhardtii tryptophan synthase beta (MAA7) mRNA,
            partial cds
          Length = 1835

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                      
Query: 274  agcttctccaggtaagccagggcgtgggatgtctccagggcagggatgatgccttcca 331
            |||||||||||||| || | |||||||   |||||||| || ||||| ||||||||||
Sbjct: 1239 agcttctccaggtaggcgatggcgtggctggtctccagcgcggggataatgccttcca 1182



to top

>gb|CP000112.1| Desulfovibrio desulfuricans G20, complete genome
          Length = 3730232

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                      
Query: 289   gccagggcgtgggatgtctccagggcagggatgatgccttc 329
             ||||| ||||||| || |||||| ||||| |||||||||||
Sbjct: 69298 gccagtgcgtgggctgactccagcgcaggtatgatgccttc 69258



to top

>ref|XM_637643.1| Dictyostelium discoideum hypothetical protein (DDB0169120), partial
           mRNA
          Length = 669

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 48  tatttttattacatataaatt 68
           |||||||||||||||||||||
Sbjct: 663 tatttttattacatataaatt 643



to top

>gb|AE014825.1| Plasmodium falciparum 3D7 chromosome 14 section 10 of 13 of the
             complete sequence
          Length = 250053

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 47    atatttttattacatataaat 67
             |||||||||||||||||||||
Sbjct: 80372 atatttttattacatataaat 80352



to top

>gb|AY246079.1| Escherichia coli strain DAEC192 tryptophan synthase subunit B (trpB)
            gene, partial cds
          Length = 1114

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 289  gccagggcgtgggatgtctccagggcagggatgatgccttc 329
            |||||||||||||| | |||||| || |||||||| |||||
Sbjct: 1043 gccagggcgtgggaggactccagcgccgggatgatcccttc 1003



to top

>gb|AY246059.1| Escherichia coli strain DAEC19 tryptophan synthase subunit B (trpB)
            gene, partial cds
          Length = 1138

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 289  gccagggcgtgggatgtctccagggcagggatgatgccttc 329
            |||||||||||||| | |||||| || |||||||| |||||
Sbjct: 1043 gccagggcgtgggaggactccagcgccgggatgatcccttc 1003



to top

>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 307   tccagggcagggatgatgccttccagccg 335
             ||||| || ||||||||||||||||||||
Sbjct: 67038 tccagcgccgggatgatgccttccagccg 67066



to top

>gb|AC116977.2| Dictyostelium discoideum chromosome 2 map 5515173-5817331 strain AX4,
              complete sequence
          Length = 302156

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 48     tatttttattacatataaatt 68
              |||||||||||||||||||||
Sbjct: 145652 tatttttattacatataaatt 145672



to top

>gb|AY132993.1| Escherichia coli strain ECOR47 tryptophan synthase subunit B (trpB)
            gene, partial cds
          Length = 1138

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 289  gccagggcgtgggatgtctccagggcagggatgatgccttc 329
            |||||||||||||| | |||||| || |||||||| |||||
Sbjct: 1043 gccagggcgtgggaggactccagcgccgggatgatcccttc 1003



to top

>emb|BX321874.2| Human DNA sequence from clone RP11-496M10 on chromosome X, complete
             sequence
          Length = 52877

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 18    ctttatttataccaagtttaa 38
             |||||||||||||||||||||
Sbjct: 46033 ctttatttataccaagtttaa 46013



to top

>emb|AL592144.5| Human DNA sequence from clone RP11-476B1 on chromosome 1 Contains a
             novel gene, complete sequence
          Length = 197322

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 36    taacatacaacatatttttattacatata 64
             ||||||||||||||||||| ||| |||||
Sbjct: 36659 taacatacaacatatttttcttatatata 36631



to top

>emb|AL590644.14| Human DNA sequence from clone RP11-380J14 on chromosome 1 Contains a
              novel gene (FLJ45933), the PADI1 gene for type I peptidyl
              arginine deiminase, the PADI3 gene for type III peptidyl
              arginine deiminase, the 5' end of the PADI4 gene for type
              IV peptidyl arginine deiminase, complete sequence
          Length = 164862

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 235    ttcagaaccaccctcacacca 255
              |||||||||||||||||||||
Sbjct: 120454 ttcagaaccaccctcacacca 120434



to top

>emb|CR626927.1| Bacteroides fragilis NCTC 9343, complete genome
          Length = 5205140

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 307     tccagggcagggatgatgccttccagccg 335
               ||||||||||| ||||| |||||||||||
Sbjct: 3114455 tccagggcaggaatgattccttccagccg 3114427



to top

>emb|AJ549502.2|HSA549502 Homo sapiens peptidylarginine deiminase gene locus (PADI12346 genes)
          Length = 355060

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 235    ttcagaaccaccctcacacca 255
              |||||||||||||||||||||
Sbjct: 221992 ttcagaaccaccctcacacca 221972



to top

>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome
          Length = 6413771

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 56      ttacatataaattcaaaaaac 76
               |||||||||||||||||||||
Sbjct: 3977458 ttacatataaattcaaaaaac 3977438



to top

>dbj|AP006841.1| Bacteroides fragilis YCH46 DNA, complete genome
          Length = 5277274

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 307     tccagggcagggatgatgccttccagccg 335
               ||||||||||| ||||| |||||||||||
Sbjct: 3051625 tccagggcaggaatgattccttccagccg 3051597



to top

>dbj|AP001754.1| Homo sapiens genomic DNA, chromosome 21q, section 98/105
          Length = 340000

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 38     acatacaacatatttttatta 58
              |||||||||||||||||||||
Sbjct: 188522 acatacaacatatttttatta 188542



to top

>emb|BX072569.6| Zebrafish DNA sequence from clone CH211-184B9 in linkage group 22,
             complete sequence
          Length = 144729

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 48    tatttttattacatataaatt 68
             |||||||||||||||||||||
Sbjct: 56092 tatttttattacatataaatt 56072



to top

>gb|M15826.1|PSETRPAB P.aeruginosa trpA and trpB genes, encoding tryptophan synthase alpha-
            and beta-chains, complete cds
          Length = 2853

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 289  gccagggcgtgggatgtctccagggcagggatgatgccttc 329
            ||||||||||||||  | ||||| || ||||||||||||||
Sbjct: 1119 gccagggcgtgggagctttccagcgccgggatgatgccttc 1079



to top

>dbj|AP001065.1| Homo sapiens genomic DNA, chromosome 21, clone:KB68A7, MX1-D21S171
             region, complete sequence
          Length = 115798

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 38    acatacaacatatttttatta 58
             |||||||||||||||||||||
Sbjct: 78626 acatacaacatatttttatta 78646



to top

>gb|AC129545.5| Mus musculus chromosome 1, clone RP23-264E23, complete sequence
          Length = 180431

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 67    ttcaaaaaaccaaactaaat 86
             ||||||||||||||||||||
Sbjct: 13301 ttcaaaaaaccaaactaaat 13282



to top

>gb|AC147027.4| Pan troglodytes BAC clone RP43-92F2 from 7, complete sequence
          Length = 162023

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 204   gtggacatccttgtctcctc 223
             ||||||||||||||||||||
Sbjct: 90597 gtggacatccttgtctcctc 90578



to top

>gb|AF275271.2| Schizosaccharomyces octosporus mitochondrion, complete genome
          Length = 44227

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                         
Query: 47    atatttttattacatataaattcaaaaa 74
             |||||||||||||||| |||||||||||
Sbjct: 28551 atatttttattacata-aaattcaaaaa 28577



to top

>gb|AC161021.4| Pan troglodytes BAC clone CH251-2N24 from chromosome 7, complete sequence
          Length = 187139

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 204    gtggacatccttgtctcctc 223
              ||||||||||||||||||||
Sbjct: 132503 gtggacatccttgtctcctc 132484



to top

>gb|AC165344.3| Mus musculus BAC clone RP23-390P7 from chromosome 16, complete sequence
          Length = 193532

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 52     tttattacatataaattcaa 71
              ||||||||||||||||||||
Sbjct: 111932 tttattacatataaattcaa 111951



to top

>gb|AC167141.2| Mus musculus BAC clone RP23-313L4 from chromosome 16, complete sequence
          Length = 192972

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 69    caaaaaaccaaactaaatta 88
             ||||||||||||||||||||
Sbjct: 43130 caaaaaaccaaactaaatta 43149



to top

>gb|AC138093.7| Mus musculus chromosome 16, clone RP24-559J21, complete sequence
          Length = 123569

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 52    tttattacatataaattcaa 71
             ||||||||||||||||||||
Sbjct: 82062 tttattacatataaattcaa 82043



to top

>gb|AC116106.18| Mus musculus chromosome 16, clone RP23-23D5, complete sequence
          Length = 252718

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 69   caaaaaaccaaactaaatta 88
            ||||||||||||||||||||
Sbjct: 9647 caaaaaaccaaactaaatta 9628



to top

>gb|AC122901.4| Mus musculus BAC clone RP23-40D21 from chromosome 10, complete sequence
          Length = 207598

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 199   gctgtgtggacatccttgtctcct 222
             ||||||| ||||||||||||||||
Sbjct: 92415 gctgtgttgacatccttgtctcct 92392



to top

>gb|AC141329.4| Mus musculus BAC clone RP23-63G7 from chromosome 7, complete sequence
          Length = 153106

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 374   tcacactatcatattcagca 393
             ||||||||||||||||||||
Sbjct: 83233 tcacactatcatattcagca 83252



to top

>gb|AF450245.1| Mus musculus clone BAC199M11, complete sequence
          Length = 124254

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 477   ttgtccatcagcatcctgca 496
             ||||||||||||||||||||
Sbjct: 22516 ttgtccatcagcatcctgca 22535



to top

>gb|AC129602.3| Mus musculus BAC clone RP23-37L24 from 16, complete sequence
          Length = 185729

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 69    caaaaaaccaaactaaatta 88
             ||||||||||||||||||||
Sbjct: 77510 caaaaaaccaaactaaatta 77529



to top

>ref|XM_949018.1| Theileria annulata strain Ankara hypothetical protein (TA02845)
            partial mRNA
          Length = 8538

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 52   tttattacatataaattcaa 71
            ||||||||||||||||||||
Sbjct: 5884 tttattacatataaattcaa 5903



to top

>gb|AC002564.1| Homo sapiens BAC clone CTB-164L14 from 7, complete sequence
          Length = 94320

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 204   gtggacatccttgtctcctc 223
             ||||||||||||||||||||
Sbjct: 46641 gtggacatccttgtctcctc 46622



to top

>gb|AE014822.1| Plasmodium falciparum 3D7 chromosome 14 section 7 of 13 of the complete
              sequence
          Length = 253924

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 48     tatttttattacatataaat 67
              ||||||||||||||||||||
Sbjct: 158459 tatttttattacatataaat 158478



to top

>emb|AL109657.8|HSDJ842G6 Human DNA sequence from clone RP5-842G6 on chromosome 20 Contains the
            3' end of the C20orf7 gene for chromosome 20 open reading
            frame 7 (FLJ22324) and the 3' end of the C20orf50 gene
            for chromosome 20 open reading frame 50 (dJ631M13.1,
            similar to SEL1L (DKFZp434C1826)), complete sequence
          Length = 100272

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 37   aacatacaacatatttttat 56
            ||||||||||||||||||||
Sbjct: 9892 aacatacaacatatttttat 9911



to top

>gb|AC161606.5| Mus musculus BAC clone RP23-232M18 from chromosome 14, complete
             sequence
          Length = 223037

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 40    atacaacatatttttattacatataaat 67
             |||||||||||||||  |||||||||||
Sbjct: 18306 atacaacatatttttggtacatataaat 18333



to top

>emb|AL161566.2|ATCHRIV66 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 66
          Length = 198372

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 411   gaaactatgctcaggtccaacacctgggtaatccaa 446
             |||||||||||||||||| || || ||||| |||||
Sbjct: 92149 gaaactatgctcaggtccgactccagggtagtccaa 92114



to top

>emb|AL035680.1|ATT24A18 Arabidopsis thaliana DNA chromosome 4, BAC clone T24A18, partial
            sequence (ESSA project)
          Length = 45980

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 411  gaaactatgctcaggtccaacacctgggtaatccaa 446
            |||||||||||||||||| || || ||||| |||||
Sbjct: 8638 gaaactatgctcaggtccgactccagggtagtccaa 8603



to top

>emb|CR382384.18| Zebrafish DNA sequence from clone CH211-15B7 in linkage group 8,
             complete sequence
          Length = 124327

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 45    acatatttttattacatata 64
             ||||||||||||||||||||
Sbjct: 90655 acatatttttattacatata 90674



to top

>emb|BX950179.6| Zebrafish DNA sequence from clone DKEY-27P23 in linkage group 5,
             complete sequence
          Length = 235445

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 61    tataaattcaaaaaaccaaa 80
             ||||||||||||||||||||
Sbjct: 56726 tataaattcaaaaaaccaaa 56745



to top

>gb|AC183768.2| Pan troglodytes BAC clone CH251-337F15 from chromosome 14, complete
             sequence
          Length = 148598

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 47    atatttttattacatataaattca 70
             |||||||||||||||||| |||||
Sbjct: 49177 atatttttattacatatatattca 49154



to top

>gb|AC117395.5| Homo sapiens 3 BAC RP11-651P23 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 172715

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 209   catccttgtctcctcttcca 228
             ||||||||||||||||||||
Sbjct: 60777 catccttgtctcctcttcca 60758



to top

>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome
          Length = 3046682

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 439     taatccaacccagcactgatggagtggg 466
               |||||||| ||||| |||||||||||||
Sbjct: 1581572 taatccaagccagcgctgatggagtggg 1581545



to top

>gb|AC109482.3| Homo sapiens chromosome 5 clone RP11-492A10, complete sequence
          Length = 101941

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 62    ataaattcaaaaaaccaaac 81
             ||||||||||||||||||||
Sbjct: 12932 ataaattcaaaaaaccaaac 12951



to top

>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 56/68 (82%)
 Strand = Plus / Plus

                                                                           
Query: 265     gttgggcagagcttctccaggtaagccagggcgtgggatgtctccagggcagggatgatg 324
               ||||| ||||||||||| |||| ||| |  ||||||| ||| ||||| || || ||||||
Sbjct: 2088948 gttggacagagcttctcaaggtgagcaaaagcgtgggctgtttccagcgccggaatgatg 2089007

                       
Query: 325     ccttccag 332
               || |||||
Sbjct: 2089008 ccctccag 2089015



to top

>gb|BC056428.1| Mus musculus vezatin, adherens junctions transmembrane protein, mRNA
            (cDNA clone MGC:66585 IMAGE:5716245), complete cds
          Length = 2900

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  gctgtgtggacatccttgtctcct 222
            ||||||| ||||||||||||||||
Sbjct: 1862 gctgtgttgacatccttgtctcct 1885



to top

>ref|NM_172538.2| Mus musculus vezatin, adherens junctions transmembrane protein
            (Vezt), mRNA
          Length = 4480

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  gctgtgtggacatccttgtctcct 222
            ||||||| ||||||||||||||||
Sbjct: 1875 gctgtgttgacatccttgtctcct 1898



to top

>emb|BX530089.9| Zebrafish DNA sequence from clone CH211-129M12 in linkage group 3,
              complete sequence
          Length = 176077

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     atatttttattacatataaa 66
              ||||||||||||||||||||
Sbjct: 147486 atatttttattacatataaa 147505



to top

>gb|AY562383.1| Leptorhynchoides thecatus mitochondrion, complete genome
          Length = 13888

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 48    tatttttattacatataaat 67
             ||||||||||||||||||||
Sbjct: 11114 tatttttattacatataaat 11095



to top

>dbj|AK036017.1| Mus musculus 16 days neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:9630027H07 product:TRANSMEMBRANE
            PROTEIN VEZATIN homolog [Homo sapiens], full insert
            sequence
          Length = 4480

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  gctgtgtggacatccttgtctcct 222
            ||||||| ||||||||||||||||
Sbjct: 1875 gctgtgttgacatccttgtctcct 1898



to top

>dbj|AK031848.1| Mus musculus adult male medulla oblongata cDNA, RIKEN full-length
            enriched library, clone:6330418D12 product:TRANSMEMBRANE
            PROTEIN VEZATIN homolog [Homo sapiens], full insert
            sequence
          Length = 2956

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  gctgtgtggacatccttgtctcct 222
            ||||||| ||||||||||||||||
Sbjct: 1938 gctgtgttgacatccttgtctcct 1961



to top

>emb|BX255919.15| Zebrafish DNA sequence from clone DKEY-259P11 in linkage group 8,
              complete sequence
          Length = 168607

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     atatttttattacatataaa 66
              ||||||||||||||||||||
Sbjct: 155655 atatttttattacatataaa 155636



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 49       atttttattacatataaatt 68
                ||||||||||||||||||||
Sbjct: 23582165 atttttattacatataaatt 23582184



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 201     tgtgtggacatccttgtctcctct 224
               ||||||||||||||| ||||||||
Sbjct: 3700714 tgtgtggacatccttctctcctct 3700737



to top

>gb|AC084882.2|AC084882 Homo sapiens chromosome 15 clone RP11-408J6 map 15q21.1, complete
             sequence
          Length = 193804

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    acatataaattcaaaaaacc 77
             ||||||||||||||||||||
Sbjct: 46144 acatataaattcaaaaaacc 46163



to top

>gb|AC078846.2|AC078846 Homo sapiens chromosome 7 clone RP11-448A19, complete sequence
          Length = 219428

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 259   ggcagtgttgggcagagctt 278
             ||||||||||||||||||||
Sbjct: 65412 ggcagtgttgggcagagctt 65431



to top

>gb|AC025761.5|AC025761 Homo sapiens chromosome 5 clone CTB-109C23, complete sequence
          Length = 112944

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 62     ataaattcaaaaaaccaaac 81
              ||||||||||||||||||||
Sbjct: 110820 ataaattcaaaaaaccaaac 110839



to top

>gb|AC005104.1| Homo sapiens BAC clone CTA-442F18 from 2, complete sequence
          Length = 134911

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 48    tatttttattacatataaat 67
             ||||||||||||||||||||
Sbjct: 81113 tatttttattacatataaat 81094



to top

>dbj|AP006435.1| Sus scrofa  CC chemokine receptor genes (CCR3, CCR2, CCR5, CCRL2, LTF),
             complete and partial cds, clone: 0479G08
          Length = 144233

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 472   atcacttgtccatcagcatc 491
             ||||||||||||||||||||
Sbjct: 95628 atcacttgtccatcagcatc 95647



to top

>dbj|AP006185.1| Sus scrofa CC chemokine receptor genes (CCR2, CCR5, CCRL2, LTF, TMEM7,
             LRRC2), complete cds, clone: 0475A03
          Length = 165558

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 472   atcacttgtccatcagcatc 491
             ||||||||||||||||||||
Sbjct: 27023 atcacttgtccatcagcatc 27042



to top

>gb|AC066615.7|AC066615 Homo sapiens chromosome 15 clone RP11-90J19 map 15q21.1, complete
              sequence
          Length = 175001

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     acatataaattcaaaaaacc 77
              ||||||||||||||||||||
Sbjct: 141624 acatataaattcaaaaaacc 141643



to top

>gb|AC084321.37| Mus musculus strain C57BL/6J chromosome 7 clone rp23-316h18, complete
              sequence
          Length = 176639

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 374    tcacactatcatattcagca 393
              ||||||||||||||||||||
Sbjct: 120979 tcacactatcatattcagca 120960



to top

>gb|BC020913.1| Homo sapiens, clone IMAGE:4733200, mRNA
          Length = 857

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 259 ggcagtgttgggcagagctt 278
           ||||||||||||||||||||
Sbjct: 380 ggcagtgttgggcagagctt 399



to top

>gb|AC009477.4| Homo sapiens BAC clone RP11-209H16 from 2, complete sequence
          Length = 173071

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 302   atgtctccagggcagggatg 321
             ||||||||||||||||||||
Sbjct: 90527 atgtctccagggcagggatg 90508



to top

>gb|AF435978.1| Clostridium cellulovorans hypothetical protein gene, complete cds;
            dxylA pseudogene, complete sequence; and xylanase (xynA)
            gene, complete cds
          Length = 8737

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 49   atttttattacatataaatt 68
            ||||||||||||||||||||
Sbjct: 1268 atttttattacatataaatt 1249



to top

>dbj|AP003629.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0481H08
          Length = 146841

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    atttttattacatataaatt 68
             ||||||||||||||||||||
Sbjct: 63129 atttttattacatataaatt 63148



to top

>emb|BX510933.4| Zebrafish DNA sequence from clone CH211-271G16 in linkage group 4,
             complete sequence
          Length = 151440

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 61    tataaattcaaaaaaccaaa 80
             ||||||||||||||||||||
Sbjct: 46411 tataaattcaaaaaaccaaa 46430



to top

>dbj|AP005071.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0669G09
          Length = 140067

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 201   tgtgtggacatccttgtctcctct 224
             ||||||||||||||| ||||||||
Sbjct: 41031 tgtgtggacatccttctctcctct 41054



to top

>dbj|BS000174.1| Pan troglodytes chromosome 22 clone:PTB-137B16, map 22, complete
             sequences
          Length = 193756

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 213   cttgtctcctcttccactgc 232
             ||||||||||||||||||||
Sbjct: 54551 cttgtctcctcttccactgc 54532



to top

>emb|BX469897.6| Zebrafish DNA sequence from clone CH211-39F22 in linkage group 4,
              complete sequence
          Length = 186500

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     atatttttattacatataaa 66
              ||||||||||||||||||||
Sbjct: 175858 atatttttattacatataaa 175877



to top

>dbj|AB102786.1| Cycloclasticus sp. A5 orf1, phnA1b, phnA1, phnA2, phnC, trpB, orf7,
            phnA4, phnA3 and phnD genes for hypothetical protein,
            aromatic dioxygenase large subunit, PAH dioxygenase iron
            sulfer protein large subunit, PAH dioxygenase iron sulfer
            protein small subunit, extradiol dioxygenase, tryptophan
            synthase b subunit, hypothetical protein, ferredoxin
            reductase, ferredoxin and isomerase, complete and partial
            cds
          Length = 10580

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 418  tgctcaggtccaacacctgggtaatccaaccc 449
            |||| ||||||||| ||||| |||||||||||
Sbjct: 7613 tgctgaggtccaacccctggataatccaaccc 7582



to top

>emb|AJ328899.1|HSA328899 Homo sapiens genomic sequence surrounding NotI site, clone NR1-PJ9R
          Length = 851

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 482 catcagcatcctgcaataca 501
           ||||||||||||||||||||
Sbjct: 342 catcagcatcctgcaataca 323



to top

>gb|AC156636.2| Mus musculus BAC clone RP24-401F19 from chromosome 12, complete sequence
          Length = 170370

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 47     atatttttattacatataaattcaaaaa 74
              |||| |||||||||||||||||| ||||
Sbjct: 106213 atatatttattacatataaattctaaaa 106186



to top

>dbj|AP001705.1| Homo sapiens genomic DNA, chromosome 21q, section 49/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 213    cttgtctcctcttccactgc 232
              ||||||||||||||||||||
Sbjct: 261965 cttgtctcctcttccactgc 261946



to top

>gb|U77666.1|BRU77666 Brassica rapa pollen coat protein homolog (BAN103) gene, complete cds
          Length = 2539

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 45   acatatttttattacatata 64
            ||||||||||||||||||||
Sbjct: 2447 acatatttttattacatata 2428



to top

>emb|CT030234.9| M.truncatula DNA sequence from clone MTH2-22I15 on chromosome 3,
             complete sequence
          Length = 112511

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 415   ctatgctcaggtccaacacctgggtaatccaa 446
             ||||| |||||||||||||| ||||| |||||
Sbjct: 22660 ctatgttcaggtccaacaccagggtagtccaa 22691



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 298   tgggatgtctccagggcagggatgatgccttc 329
             |||||||||||||| || || |||||||||||
Sbjct: 21582 tgggatgtctccagagctggaatgatgccttc 21613



to top

>gb|AE015451.1| Pseudomonas putida KT2440 complete genome
          Length = 6181863

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                         
Query: 289   gccagggcgtgggatgtctccagggcagggatgatgccttccag 332
             |||| |||||||||  | |||||||| || ||||||||||||||
Sbjct: 92502 gccaaggcgtgggagctttccagggctggaatgatgccttccag 92545



to top

>dbj|AP000239.2| Homo sapiens genomic DNA, chromosome 21q, clone:RP11-32A2, complete
             sequence
          Length = 119326

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 213   cttgtctcctcttccactgc 232
             ||||||||||||||||||||
Sbjct: 77045 cttgtctcctcttccactgc 77026



to top

>gb|AF042321.1|AF042321 Camptotheca acuminata tryptophan synthase beta (TSB) gene, complete
            cds
          Length = 9645

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 197  tggctgtgtggacatccttgtctcctcttccactgcagtt 236
            ||||||| || || |||||||| ||||| |||||||||||
Sbjct: 8584 tggctgtatgaacgtccttgtcacctctgccactgcagtt 8545



to top

>gb|AC116952.4| Mus musculus BAC clone RP23-104A7 from 14, complete sequence
          Length = 210088

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 40     atacaacatatttttattacatataaat 67
              |||||||||||||||  |||||||||||
Sbjct: 156370 atacaacatatttttggtacatataaat 156397



to top

>emb|AL928821.6| Zebrafish DNA sequence from clone CH211-127N10, complete sequence
          Length = 153232

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 47  atatttttattacatataaa 66
           ||||||||||||||||||||
Sbjct: 939 atatttttattacatataaa 920



to top

>emb|X96607.1|MMIGHALP M.musculus IgH 3' alpha enhancer DNA
          Length = 17956

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 477   ttgtccatcagcatcctgca 496
             ||||||||||||||||||||
Sbjct: 15812 ttgtccatcagcatcctgca 15831



to top

>gb|AY753561.1| Mus musculus vezatin isoform 2.4 mRNA, complete cds, alternatively
            spliced
          Length = 2343

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  gctgtgtggacatccttgtctcct 222
            ||||||| ||||||||||||||||
Sbjct: 1831 gctgtgttgacatccttgtctcct 1854



to top

>gb|M81620.1|ATHTRPSB A.thaliana tryptophan synthase beta-subunit (TSB2) gene, complete cds
          Length = 3007

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 411  gaaactatgctcaggtccaacacctgggtaatccaa 446
            |||||||||||||||||| || || ||||| |||||
Sbjct: 2172 gaaactatgctcaggtccgactccagggtagtccaa 2137



to top

>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome
          Length = 2695903

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 56/68 (82%)
 Strand = Plus / Minus

                                                                           
Query: 265     gttgggcagagcttctccaggtaagccagggcgtgggatgtctccagggcagggatgatg 324
               ||||| ||||||||||| |||| ||| |  ||||||| ||| ||||| || || ||||||
Sbjct: 2228082 gttggacagagcttctcaaggtgagcaaaagcgtgggctgtttccagcgccggaatgatg 2228023

                       
Query: 325     ccttccag 332
               || |||||
Sbjct: 2228022 ccctccag 2228015



to top

>dbj|AP000199.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region, clone
             B355D16-T1073, segment 5/8, complete sequence
          Length = 100000

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 213   cttgtctcctcttccactgc 232
             ||||||||||||||||||||
Sbjct: 16026 cttgtctcctcttccactgc 16045



to top

>dbj|AP000095.1| Homo sapiens genomic DNA of 21q22.1, GART and AML related,
             B335D16-P10G11 region, segment 5/7
          Length = 100000

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 213   cttgtctcctcttccactgc 232
             ||||||||||||||||||||
Sbjct: 16026 cttgtctcctcttccactgc 16045


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,220,790
Number of Sequences: 3902068
Number of extensions: 5220790
Number of successful extensions: 136615
Number of sequences better than 10.0: 172
Number of HSP's better than 10.0 without gapping: 171
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 135921
Number of HSP's gapped (non-prelim): 692
length of query: 512
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 489
effective length of database: 17,143,297,704
effective search space: 8383072577256
effective search space used: 8383072577256
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top