>emb|Z83819.1|HS146H21 Human DNA sequence from clone RP1-146H21 on chromosome Xq22 Contains
             the 3' end of the CSTF2 gene for cleavage stimulation
             factor (3' pre-RNA, subunit 2, 64kDa), the NOX1 gene for
             NADPH oxidase 1 and two heterogeneous nuclear
             ribonucleoprotein A1 (HNRPA1) pseudogenes, complete
             sequence
          Length = 66424

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 72    acgttgttgaaagaaattaaa 92
             |||||||||||||||||||||
Sbjct: 63166 acgttgttgaaagaaattaaa 63186

>emb|AL451065.13| Human DNA sequence from clone RP11-274J16 on chromosome 9 Contains the
             3' end of the FGD3 gene for FGD1 family, member 3
             (FLJ00004), a novel gene, a novel gene (MGC26847), a novel
             gene (MGC11115), the NINJ1 gene for ninjurin 1 and three
             CpG islands, complete sequence
          Length = 163689

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 72    acgttgttgaaagaaattaaa 92
             |||||||||||||||||||||
Sbjct: 88463 acgttgttgaaagaaattaaa 88443

>emb|AL359262.9| Human DNA sequence from clone RP11-334O13 on chromosome 13 Contains a
            high-mobility group pseudogene, complete sequence
          Length = 162763

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 72   acgttgttgaaagaaattaaa 92
            |||||||||||||||||||||
Sbjct: 1247 acgttgttgaaagaaattaaa 1267

>emb|BX914206.10| Zebrafish DNA sequence from clone CH211-174J14 in linkage group 18,
             complete sequence
          Length = 139321

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 75    ttgttgaaagaaattaaaaca 95
             |||||||||||||||||||||
Sbjct: 90599 ttgttgaaagaaattaaaaca 90619

>emb|AL808027.14| Mouse DNA sequence from clone RP23-161B9 on chromosome 2, complete
             sequence
          Length = 241914

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 35    acacagaagcagcctctttgt 55
             |||||||||||||||||||||
Sbjct: 50212 acacagaagcagcctctttgt 50192

>gb|AC098645.3| Papio anubis clone RP41-470J23, complete sequence
          Length = 193317

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 72     acgttgttgaaagaaattaaa 92
              |||||||||||||||||||||
Sbjct: 181327 acgttgttgaaagaaattaaa 181347

>gb|AC098698.3| Papio anubis clone RP41-177A23, complete sequence
          Length = 165334

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 72    acgttgttgaaagaaattaaa 92
             |||||||||||||||||||||
Sbjct: 21401 acgttgttgaaagaaattaaa 21421

>gb|AC027689.10|AC027689 Homo sapiens chromosome 18 clone RP11-245A17, complete sequence
          Length = 180573

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 75    ttgttgaaagaaattaaaaca 95
             |||||||||||||||||||||
Sbjct: 68604 ttgttgaaagaaattaaaaca 68584

>dbj|AP005793.2| Homo sapiens genomic DNA, chromosome 18 clone:RP11-2N10, complete
            sequence
          Length = 51000

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 75   ttgttgaaagaaattaaaaca 95
            |||||||||||||||||||||
Sbjct: 3548 ttgttgaaagaaattaaaaca 3568

>emb|AJ494839.1|SAU494839 Stigmatella aurantiaca partial sqs gene for squalene synthase and
           cas gene for cycloartenol synthase, strain Sg a15
          Length = 3629

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 203 acatcccccatgccatcggccatgg 227
           |||||| ||||||||||||||||||
Sbjct: 347 acatccgccatgccatcggccatgg 323

>gb|AY430222.1| Regalecus glesne recombination activating protein 1 (RAG1) gene,
           partial cds
          Length = 1469

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 201 tgacatcccccatgccatcg 220
           ||||||||||||||||||||
Sbjct: 333 tgacatcccccatgccatcg 314

>gb|AY380535.1| Salvelinus malma recombination-activating protein 1 (RAG1) gene,
           partial cds
          Length = 1556

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 201 tgacatcccccatgccatcg 220
           ||||||||||||||||||||
Sbjct: 366 tgacatcccccatgccatcg 347

>gb|AC012162.11| Drosophila melanogaster clone BACR01N10, complete sequence
          Length = 169856

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 78    ttgaaagaaattaaaacaca 97
             ||||||||||||||||||||
Sbjct: 42427 ttgaaagaaattaaaacaca 42446

>emb|AL591790.1|SME591790 Sinorhizobium meliloti 1021 complete chromosome; segment 9/12
          Length = 323450

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 198    ggatgacatcccccatgccatcggccat 225
              ||||||||||| ||||||||| ||||||
Sbjct: 125311 ggatgacatccgccatgccataggccat 125338

>gb|AC124429.4| Mus musculus BAC clone RP24-239N4 from chromosome 13, complete sequence
          Length = 168858

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 88     ttaaaacacaggagcacaaa 107
              ||||||||||||||||||||
Sbjct: 112050 ttaaaacacaggagcacaaa 112069

>gb|AC141115.22| Medicago truncatula clone mth2-16b23, complete sequence
          Length = 126187

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 102    cacaaaaaacagtagcacac 121
              ||||||||||||||||||||
Sbjct: 104476 cacaaaaaacagtagcacac 104495

>gb|AC153760.3| Loxodonta africana clone VMRC15-151E6, complete sequence
          Length = 130127

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 74    gttgttgaaagaaattaaaa 93
             ||||||||||||||||||||
Sbjct: 43499 gttgttgaaagaaattaaaa 43480

>gb|AC092491.6| Homo sapiens 12 BAC RP11-125G9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 103308

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 93    acacaggagcacaaaaaaca 112
             ||||||||||||||||||||
Sbjct: 74098 acacaggagcacaaaaaaca 74117

>ref|XM_391900.2| PREDICTED: Apis mellifera similar to CG8939-PA (LOC408348), mRNA
          Length = 2588

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 78   ttgaaagaaattaaaacaca 97
            ||||||||||||||||||||
Sbjct: 1335 ttgaaagaaattaaaacaca 1354

>gb|AY552034.1| Hypancistrus sp. CAC-2004 RAG1 gene, exon 3 and partial cds
          Length = 938

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 201 tgacatcccccatgccatcg 220
           ||||||||||||||||||||
Sbjct: 366 tgacatcccccatgccatcg 347

>gb|AC010736.13| Homo sapiens BAC clone RP11-436F6 from 2, complete sequence
          Length = 204267

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 75    ttgttgaaagaaattaaaac 94
             ||||||||||||||||||||
Sbjct: 48500 ttgttgaaagaaattaaaac 48481

>gb|AE003506.3| Drosophila melanogaster chromosome X, section 58 of 74 of the complete
              sequence
          Length = 302073

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 78     ttgaaagaaattaaaacaca 97
              ||||||||||||||||||||
Sbjct: 282277 ttgaaagaaattaaaacaca 282258


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,738,613
Number of Sequences: 3902068
Number of extensions: 2738613
Number of successful extensions: 261119
Number of sequences better than 10.0: 22
Number of HSP's better than 10.0 without gapping: 22
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 261054
Number of HSP's gapped (non-prelim): 65
length of query: 227
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 205
effective length of database: 17,147,199,772
effective search space: 3515175953260
effective search space used: 3515175953260
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)