Clone Name | rbart12e11 |
---|---|
Clone Library Name | barley_pub |
>dbj|AB029935.1| Triticum aestivum mRNA for chitinase 2, complete cds Length = 1163 Score = 256 bits (129), Expect = 6e-65 Identities = 159/169 (94%) Strand = Plus / Minus Query: 320 atctcactgcaccgcgagcccgatgttgaacgacaattggttgtagcagtcgaggttatt 379 ||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||| Sbjct: 983 atctcactgtgccgcgagcccaacgttgaacgacaattggttgtagcagtcgaggttatt 924 Query: 380 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggccac 439 |||||||||||||||||| |||||||| ||||||||||||||||||||||| || ||||| Sbjct: 923 cccgtagccgatgccgaaaatgtcacaatagcgcttgtagaacccgatccgatccgccac 864 Query: 440 cttgtcgttctgccccttgccgcattcgatcccgccattgatgacgttg 488 |||||||||||||||| ||||||||||||||||||| |||||||||||| Sbjct: 863 cttgtcgttctgccccatgccgcattcgatcccgccgttgatgacgttg 815 Score = 89.7 bits (45), Expect = 8e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 209 aggtctggacatccatttatttggtcataaaatacttaccaagattatttatttgtgggt 268 |||||||| |||||||||||||||||||||| ||||| |||||||||||||||| || || Sbjct: 1085 aggtctggtcatccatttatttggtcataaagtacttcccaagattatttatttatgtgt 1026 Query: 269 gatca 273 ||||| Sbjct: 1025 gatca 1021
>gb|AF000965.1|AF000965 Poa pratensis chitinase (Chi3) pseudogene sequence Length = 1173 Score = 109 bits (55), Expect = 9e-21 Identities = 109/127 (85%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||| ||||| | |||||||| || ||||| || ||| |||||||||||| Sbjct: 1134 tggttgtagcagtccaggttgtccccgtagctgacgccgaggaggtcgcagtagcgcttg 1075 Query: 417 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 476 ||||||||||||| |||||| || || || ||||||||||||||| |||| |||||| Sbjct: 1074 tagaacccgatcctgtcggcgacgcggttgtcctgccccttgccgcactcgagcccgccg 1015 Query: 477 ttgatga 483 ||||||| Sbjct: 1014 ttgatga 1008
>gb|AF000966.1|AF000966 Poa pratensis chitinase (Chi2) gene, complete cds Length = 1080 Score = 103 bits (52), Expect = 5e-19 Identities = 109/128 (85%) Strand = Plus / Minus Query: 361 tgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtaga 420 |||||||||| ||||| || ||||||| || ||||| || ||| |||||||||||||||| Sbjct: 967 tgtagcagtccaggttgtttccgtagctgacgccgaggaggtcgcagtagcgcttgtaga 908 Query: 421 acccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattga 480 ||||||||||||| || || || || |||||| |||||||| |||| ||||||||||| Sbjct: 907 acccgatccggtctgcgacgcggttgtcctgccctttgccgcactcgagcccgccattga 848 Query: 481 tgacgttg 488 ||| |||| Sbjct: 847 tgatgttg 840
>emb|X54367.1|OSCHIT Oryza sativa (rice) gene for endochitinase Length = 1237 Score = 93.7 bits (47), Expect = 5e-16 Identities = 80/91 (87%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 ||||||||||| || ||||||| || |||| || ||| | ||||| |||||||||||| Sbjct: 1080 tggttgtagcaatccaggttatcgccatagctgacgcccagcatgtcgcagtagcgcttg 1021 Query: 417 tagaacccgatccggtcggccaccttgtcgt 447 ||||||||||||||||||||||||||||||| Sbjct: 1020 tagaacccgatccggtcggccaccttgtcgt 990
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 93.7 bits (47), Expect = 5e-16 Identities = 80/91 (87%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 ||||||||||| || ||||||| || |||| || ||| | ||||| |||||||||||| Sbjct: 30372331 tggttgtagcaatccaggttatcgccatagctgacgcccagcatgtcgcagtagcgcttg 30372272 Query: 417 tagaacccgatccggtcggccaccttgtcgt 447 ||||||||||||||||||||||||||||||| Sbjct: 30372271 tagaacccgatccggtcggccaccttgtcgt 30372241 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 30375940 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 30375881 Query: 417 tagaacccgatccggtcggc 436 |||||||| ||||||||||| Sbjct: 30375880 tagaacccaatccggtcggc 30375861
>dbj|AP004685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0017G10 Length = 166700 Score = 93.7 bits (47), Expect = 5e-16 Identities = 80/91 (87%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 ||||||||||| || ||||||| || |||| || ||| | ||||| |||||||||||| Sbjct: 9692 tggttgtagcaatccaggttatcgccatagctgacgcccagcatgtcgcagtagcgcttg 9633 Query: 417 tagaacccgatccggtcggccaccttgtcgt 447 ||||||||||||||||||||||||||||||| Sbjct: 9632 tagaacccgatccggtcggccaccttgtcgt 9602 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 13301 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 13242 Query: 417 tagaacccgatccggtcggc 436 |||||||| ||||||||||| Sbjct: 13241 tagaacccaatccggtcggc 13222
>dbj|AP003685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0548E04 Length = 138037 Score = 93.7 bits (47), Expect = 5e-16 Identities = 80/91 (87%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 ||||||||||| || ||||||| || |||| || ||| | ||||| |||||||||||| Sbjct: 118926 tggttgtagcaatccaggttatcgccatagctgacgcccagcatgtcgcagtagcgcttg 118867 Query: 417 tagaacccgatccggtcggccaccttgtcgt 447 ||||||||||||||||||||||||||||||| Sbjct: 118866 tagaacccgatccggtcggccaccttgtcgt 118836 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 122535 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 122476 Query: 417 tagaacccgatccggtcggc 436 |||||||| ||||||||||| Sbjct: 122475 tagaacccaatccggtcggc 122456
>dbj|AK061280.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-F06, full insert sequence Length = 1169 Score = 93.7 bits (47), Expect = 5e-16 Identities = 80/91 (87%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 ||||||||||| || ||||||| || |||| || ||| | ||||| |||||||||||| Sbjct: 1018 tggttgtagcaatccaggttatcgccatagctgacgcccagcatgtcgcagtagcgcttg 959 Query: 417 tagaacccgatccggtcggccaccttgtcgt 447 ||||||||||||||||||||||||||||||| Sbjct: 958 tagaacccgatccggtcggccaccttgtcgt 928
>dbj|D16223.1|RICCHT3 Oryza sativa (japonica cultivar-group) Cht-3 gene for endochitinase, complete cds Length = 2808 Score = 93.7 bits (47), Expect = 5e-16 Identities = 80/91 (87%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 ||||||||||| || ||||||| || |||| || ||| | ||||| |||||||||||| Sbjct: 2773 tggttgtagcaatccaggttatcgccatagctgacgcccagcatgtcgcagtagcgcttg 2714 Query: 417 tagaacccgatccggtcggccaccttgtcgt 447 ||||||||||||||||||||||||||||||| Sbjct: 2713 tagaacccgatccggtcggccaccttgtcgt 2683
>emb|X15349.1|HVENDCHT Barley (H.vulgare) mRNA for endochitinase Length = 556 Score = 87.7 bits (44), Expect = 3e-14 Identities = 68/76 (89%) Strand = Plus / Minus Query: 361 tgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtaga 420 |||||||||||||||| || |||||||| | ||||| |||||| |||||||||||||| | Sbjct: 517 tgtagcagtcgaggttgttgccgtagccaacgccgaggatgtcgcagtagcgcttgtaaa 458 Query: 421 acccgatccggtcggc 436 |||||||||| ||||| Sbjct: 457 acccgatccgatcggc 442
>gb|U02287.1|HVU02287 Hordeum vulgare cultivar NK1558 chitinase gene, complete cds Length = 1684 Score = 87.7 bits (44), Expect = 3e-14 Identities = 68/76 (89%) Strand = Plus / Minus Query: 361 tgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtaga 420 |||||||||||||||| || |||||||| | ||||| |||||| |||||||||||||| | Sbjct: 1536 tgtagcagtcgaggttgttgccgtagccaacgccgaggatgtcgcagtagcgcttgtaaa 1477 Query: 421 acccgatccggtcggc 436 |||||||||| ||||| Sbjct: 1476 acccgatccgatcggc 1461
>emb|Z29962.1|OSCHITIB O.sativa (PCH6) mRNA for chitinase class I Length = 1100 Score = 85.7 bits (43), Expect = 1e-13 Identities = 43/43 (100%) Strand = Plus / Minus Query: 405 cagtagcgcttgtagaacccgatccggtcggccaccttgtcgt 447 ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 902 cagtagcgcttgtagaacccgatccggtcggccaccttgtcgt 860
>gb|AY973230.1| Triticum aestivum cultivar Sumai 3 class II chitinase gene, complete cds Length = 811 Score = 83.8 bits (42), Expect = 5e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||||||||| | |||||||| | ||||| |||||| |||||||||||| Sbjct: 785 tggttgtagcagtcgaggttgtcgccgtagccaacgccgaggatgtcgcagtagcgcttg 726 Query: 417 tagaacccgatccg 430 || ||||||||||| Sbjct: 725 taaaacccgatccg 712
>gb|AY973229.1| Triticum aestivum cultivar Gamenya class II chitinase gene, complete cds Length = 891 Score = 83.8 bits (42), Expect = 5e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||||||||| | |||||||| | ||||| |||||| |||||||||||| Sbjct: 785 tggttgtagcagtcgaggttgtcgccgtagccaacgccgaggatgtcgcagtagcgcttg 726 Query: 417 tagaacccgatccg 430 || ||||||||||| Sbjct: 725 taaaacccgatccg 712
>dbj|AB051579.1| Secale cereale rscc mRNA for seed chitinase-c, complete cds Length = 1018 Score = 81.8 bits (41), Expect = 2e-12 Identities = 68/77 (88%) Strand = Plus / Minus Query: 360 ttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtag 419 ||||||||||||||||| | |||||||| | ||||| |||||| |||||||||||||| Sbjct: 836 ttgtagcagtcgaggttgtcgccgtagccaacgccgaggatgtcgcagtagcgcttgtaa 777 Query: 420 aacccgatccggtcggc 436 ||||||||||| ||||| Sbjct: 776 aacccgatccgatcggc 760
>dbj|AB029936.1| Triticum aestivum Chi 3 mRNA for chitinase 3, complete cds Length = 1148 Score = 81.8 bits (41), Expect = 2e-12 Identities = 71/81 (87%) Strand = Plus / Minus Query: 356 ttggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgctt 415 ||||||||||||||| ||||| | ||||||| || ||| | || ||| ||||||||||| Sbjct: 996 ttggttgtagcagtccaggttgtcaccgtagctgacgccaaggaggtcgcagtagcgctt 937 Query: 416 gtagaacccgatccggtcggc 436 ||||||||||||||||||||| Sbjct: 936 gtagaacccgatccggtcggc 916
>gb|AC132492.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0605G01, complete sequence Length = 146303 Score = 79.8 bits (40), Expect = 8e-12 Identities = 67/76 (88%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||| ||||||||||||||| |||||||||||||||||| | ||| |||||||||| | Sbjct: 96288 tggtcgtagcagtcgaggttgctcccgtagccgatgccgagcacgtcgcagtagcgctgg 96229 Query: 417 tagaacccgatccggt 432 ||||| |||||||||| Sbjct: 96228 tagaagccgatccggt 96213 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 380 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 107042 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 106986 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||||||||| ||| |||||||||||| | |||||||||||| | Sbjct: 87376 tggttgtagcagtcgaggttgccgccggtgccgatgccgaacgcgccacagtagcgctgg 87317 Query: 417 tagaacccgatccggt 432 ||||| |||||||||| Sbjct: 87316 tagaagccgatccggt 87301
>gb|AY444342.1| Oryza sativa chitinase gene, complete cds Length = 1101 Score = 79.8 bits (40), Expect = 8e-12 Identities = 67/76 (88%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||| ||||||||||||||| |||||||||||||||||| | ||| |||||||||| | Sbjct: 1064 tggtcgtagcagtcgaggttgctcccgtagccgatgccgagcacgtcgcagtagcgctgg 1005 Query: 417 tagaacccgatccggt 432 ||||| |||||||||| Sbjct: 1004 tagaagccgatccggt 989
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 79.8 bits (40), Expect = 8e-12 Identities = 67/76 (88%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||| ||||||||||||||| |||||||||||||||||| | ||| |||||||||| | Sbjct: 19292213 tggtcgtagcagtcgaggttgctcccgtagccgatgccgagcacgtcgcagtagcgctgg 19292154 Query: 417 tagaacccgatccggt 432 ||||| |||||||||| Sbjct: 19292153 tagaagccgatccggt 19292138 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 380 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 19302967 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 19302911 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||||||||| ||| |||||||||||| | |||||||||||| | Sbjct: 19283301 tggttgtagcagtcgaggttgccgccggtgccgatgccgaacgcgccacagtagcgctgg 19283242 Query: 417 tagaacccgatccggt 432 ||||| |||||||||| Sbjct: 19283241 tagaagccgatccggt 19283226
>gb|AF280437.1|AF280437 Secale cereale 31.7 kDa class I endochitinase-antifreeze protein precursor, mRNA, complete cds Length = 1192 Score = 79.8 bits (40), Expect = 8e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||| || || | ||||||| || ||||| || |||||||||||||||| Sbjct: 989 tggttgtagcagtccagattgtggccgtagctgacgccgaggaggtcacagtagcgcttg 930 Query: 417 tagaacccgatccggtcggc 436 ||||||||||| |||||||| Sbjct: 929 tagaacccgattcggtcggc 910
>gb|AY437443.1| Triticum aestivum cultivar Ning 7840 class I chitinase mRNA, complete cds Length = 1121 Score = 79.8 bits (40), Expect = 8e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||| ||||| | ||||||| || ||||| | ||| |||||||||||| Sbjct: 1009 tggttgtagcagtccaggttgtcgccgtagctgacgccgagtaggtcgcagtagcgcttg 950 Query: 417 tagaacccgatccggtcggc 436 |||||||||||||||||||| Sbjct: 949 tagaacccgatccggtcggc 930
>gb|L34211.1|BLYCHI33A Hordeum vulgare chitinase (CHI33) gene, complete cds Length = 1779 Score = 79.8 bits (40), Expect = 8e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||||||||| ||||||||||| ||| | ||||| |||||||||| | Sbjct: 1634 tggttgtagcagtcgaggttgcccccgtagccgacgccaaggatgttgcagtagcgctgg 1575 Query: 417 tagaacccgatccggtcggc 436 ||||| |||||||||||||| Sbjct: 1574 tagaagccgatccggtcggc 1555
>gb|L34210.1|BLYCHI26A Hordeum vulgare chitinase (CHI26) gene, complete cds Length = 3169 Score = 79.8 bits (40), Expect = 8e-12 Identities = 67/76 (88%) Strand = Plus / Minus Query: 361 tgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtaga 420 ||||||| |||||||| || |||||||| | ||||| ||||||||||||||||||||| | Sbjct: 2478 tgtagcaatcgaggttgttgccgtagccaacgccgaggatgtcacagtagcgcttgtaaa 2419 Query: 421 acccgatccggtcggc 436 ||||||| || ||||| Sbjct: 2418 acccgattcgatcggc 2403
>gb|L37289.1|RICCHITA Oryza sativa chitinase mRNA, complete cds Length = 1291 Score = 79.8 bits (40), Expect = 8e-12 Identities = 67/76 (88%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||| ||||||||||||||| |||||||||||||||||| | ||| |||||||||| | Sbjct: 1007 tggtcgtagcagtcgaggttgctcccgtagccgatgccgagcacgtcgcagtagcgctgg 948 Query: 417 tagaacccgatccggt 432 ||||| |||||||||| Sbjct: 947 tagaagccgatccggt 932
>gb|M62904.1|BLYCHI H.vulgare L. 26kD chitinase mRNA, complete cds Length = 998 Score = 79.8 bits (40), Expect = 8e-12 Identities = 67/76 (88%) Strand = Plus / Minus Query: 361 tgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtaga 420 ||||||| |||||||| || |||||||| | ||||| ||||||||||||||||||||| | Sbjct: 841 tgtagcaatcgaggttgttgccgtagccaacgccgaggatgtcacagtagcgcttgtaaa 782 Query: 421 acccgatccggtcggc 436 ||||||| || ||||| Sbjct: 781 acccgattcgatcggc 766
>gb|AF000964.1|AF000964 Poa pratensis chitinase (Chi1) gene, complete cds Length = 1252 Score = 77.8 bits (39), Expect = 3e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 359 gttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgta 418 |||||||||||| ||||| | ||||||| || ||||| || ||| |||||||||||||| Sbjct: 975 gttgtagcagtccaggttgtctccgtagctgacgccgaggaggtcgcagtagcgcttgta 916 Query: 419 gaacccgatccggtc 433 ||||||||||||||| Sbjct: 915 gaacccgatccggtc 901 Score = 48.1 bits (24), Expect = 0.027 Identities = 36/40 (90%) Strand = Plus / Minus Query: 449 ctgccccttgccgcattcgatcccgccattgatgacgttg 488 |||||| |||||||| |||| |||||||||||||| |||| Sbjct: 879 ctgccctttgccgcactcgagcccgccattgatgatgttg 840
>gb|L40336.1|RICCHITB Oryza sativa chitinase (Rcht2) gene, complete cds Length = 5595 Score = 75.8 bits (38), Expect = 1e-10 Identities = 68/78 (87%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||||||||| |||||||||| |||||| ||||| |||||||||||| Sbjct: 4846 tggttgtagcagtcgaggttgctcccgtagcctgtgccgagcatgtcgcagtagcgcttg 4787 Query: 417 tagaacccgatccggtcg 434 ||| | ||||| |||||| Sbjct: 4786 tagtagccgatgcggtcg 4769
>gb|L40338.1|RICRCH0 Oryza sativa (clone RCH08) chitinase (Rcht2) mRNA, 3' end of cds Length = 652 Score = 75.8 bits (38), Expect = 1e-10 Identities = 68/78 (87%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||||||||| |||||||||| |||||| ||||| |||||||||||| Sbjct: 509 tggttgtagcagtcgaggttgctcccgtagcctgtgccgagcatgtcgcagtagcgcttg 450 Query: 417 tagaacccgatccggtcg 434 ||| | ||||| |||||| Sbjct: 449 tagtagccgatgcggtcg 432
>gb|AF013580.1|AF013580 Oryza sativa clone RGCH8 chitinase gene, complete cds Length = 2730 Score = 75.8 bits (38), Expect = 1e-10 Identities = 68/78 (87%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||||||||| |||||||||| |||||| ||||| |||||||||||| Sbjct: 2296 tggttgtagcagtcgaggttgctcccgtagcctgtgccgagcatgtcgcagtagcgcttg 2237 Query: 417 tagaacccgatccggtcg 434 ||| | ||||| |||||| Sbjct: 2236 tagtagccgatgcggtcg 2219
>gb|AF001500.1|OSAF001500 Oryza sativa clone MIRCH1 chitinase mRNA, partial cds Length = 913 Score = 75.8 bits (38), Expect = 1e-10 Identities = 68/78 (87%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||||||||| |||||||||| |||||| ||||| |||||||||||| Sbjct: 756 tggttgtagcagtcgaggttgctcccgtagcctgtgccgagcatgtcgcagtagcgcttg 697 Query: 417 tagaacccgatccggtcg 434 ||| | ||||| |||||| Sbjct: 696 tagtagccgatgcggtcg 679
>gb|AY997529.2| Musa x paradisiaca chitinase (Chi-1) mRNA, complete cds Length = 1082 Score = 71.9 bits (36), Expect = 2e-09 Identities = 51/56 (91%) Strand = Plus / Minus Query: 381 ccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| Sbjct: 981 ccgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggc 926
>gb|L40337.1|RICRCH1 Oryza sativa chitinase (Rcht1) mRNA, complete cds Length = 1204 Score = 71.9 bits (36), Expect = 2e-09 Identities = 66/76 (86%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||| ||||||||||||||| |||||||||||||||||| | || |||||||||| | Sbjct: 971 tggtcgtagcagtcgaggttgctcccgtagccgatgccgagcacgttgcagtagcgctgg 912 Query: 417 tagaacccgatccggt 432 ||||| |||||||||| Sbjct: 911 tagaagccgatccggt 896
>ref|XM_468715.1| Oryza sativa (japonica cultivar-group), mRNA Length = 981 Score = 69.9 bits (35), Expect = 7e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 382 cgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 436 |||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| Sbjct: 937 cgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggc 883
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 69.9 bits (35), Expect = 7e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 382 cgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 436 |||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| Sbjct: 17204043 cgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggc 17203989
>gb|AC145386.1| Oryza sativa chromosome 3 BAC OSJNBb0028K20 genomic sequence, complete sequence Length = 115326 Score = 69.9 bits (35), Expect = 7e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 382 cgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 436 |||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| Sbjct: 36787 cgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggc 36733
>gb|AC137992.2| Oryza sativa chromosome 3 BAC OSJNBb0056B16 genomic sequence, complete sequence Length = 153247 Score = 69.9 bits (35), Expect = 7e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 382 cgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 436 |||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| Sbjct: 95436 cgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggc 95382
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 69.9 bits (35), Expect = 7e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 382 cgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 436 |||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| Sbjct: 17197612 cgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggc 17197558
>gb|AY106654.1| Zea mays PCO078819 mRNA sequence Length = 574 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Plus Query: 379 tcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcgg 435 ||||||||||||||| ||||| || ||||||||||||||||| || |||||||||| Sbjct: 229 tcccgtagccgatgcggaagacatcgcagtagcgcttgtagaagccaatccggtcgg 285
>gb|AY378172.1| Oryza sativa (japonica cultivar-group) OsmChiI-34 mRNA, partial cds Length = 894 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 890 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 831 Query: 417 tagaacccgatccggtcggc 436 |||||||| ||||||||||| Sbjct: 830 tagaacccaatccggtcggc 811
>emb|Z78202.1|PACHI1 Persea americana mRNA for endochitinase Length = 1120 Score = 63.9 bits (32), Expect = 5e-07 Identities = 74/88 (84%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggccaccttgtcgttctgccccttgcc 460 ||||||||| | ||||||||| || || ||||| ||||||||||| || |||||||| Sbjct: 922 gtcacagtacctcttgtagaagccaatgcggtctgccaccttgtcattgaatcccttgcc 863 Query: 461 gcattcgatcccgccattgatgacgttg 488 |||||||||||| || ||||||| |||| Sbjct: 862 gcattcgatcccaccgttgatgatgttg 835
>emb|Z29961.1|OSCHITIA O.sativa (PCH16) mRNA for chitinase class I Length = 1159 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 1073 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 1014 Query: 417 tagaacccgatccggtcggc 436 |||||||| ||||||||||| Sbjct: 1013 tagaacccaatccggtcggc 994
>emb|X87109.1|OSDNARC24 O.sativa RC24 gene Length = 2048 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 2006 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 1947 Query: 417 tagaacccgatccggtcggc 436 |||||||| ||||||||||| Sbjct: 1946 tagaacccaatccggtcggc 1927
>emb|X76041.1|TACHIG T.aestivum (Chinese spring) chi gene for endochitinase Length = 1985 Score = 63.9 bits (32), Expect = 5e-07 Identities = 32/32 (100%) Strand = Plus / Minus Query: 405 cagtagcgcttgtagaacccgatccggtcggc 436 |||||||||||||||||||||||||||||||| Sbjct: 1531 cagtagcgcttgtagaacccgatccggtcggc 1500
>emb|X56063.1|OSENDO O.sativa mRNA for endochitinase Length = 1160 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 905 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 846 Query: 417 tagaacccgatccggtcggc 436 |||||||| ||||||||||| Sbjct: 845 tagaacccaatccggtcggc 826
>dbj|AK105798.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-A08, full insert sequence Length = 1141 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 1010 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 951 Query: 417 tagaacccgatccggtcggc 436 |||||||| ||||||||||| Sbjct: 950 tagaacccaatccggtcggc 931
>dbj|AK104020.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-008-C04, full insert sequence Length = 1136 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 1005 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 946 Query: 417 tagaacccgatccggtcggc 436 |||||||| ||||||||||| Sbjct: 945 tagaacccaatccggtcggc 926
>dbj|AK099339.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033028I21, full insert sequence Length = 1174 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 986 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 927 Query: 417 tagaacccgatccggtcggc 436 |||||||| ||||||||||| Sbjct: 926 tagaacccaatccggtcggc 907
>dbj|AK061042.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-D05, full insert sequence Length = 1217 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 1008 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 949 Query: 417 tagaacccgatccggtcggc 436 |||||||| ||||||||||| Sbjct: 948 tagaacccaatccggtcggc 929
>dbj|D16221.1|RICCHT1 Oryza sativa (japonica cultivar-group) Cht-1 gene for endochitinase, complete cds Length = 2739 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 2270 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 2211 Query: 417 tagaacccgatccggtcggc 436 |||||||| ||||||||||| Sbjct: 2210 tagaacccaatccggtcggc 2191
>ref|NM_197596.1| Oryza sativa (japonica cultivar-group) chitinase (OSJNBb0015I11.14), mRNA Length = 924 Score = 60.0 bits (30), Expect = 7e-06 Identities = 66/78 (84%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||||||||| | |||||||| ||||| ||||| |||||||||||| Sbjct: 767 tggttgtagcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttg 708 Query: 417 tagaacccgatccggtcg 434 ||| | ||||| |||||| Sbjct: 707 tagtagccgatgcggtcg 690
>gb|AC051633.7| Oryza sativa chromosome 10 BAC OSJNBb0015I11 genomic sequence, complete sequence Length = 138824 Score = 60.0 bits (30), Expect = 7e-06 Identities = 66/78 (84%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||||||||| | |||||||| ||||| ||||| |||||||||||| Sbjct: 89608 tggttgtagcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttg 89549 Query: 417 tagaacccgatccggtcg 434 ||| | ||||| |||||| Sbjct: 89548 tagtagccgatgcggtcg 89531 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggtt 376 |||||||||||||||||||| Sbjct: 104334 tggttgtagcagtcgaggtt 104315 Score = 40.1 bits (20), Expect = 6.6 Identities = 32/36 (88%) Strand = Plus / Minus Query: 399 atgtcacagtagcgcttgtagaacccgatccggtcg 434 ||||| ||||||||||||||| | ||||| |||||| Sbjct: 104292 atgtcgcagtagcgcttgtagtagccgatgcggtcg 104257
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 60.0 bits (30), Expect = 7e-06 Identities = 66/78 (84%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||||||||| | |||||||| ||||| ||||| |||||||||||| Sbjct: 20688156 tggttgtagcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttg 20688097 Query: 417 tagaacccgatccggtcg 434 ||| | ||||| |||||| Sbjct: 20688096 tagtagccgatgcggtcg 20688079 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggtt 376 |||||||||||||||||||| Sbjct: 20702882 tggttgtagcagtcgaggtt 20702863 Score = 40.1 bits (20), Expect = 6.6 Identities = 32/36 (88%) Strand = Plus / Minus Query: 399 atgtcacagtagcgcttgtagaacccgatccggtcg 434 ||||| ||||||||||||||| | ||||| |||||| Sbjct: 20702840 atgtcgcagtagcgcttgtagtagccgatgcggtcg 20702805
>dbj|AK070067.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023042L15, full insert sequence Length = 1073 Score = 60.0 bits (30), Expect = 7e-06 Identities = 66/78 (84%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||||||||| | |||||||| ||||| ||||| |||||||||||| Sbjct: 793 tggttgtagcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttg 734 Query: 417 tagaacccgatccggtcg 434 ||| | ||||| |||||| Sbjct: 733 tagtagccgatgcggtcg 716
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 60.0 bits (30), Expect = 7e-06 Identities = 66/78 (84%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||||||||| | |||||||| ||||| ||||| |||||||||||| Sbjct: 20699428 tggttgtagcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttg 20699369 Query: 417 tagaacccgatccggtcg 434 ||| | ||||| |||||| Sbjct: 20699368 tagtagccgatgcggtcg 20699351 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggtt 376 |||||||||||||||||||| Sbjct: 20714154 tggttgtagcagtcgaggtt 20714135 Score = 40.1 bits (20), Expect = 6.6 Identities = 32/36 (88%) Strand = Plus / Minus Query: 399 atgtcacagtagcgcttgtagaacccgatccggtcg 434 ||||| ||||||||||||||| | ||||| |||||| Sbjct: 20714112 atgtcgcagtagcgcttgtagtagccgatgcggtcg 20714077
>dbj|AB016497.1| Oryza sativa mRNA for chitinase, complete cds Length = 923 Score = 60.0 bits (30), Expect = 7e-06 Identities = 66/78 (84%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||||||||| | |||||||| ||||| ||||| |||||||||||| Sbjct: 773 tggttgtagcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttg 714 Query: 417 tagaacccgatccggtcg 434 ||| | ||||| |||||| Sbjct: 713 tagtagccgatgcggtcg 696
>gb|AC135418.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0035J16, complete sequence Length = 170233 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 380 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 6316 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 6260
>dbj|AK071196.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086B11, full insert sequence Length = 1305 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 380 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 1029 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 973
>dbj|AB096139.1| Oryza sativa (japonica cultivar-group) Chia1d mRNA for chitinase, complete cds Length = 1285 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 380 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 1016 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 960
>dbj|AB012855.1| Oryza sativa mRNA for chitinase, complete cds Length = 1300 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 380 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 1031 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 975
>dbj|AB018248.1| Oryza sativa (indica cultivar-group) mRNA for chitinase, complete cds Length = 1280 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 380 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 1005 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 949
>emb|X56787.1|OSLMRNAC O.sativa L. mRNA for endochitinase Length = 1186 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||||||||| ||| |||||||||||| | |||||||||||| | Sbjct: 986 tggttgtagcagtcgaggttgccgccggtgccgatgccgaacgcgccacagtagcgctgg 927 Query: 417 tagaacccgatccggt 432 ||||| |||||||||| Sbjct: 926 tagaagccgatccggt 911
>dbj|AK108949.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-153-C03, full insert sequence Length = 979 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||||||||| ||| |||||||||||| | |||||||||||| | Sbjct: 651 tggttgtagcagtcgaggttgccgccggtgccgatgccgaacgcgccacagtagcgctgg 592 Query: 417 tagaacccgatccggt 432 ||||| |||||||||| Sbjct: 591 tagaagccgatccggt 576
>dbj|D16222.1|RICCHT2 Oryza sativa (japonica cultivar-group) Cht-2 gene for endochitinase, complete cds Length = 2986 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||||||||| ||| |||||||||||| | |||||||||||| | Sbjct: 2421 tggttgtagcagtcgaggttgccgccggtgccgatgccgaacgcgccacagtagcgctgg 2362 Query: 417 tagaacccgatccggt 432 ||||| |||||||||| Sbjct: 2361 tagaagccgatccggt 2346
>gb|AY532766.1| Zea diploperennis isolate d8 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532765.1| Zea diploperennis isolate d7 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532764.1| Zea diploperennis isolate d6 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532763.1| Zea diploperennis isolate d5 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532762.1| Zea diploperennis isolate d5b chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532761.1| Zea diploperennis isolate d4 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532760.1| Zea diploperennis isolate d3 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532759.1| Zea diploperennis isolate d2 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532758.1| Zea diploperennis isolate d1 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532757.1| Zea mays subsp. parviglumis isolate p15 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532756.1| Zea mays subsp. parviglumis isolate p14b chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532755.1| Zea mays subsp. parviglumis isolate p14 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532754.1| Zea mays subsp. parviglumis isolate p13b chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532753.1| Zea mays subsp. parviglumis isolate p13 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532752.1| Zea mays subsp. parviglumis isolate p12 chitinase (chiI) gene, complete cds Length = 1082 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532751.1| Zea mays subsp. parviglumis isolate p11 chitinase (chiI) gene, complete cds Length = 1081 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 906 gtcacagtatcgtttgtagaagccgatccggtcggc 871
>gb|AY532750.1| Zea mays subsp. parviglumis isolate p9 chitinase (chiI) gene, complete cds Length = 1084 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 909 gtcacagtatcgtttgtagaagccgatccggtcggc 874
>gb|AY532749.1| Zea mays subsp. parviglumis isolate p8 chitinase (chiI) gene, complete cds Length = 1081 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 906 gtcacagtatcgtttgtagaagccgatccggtcggc 871
>gb|AY532748.1| Zea mays subsp. parviglumis isolate p6 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532747.1| Zea mays subsp. parviglumis isolate p5 chitinase (chiI) gene, complete cds Length = 1089 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 906 gtcacagtatcgtttgtagaagccgatccggtcggc 871
>gb|AY532746.1| Zea mays subsp. parviglumis isolate p4 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532745.1| Zea mays subsp. parviglumis isolate p3 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532744.1| Zea mays subsp. parviglumis isolate p2 chitinase (chiI) gene, complete cds Length = 1087 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532743.1| Zea mays subsp. parviglumis isolate p1 chitinase (chiI) gene, complete cds Length = 1081 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 906 gtcacagtatcgtttgtagaagccgatccggtcggc 871
>dbj|AB051578.1| Secale cereale rsca mRNA for seed chitinase-a, complete cds Length = 1191 Score = 48.1 bits (24), Expect = 0.027 Identities = 66/80 (82%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||| ||||||||||| || || ||||| | | | |||||| |||||||||||| Sbjct: 1007 tggttgtaacagtcgaggttgttgccatagccaacacgaaggatgtcgcagtagcgcttg 948 Query: 417 tagaacccgatccggtcggc 436 || |||||||| || ||||| Sbjct: 947 taaaacccgattcgatcggc 928
>gb|L00973.1|MZECHITC Zea mays acidic class I chitinase mRNA, complete cds Length = 1128 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 401 gtcacagtagcgcttgtagaacccgatccggtcggc 436 ||||||||| || |||||||| |||||||||||||| Sbjct: 921 gtcacagtatcgtttgtagaagccgatccggtcggc 886
>gb|AC146189.3| Pan troglodytes BAC clone CH251-490L21 from Y, complete sequence Length = 180597 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 275 cacatccacacacgcacatgcat 297 ||||||||||||||||||||||| Sbjct: 119650 cacatccacacacgcacatgcat 119628
>gb|AC140850.20| Medicago truncatula clone mth2-11i23, complete sequence Length = 138846 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 270 atcatcacatccacacacgcacatgca 296 |||||||||||| |||||||||||||| Sbjct: 130057 atcatcacatccccacacgcacatgca 130031
>gb|AC167968.5| Culex pipiens quinquefasciatus, clone Culex pipiens quinquefasciatus-3940121D9, complete sequence Length = 108830 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Plus Query: 458 gccgcattcgatcccgccattgatgacgttg 488 |||||| ||||| |||||||||||||||||| Sbjct: 73169 gccgcactcgatgccgccattgatgacgttg 73199
>dbj|BS000612.1| Pan troglodytes chromosome Y clone:PTBY-009O17, complete sequences Length = 80000 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 275 cacatccacacacgcacatgcat 297 ||||||||||||||||||||||| Sbjct: 64086 cacatccacacacgcacatgcat 64108
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence Length = 23952694 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 275 cacatccacacacgcacatgcat 297 ||||||||||||||||||||||| Sbjct: 23891747 cacatccacacacgcacatgcat 23891725
>gb|AC154093.1| Homo sapiens chromosome 13 clone fa0790, complete sequence Length = 37001 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 cacatccacacacgcacatgca 296 |||||||||||||||||||||| Sbjct: 36335 cacatccacacacgcacatgca 36356
>gb|AC124684.3| Mus musculus BAC clone RP24-375D13 from chromosome 1, complete sequence Length = 167927 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 276 acatccacacacgcacatgcat 297 |||||||||||||||||||||| Sbjct: 115354 acatccacacacgcacatgcat 115375
>emb|CR733892.2|CNS0GT1V Tetraodon nigroviridis full-length cDNA Length = 1579 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 467 gatcccgccattgatgacgttg 488 |||||||||||||||||||||| Sbjct: 553 gatcccgccattgatgacgttg 532
>emb|AL359649.8| Human DNA sequence from clone RP11-65D24 on chromosome 13 Contains 2 novel genes, complete sequence Length = 144792 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 cacatccacacacgcacatgca 296 |||||||||||||||||||||| Sbjct: 109684 cacatccacacacgcacatgca 109663
>gb|AC153149.4| Mus musculus BAC clone RP23-176O2 from chromosome 3, complete sequence Length = 206540 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 cacatccacacacgcacatgca 296 |||||||||||||||||||||| Sbjct: 146384 cacatccacacacgcacatgca 146405
>gb|AC084760.2| Gallus gallus clone WAG-65N20, complete sequence Length = 109569 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 226 tatttggtcataaaatacttac 247 |||||||||||||||||||||| Sbjct: 23660 tatttggtcataaaatacttac 23639
>gb|AC019306.10| Homo sapiens chromosome 18, clone RP11-326M20, complete sequence Length = 175840 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 275 cacatccacacacgcacatgcataaa 300 ||||| |||||||||||||||||||| Sbjct: 137699 cacatacacacacgcacatgcataaa 137724
>gb|AC153644.3| Mus musculus BAC clone RP24-531A1 from 1, complete sequence Length = 166988 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 276 acatccacacacgcacatgcat 297 |||||||||||||||||||||| Sbjct: 15411 acatccacacacgcacatgcat 15432
>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome Length = 7215267 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 458 gccgcattcgatcccgccattgatga 483 |||||||||||| ||||||||||||| Sbjct: 1140779 gccgcattcgatgccgccattgatga 1140754
>gb|AC140314.2| Mus musculus BAC clone RP23-395L3 from chromosome 12, complete sequence Length = 191322 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 95 ttgcagtcgtctctgcataaa 115 ||||||||||||||||||||| Sbjct: 155982 ttgcagtcgtctctgcataaa 155962
>emb|AL591393.10| Human DNA sequence from clone RP11-224J22 on chromosome 9 Contains a novel gene (FLJ33868) and 2 CpG islands, complete sequence Length = 174911 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 238 aaatacttaccaagattatttattt 262 |||||||||||||| |||||||||| Sbjct: 80594 aaatacttaccaagtttatttattt 80570
>emb|BX322565.11| Zebrafish DNA sequence from clone CH211-262K18 in linkage group 24, complete sequence Length = 158981 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 274 tcacatccacacacgcacatgcata 298 |||||| |||||||||||||||||| Sbjct: 125189 tcacatacacacacgcacatgcata 125165
>emb|BX294098.11| Zebrafish DNA sequence from clone CH211-254P12 in linkage group 24, complete sequence Length = 152545 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 274 tcacatccacacacgcacatgcata 298 |||||| |||||||||||||||||| Sbjct: 66156 tcacatacacacacgcacatgcata 66180
>gb|AC155311.2| Mus musculus BAC clone RP23-407F7 from chromosome 12, complete sequence Length = 166104 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 95 ttgcagtcgtctctgcataaa 115 ||||||||||||||||||||| Sbjct: 148650 ttgcagtcgtctctgcataaa 148670
>emb|BX294095.13| Zebrafish DNA sequence from clone CH211-248L17 in linkage group 24, complete sequence Length = 147604 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 274 tcacatccacacacgcacatgcata 298 |||||| |||||||||||||||||| Sbjct: 105496 tcacatacacacacgcacatgcata 105472
>gb|L16798.1|MZECHITINA Zea mays class I acidic chitinase mRNA, partial cds Length = 1012 Score = 42.1 bits (21), Expect = 1.7 Identities = 90/113 (79%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 416 |||||||||||||| | ||| | ||||||| |||||| | |||||| ||||||| || Sbjct: 776 tggttgtagcagtccaagttgtcgccgtagctgatgccaaggatgtcgcagtagctggtg 717 Query: 417 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgat 469 ||||| | |||||| ||||||||| ||||| | || |||||||| ||||| Sbjct: 716 tagaagaaggtccggttggccaccttctcgttgtagcctttgccgcactcgat 664
>ref|NM_197598.1| Oryza sativa (japonica cultivar-group) putative chitinase (OSJNBb0015I11.16), mRNA Length = 891 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 357 tggttgtagcagtcgaggtt 376 |||||||||||||||||||| Sbjct: 863 tggttgtagcagtcgaggtt 844 Score = 40.1 bits (20), Expect = 6.6 Identities = 32/36 (88%) Strand = Plus / Minus Query: 399 atgtcacagtagcgcttgtagaacccgatccggtcg 434 ||||| ||||||||||||||| | ||||| |||||| Sbjct: 821 atgtcgcagtagcgcttgtagtagccgatgcggtcg 786
>gb|AC166486.5| Mus musculus chromosome 1, clone RP23-187M9, complete sequence Length = 187098 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 221 ccatttatttggtcataaaa 240 |||||||||||||||||||| Sbjct: 13104 ccatttatttggtcataaaa 13085
>gb|AC131725.2| Mus musculus BAC clone RP23-129H16 from chromosome 5, complete sequence Length = 203437 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 275 cacatccacacacgcacatgcata 298 ||||| |||||||||||||||||| Sbjct: 10245 cacatacacacacgcacatgcata 10268
>gb|AC124374.5| Mus musculus BAC clone RP24-567K8 from chromosome 5, complete sequence Length = 181395 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 275 cacatccacacacgcacatgcata 298 ||||| |||||||||||||||||| Sbjct: 177006 cacatacacacacgcacatgcata 176983
>gb|AC069288.7| Homo sapiens BAC clone RP11-416J17 from 7, complete sequence Length = 145709 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 275 cacatccacacacgcacatg 294 |||||||||||||||||||| Sbjct: 136461 cacatccacacacgcacatg 136480
>emb|BX901895.15| Zebrafish DNA sequence from clone CH211-218C11 in linkage group 7, complete sequence Length = 208436 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 aatatgtttataataaaagg 139 |||||||||||||||||||| Sbjct: 125720 aatatgtttataataaaagg 125739
>emb|CR931785.6| Zebrafish DNA sequence from clone DKEY-230N5 in linkage group 7, complete sequence Length = 196531 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 aatatgtttataataaaagg 139 |||||||||||||||||||| Sbjct: 145929 aatatgtttataataaaagg 145948
>emb|CR735059.2|CNS0GTYA Tetraodon nigroviridis full-length cDNA Length = 1566 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>gb|AC121591.4| Mus musculus BAC clone RP23-289H3 from 1, complete sequence Length = 195393 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 221 ccatttatttggtcataaaa 240 |||||||||||||||||||| Sbjct: 12989 ccatttatttggtcataaaa 13008
>emb|CR933541.6| Mouse DNA sequence from clone DN-97M20 on chromosome 11, complete sequence Length = 176646 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 275 cacatccacacacgcacatgcata 298 ||||| |||||||||||||||||| Sbjct: 66957 cacatgcacacacgcacatgcata 66934
>emb|CR735005.2|CNS0GTWS Tetraodon nigroviridis full-length cDNA Length = 1561 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR734871.2|CNS0GTT2 Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 544 tcccgccattgatgacgttg 525
>emb|CR734832.2|CNS0GTRZ Tetraodon nigroviridis full-length cDNA Length = 1567 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 550 tcccgccattgatgacgttg 531
>emb|CR734821.2|CNS0GTRO Tetraodon nigroviridis full-length cDNA Length = 1526 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 532 tcccgccattgatgacgttg 513
>emb|CR734784.2|CNS0GTQN Tetraodon nigroviridis full-length cDNA Length = 1557 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR734271.2|CNS0GTCE Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 542 tcccgccattgatgacgttg 523
>emb|CR734258.2|CNS0GTC1 Tetraodon nigroviridis full-length cDNA Length = 1567 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR734222.2|CNS0GTB1 Tetraodon nigroviridis full-length cDNA Length = 1470 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 447 tcccgccattgatgacgttg 428
>emb|CR734221.2|CNS0GTB0 Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 543 tcccgccattgatgacgttg 524
>emb|CR734121.2|CNS0GT88 Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR660465.2|CNS0F8L3 Tetraodon nigroviridis full-length cDNA Length = 1549 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR734099.2|CNS0GT7M Tetraodon nigroviridis full-length cDNA Length = 1572 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 550 tcccgccattgatgacgttg 531
>emb|CR734078.2|CNS0GT71 Tetraodon nigroviridis full-length cDNA Length = 1472 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 450 tcccgccattgatgacgttg 431
>emb|CR734011.2|CNS0GT56 Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR733956.2|CNS0GT3N Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR733647.2|CNS0GSV2 Tetraodon nigroviridis full-length cDNA Length = 1578 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 556 tcccgccattgatgacgttg 537
>emb|CR733499.2|CNS0GSQY Tetraodon nigroviridis full-length cDNA Length = 1571 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 557 tcccgccattgatgacgttg 538
>emb|CR733422.2|CNS0GSOW Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR733844.2|CNS0GT0J Tetraodon nigroviridis full-length cDNA Length = 1566 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR733835.2|CNS0GT0A Tetraodon nigroviridis full-length cDNA Length = 1565 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR733710.2|CNS0GSWT Tetraodon nigroviridis full-length cDNA Length = 1553 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR733648.2|CNS0GSV3 Tetraodon nigroviridis full-length cDNA Length = 1546 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 523 tcccgccattgatgacgttg 504
>emb|CR733358.2|CNS0GSNX Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR733481.1|CNS0GSQG Tetraodon nigroviridis full-length cDNA Length = 1527 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 531 tcccgccattgatgacgttg 512
>emb|CR733235.2|CNS0GSM1 Tetraodon nigroviridis full-length cDNA Length = 1579 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 557 tcccgccattgatgacgttg 538
>emb|CR733200.2|CNS0GSLG Tetraodon nigroviridis full-length cDNA Length = 1522 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 532 tcccgccattgatgacgttg 513
>emb|CR732950.2|CNS0GSGO Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR732939.2|CNS0GSGE Tetraodon nigroviridis full-length cDNA Length = 1540 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR732821.2|CNS0GSDN Tetraodon nigroviridis full-length cDNA Length = 1563 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR733142.1|CNS0GSKK Tetraodon nigroviridis full-length cDNA Length = 1544 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 538 tcccgccattgatgacgttg 519
>emb|CR732987.1|CNS0GSHK Tetraodon nigroviridis full-length cDNA Length = 1547 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 549 tcccgccattgatgacgttg 530
>emb|CR732771.2|CNS0GSCH Tetraodon nigroviridis full-length cDNA Length = 1570 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR732486.2|CNS0GS4R Tetraodon nigroviridis full-length cDNA Length = 1569 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR732720.1|CNS0GSB8 Tetraodon nigroviridis full-length cDNA Length = 1547 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 541 tcccgccattgatgacgttg 522
>emb|CR732153.2|CNS0GRVI Tetraodon nigroviridis full-length cDNA Length = 1563 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 541 tcccgccattgatgacgttg 522
>emb|CR732143.2|CNS0GRV8 Tetraodon nigroviridis full-length cDNA Length = 1635 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 535 tcccgccattgatgacgttg 516
>emb|CR732095.2|CNS0GRTW Tetraodon nigroviridis full-length cDNA Length = 1572 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 549 tcccgccattgatgacgttg 530
>emb|CR731975.2|CNS0GRQK Tetraodon nigroviridis full-length cDNA Length = 1565 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR731884.2|CNS0GRO1 Tetraodon nigroviridis full-length cDNA Length = 1376 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 452 tcccgccattgatgacgttg 433
>emb|CR731882.2|CNS0GRNZ Tetraodon nigroviridis full-length cDNA Length = 1560 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 541 tcccgccattgatgacgttg 522
>emb|CR731865.2|CNS0GRNI Tetraodon nigroviridis full-length cDNA Length = 1567 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR731820.2|CNS0GRM9 Tetraodon nigroviridis full-length cDNA Length = 1565 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 542 tcccgccattgatgacgttg 523
>emb|CR731792.2|CNS0GRLH Tetraodon nigroviridis full-length cDNA Length = 1566 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 537 tcccgccattgatgacgttg 518
>emb|CR731776.2|CNS0GRL1 Tetraodon nigroviridis full-length cDNA Length = 1497 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 517 tcccgccattgatgacgttg 498
>emb|CR731855.1|CNS0GRN8 Tetraodon nigroviridis full-length cDNA Length = 1538 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 528 tcccgccattgatgacgttg 509
>emb|CR731713.2|CNS0GRJA Tetraodon nigroviridis full-length cDNA Length = 1546 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR731699.2|CNS0GRIW Tetraodon nigroviridis full-length cDNA Length = 1565 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR731639.2|CNS0GRH8 Tetraodon nigroviridis full-length cDNA Length = 1556 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 544 tcccgccattgatgacgttg 525
>emb|CR731638.2|CNS0GRH7 Tetraodon nigroviridis full-length cDNA Length = 1543 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 535 tcccgccattgatgacgttg 516
>emb|CR731604.2|CNS0GRG9 Tetraodon nigroviridis full-length cDNA Length = 1563 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 541 tcccgccattgatgacgttg 522
>emb|CR731584.2|CNS0GRFP Tetraodon nigroviridis full-length cDNA Length = 1531 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR731508.2|CNS0GRDL Tetraodon nigroviridis full-length cDNA Length = 1560 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 536 tcccgccattgatgacgttg 517
>emb|CR731430.2|CNS0GRBF Tetraodon nigroviridis full-length cDNA Length = 1584 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 559 tcccgccattgatgacgttg 540
>emb|CR731429.2|CNS0GRBE Tetraodon nigroviridis full-length cDNA Length = 1583 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 560 tcccgccattgatgacgttg 541
>emb|CR731340.2|CNS0GR8X Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR731328.2|CNS0GR8L Tetraodon nigroviridis full-length cDNA Length = 1550 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR731318.2|CNS0GR8B Tetraodon nigroviridis full-length cDNA Length = 1551 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 530 tcccgccattgatgacgttg 511
>emb|CR731270.2|CNS0GR6Z Tetraodon nigroviridis full-length cDNA Length = 1582 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 560 tcccgccattgatgacgttg 541
>emb|CR731093.2|CNS0GR22 Tetraodon nigroviridis full-length cDNA Length = 1567 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR731045.2|CNS0GR0Q Tetraodon nigroviridis full-length cDNA Length = 1541 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 535 tcccgccattgatgacgttg 516
>emb|CR730981.2|CNS0GQYY Tetraodon nigroviridis full-length cDNA Length = 1547 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 536 tcccgccattgatgacgttg 517
>emb|CR730926.2|CNS0GQXF Tetraodon nigroviridis full-length cDNA Length = 1555 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 532 tcccgccattgatgacgttg 513
>emb|CR730776.1|CNS0GQT9 Tetraodon nigroviridis full-length cDNA Length = 1537 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 532 tcccgccattgatgacgttg 513
>emb|CR730498.2|CNS0GQLJ Tetraodon nigroviridis full-length cDNA Length = 1572 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 552 tcccgccattgatgacgttg 533
>emb|CR730495.2|CNS0GQLG Tetraodon nigroviridis full-length cDNA Length = 1575 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 556 tcccgccattgatgacgttg 537
>emb|CR730296.2|CNS0GQFX Tetraodon nigroviridis full-length cDNA Length = 1565 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR730281.2|CNS0GQFI Tetraodon nigroviridis full-length cDNA Length = 1539 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR730218.2|CNS0GQDS Tetraodon nigroviridis full-length cDNA Length = 1534 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR730207.2|CNS0GQDH Tetraodon nigroviridis full-length cDNA Length = 1461 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 512 tcccgccattgatgacgttg 493
>emb|CR730659.1|CNS0GQQ0 Tetraodon nigroviridis full-length cDNA Length = 1555 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 542 tcccgccattgatgacgttg 523
>emb|CR730347.1|CNS0GQHC Tetraodon nigroviridis full-length cDNA Length = 1549 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 540 tcccgccattgatgacgttg 521
>emb|CR730270.1|CNS0GQF7 Tetraodon nigroviridis full-length cDNA Length = 1538 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR730047.3|CNS0GQ91 Tetraodon nigroviridis full-length cDNA Length = 1262 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 261 tcccgccattgatgacgttg 242
>emb|CR730165.2|CNS0GQCB Tetraodon nigroviridis full-length cDNA Length = 1550 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 536 tcccgccattgatgacgttg 517
>emb|CR730154.2|CNS0GQC0 Tetraodon nigroviridis full-length cDNA Length = 1567 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR730151.2|CNS0GQBX Tetraodon nigroviridis full-length cDNA Length = 1345 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 325 tcccgccattgatgacgttg 306
>emb|CR730122.2|CNS0GQB4 Tetraodon nigroviridis full-length cDNA Length = 1559 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 540 tcccgccattgatgacgttg 521
>emb|CR730115.2|CNS0GQAX Tetraodon nigroviridis full-length cDNA Length = 1406 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 385 tcccgccattgatgacgttg 366
>emb|CR729994.2|CNS0GQ7K Tetraodon nigroviridis full-length cDNA Length = 1567 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR729808.2|CNS0GQ2E Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR730182.1|CNS0GQCS Tetraodon nigroviridis full-length cDNA Length = 1508 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 520 tcccgccattgatgacgttg 501
>emb|CR729680.2|CNS0GPYU Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR729602.2|CNS0GPWO Tetraodon nigroviridis full-length cDNA Length = 1542 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR729505.2|CNS0GPTZ Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR729481.2|CNS0GPTB Tetraodon nigroviridis full-length cDNA Length = 1546 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR729224.2|CNS0GPM6 Tetraodon nigroviridis full-length cDNA Length = 1565 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR729215.2|CNS0GPLX Tetraodon nigroviridis full-length cDNA Length = 1589 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 566 tcccgccattgatgacgttg 547
>emb|CR729213.2|CNS0GPLV Tetraodon nigroviridis full-length cDNA Length = 1561 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 548 tcccgccattgatgacgttg 529
>emb|CR729312.1|CNS0GPOM Tetraodon nigroviridis full-length cDNA Length = 1504 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 536 tcccgccattgatgacgttg 517
>emb|CR728931.2|CNS0GPE1 Tetraodon nigroviridis full-length cDNA Length = 1579 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 557 tcccgccattgatgacgttg 538
>emb|CR728875.2|CNS0GPCH Tetraodon nigroviridis full-length cDNA Length = 1407 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 386 tcccgccattgatgacgttg 367
>emb|CR728865.1|CNS0GPC7 Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR728444.2|CNS0GP0I Tetraodon nigroviridis full-length cDNA Length = 1563 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 541 tcccgccattgatgacgttg 522
>emb|CR728316.2|CNS0GOWY Tetraodon nigroviridis full-length cDNA Length = 1567 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR728296.2|CNS0GOWE Tetraodon nigroviridis full-length cDNA Length = 1537 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 535 tcccgccattgatgacgttg 516
>emb|CR728226.2|CNS0GOUG Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR728206.2|CNS0GOTW Tetraodon nigroviridis full-length cDNA Length = 1559 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 541 tcccgccattgatgacgttg 522
>emb|CR728166.2|CNS0GOSS Tetraodon nigroviridis full-length cDNA Length = 1562 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 549 tcccgccattgatgacgttg 530
>emb|CR728150.2|CNS0GOSC Tetraodon nigroviridis full-length cDNA Length = 1575 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 557 tcccgccattgatgacgttg 538
>emb|CR728277.1|CNS0GOVV Tetraodon nigroviridis full-length cDNA Length = 1537 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 532 tcccgccattgatgacgttg 513
>emb|CR728134.2|CNS0GORW Tetraodon nigroviridis full-length cDNA Length = 1560 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 540 tcccgccattgatgacgttg 521
>emb|CR728039.2|CNS0GOP9 Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR727992.2|CNS0GONY Tetraodon nigroviridis full-length cDNA Length = 1533 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 543 tcccgccattgatgacgttg 524
>emb|CR727983.2|CNS0GONP Tetraodon nigroviridis full-length cDNA Length = 1537 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR727776.2|CNS0GOHY Tetraodon nigroviridis full-length cDNA Length = 1577 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 555 tcccgccattgatgacgttg 536
>emb|CR727968.1|CNS0GONA Tetraodon nigroviridis full-length cDNA Length = 1554 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 552 tcccgccattgatgacgttg 533
>emb|CR727647.1|CNS0GOED Tetraodon nigroviridis full-length cDNA Length = 1533 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 533 tcccgccattgatgacgttg 514
>emb|CR727590.2|CNS0GOCS Tetraodon nigroviridis full-length cDNA Length = 1580 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 558 tcccgccattgatgacgttg 539
>emb|CR727582.2|CNS0GOCK Tetraodon nigroviridis full-length cDNA Length = 1566 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR727551.2|CNS0GOBP Tetraodon nigroviridis full-length cDNA Length = 1562 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 543 tcccgccattgatgacgttg 524
>emb|CR727543.2|CNS0GOBH Tetraodon nigroviridis full-length cDNA Length = 1523 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR727387.2|CNS0GO75 Tetraodon nigroviridis full-length cDNA Length = 1589 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 558 tcccgccattgatgacgttg 539
>emb|CR727251.2|CNS0GO3D Tetraodon nigroviridis full-length cDNA Length = 1571 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR727066.2|CNS0GNY8 Tetraodon nigroviridis full-length cDNA Length = 1520 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR727056.2|CNS0GNXY Tetraodon nigroviridis full-length cDNA Length = 1567 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR727043.2|CNS0GNXL Tetraodon nigroviridis full-length cDNA Length = 1570 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 550 tcccgccattgatgacgttg 531
>emb|CR727025.2|CNS0GNX3 Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR727019.2|CNS0GNWX Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 543 tcccgccattgatgacgttg 524
>emb|CR726875.2|CNS0GNSX Tetraodon nigroviridis full-length cDNA Length = 1562 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR726842.1|CNS0GNS0 Tetraodon nigroviridis full-length cDNA Length = 1520 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 521 tcccgccattgatgacgttg 502
>emb|CR726547.2|CNS0GNJT Tetraodon nigroviridis full-length cDNA Length = 1570 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 549 tcccgccattgatgacgttg 530
>emb|CR726544.2|CNS0GNJQ Tetraodon nigroviridis full-length cDNA Length = 1598 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 576 tcccgccattgatgacgttg 557
>emb|CR726536.2|CNS0GNJI Tetraodon nigroviridis full-length cDNA Length = 1466 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 477 tcccgccattgatgacgttg 458
>emb|CR726515.2|CNS0GNIX Tetraodon nigroviridis full-length cDNA Length = 1569 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 548 tcccgccattgatgacgttg 529
>emb|CR726450.2|CNS0GNH4 Tetraodon nigroviridis full-length cDNA Length = 1578 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 557 tcccgccattgatgacgttg 538
>emb|CR726252.2|CNS0GNBM Tetraodon nigroviridis full-length cDNA Length = 1521 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 512 tcccgccattgatgacgttg 493
>emb|CR726238.2|CNS0GNB8 Tetraodon nigroviridis full-length cDNA Length = 1569 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR726156.2|CNS0GN8Y Tetraodon nigroviridis full-length cDNA Length = 1562 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 544 tcccgccattgatgacgttg 525
>emb|CR726540.1|CNS0GNJM Tetraodon nigroviridis full-length cDNA Length = 1531 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR726056.2|CNS0GN66 Tetraodon nigroviridis full-length cDNA Length = 1580 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 tcccgccattgatgacgttg 488 |||||||||||||||||||| Sbjct: 558 tcccgccattgatgacgttg 539 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,369,830 Number of Sequences: 3902068 Number of extensions: 4369830 Number of successful extensions: 85257 Number of sequences better than 10.0: 729 Number of HSP's better than 10.0 without gapping: 727 Number of HSP's successfully gapped in prelim test: 2 Number of HSP's that attempted gapping in prelim test: 84168 Number of HSP's gapped (non-prelim): 1076 length of query: 488 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 466 effective length of database: 17,147,199,772 effective search space: 7990595093752 effective search space used: 7990595093752 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)