ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart12e06
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_474131.1| Oryza sativa (japonica cultivar-group), predic... 74 4e-10
2dbj|AK098910.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 4e-10
3dbj|AK071913.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 4e-10
4dbj|AK061729.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 4e-10
5dbj|D90406.1|RICOZA Oryza sativa (japonica cultivar-group) mRNA ... 74 4e-10
6gb|DQ430402.1| Sorghum propinquum locus pSHR0111.4 genomic sequence 70 7e-09
7gb|DQ430401.1| Sorghum bicolor voucher PI585454 locus pSHR0111.4... 70 7e-09
8gb|DQ430400.1| Sorghum bicolor voucher PI267539 locus pSHR0111.4... 70 7e-09
9gb|DQ430399.1| Sorghum bicolor voucher PI267408 locus pSHR0111.4... 70 7e-09
10gb|DQ430398.1| Sorghum bicolor voucher PI221607 locus pSHR0111.4... 70 7e-09
11gb|DQ430397.1| Sorghum bicolor voucher PI152702 locus pSHR0111.4... 70 7e-09
12gb|DQ430396.1| Sorghum bicolor voucher NSL92371 locus pSHR0111.4... 70 7e-09
13gb|DQ430395.1| Sorghum bicolor voucher NSL87902b locus pSHR0111.... 70 7e-09
14gb|DQ430394.1| Sorghum bicolor voucher NSL87902a locus pSHR0111.... 70 7e-09
15gb|DQ430393.1| Sorghum bicolor voucher NSL87666b locus pSHR0111.... 70 7e-09
16gb|DQ430392.1| Sorghum bicolor voucher NSL87666a locus pSHR0111.... 70 7e-09
17gb|DQ430391.1| Sorghum bicolor voucher NSL77217 locus pSHR0111.4... 70 7e-09
18gb|DQ430390.1| Sorghum bicolor voucher NSL77034 locus pSHR0111.4... 70 7e-09
19gb|DQ430389.1| Sorghum bicolor voucher NSL56174 locus pSHR0111.4... 70 7e-09
20gb|DQ430388.1| Sorghum bicolor voucher NSL56003 locus pSHR0111.4... 70 7e-09
21gb|DQ430387.1| Sorghum bicolor voucher NSL55243 locus pSHR0111.4... 70 7e-09
22gb|DQ430386.1| Sorghum bicolor voucher NSL51365 locus pSHR0111.4... 70 7e-09
23gb|DQ430385.1| Sorghum bicolor voucher NSL51030 locus pSHR0111.4... 70 7e-09
24gb|DQ430384.1| Sorghum bicolor voucher NSL50875 locus pSHR0111.4... 70 7e-09
25gb|DQ430383.1| Sorghum bicolor voucher BTx623 locus pSHR0111.4 g... 70 7e-09
26dbj|AB020961.1| Zea mays mRNA for cysteine protease component of... 68 3e-08
27dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 60 6e-06
28emb|AL442007.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 60 6e-06
29emb|AL606692.3|OSJN00105 Oryza sativa genomic DNA, chromosome 4,... 60 6e-06
30gb|AY103676.1| Zea mays PCO102242 mRNA sequence 58 2e-05
31gb|AF019147.1|AF019147 Zea mays cysteine proteinase Mir3 (mir3) ... 46 0.095
32gb|AC160120.2| Mus musculus BAC clone RP23-407B7 from chromosome... 46 0.095
33gb|AC150917.2| Bos taurus BAC CH240-430L1 (Children's Hospital ... 42 1.5
34emb|CR391971.7| Zebrafish DNA sequence from clone CH211-260O6 in... 42 1.5
35emb|AL845552.2|CNS08CBB Human chromosome 14 DNA sequence BAC C-2... 42 1.5
36gb|AC111100.13| Mus musculus chromosome 3, clone RP23-179J8, com... 40 5.8
37gb|AY371484.1| Schistosoma mansoni Smad4 (Smad4) mRNA, complete cds 40 5.8
38gb|AC162789.4| Mus musculus chromosome 1, clone RP24-323I23, com... 40 5.8
39gb|AC146577.2| Pan troglodytes BAC clone CH251-189A13 from Y, co... 40 5.8
40gb|AC164882.2| Mus musculus BAC clone RP23-88F16 from chromosome... 40 5.8
41gb|AC145936.3| Pan troglodytes BAC clone RP43-10N24 from Y, comp... 40 5.8
42emb|AJ011856.1|SCE011856 Saccharomyces cerevisiae complete mitoc... 40 5.8
43gb|AE014836.1| Plasmodium falciparum 3D7 chromosome 11 section 1... 40 5.8
44emb|AL355674.10| Human DNA sequence from clone RP11-171A24 on ch... 40 5.8
45emb|AL354854.8| Human DNA sequence from clone RP11-572H4 on chro... 40 5.8
46emb|V00696.1|MISC16 Yeast (S. cerevisiae) mitochondrial gene for... 40 5.8
47dbj|BS000621.1| Pan troglodytes chromosome Y clone:PTBY-001L21, ... 40 5.8
48dbj|BS000577.1| Pan troglodytes chromosome Y clone:PTB-263L12, c... 40 5.8
49gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 40 5.8
50gb|L36899.1|YSCMTCG15 Saccharomyces cerevisiae mitochondrion ori... 40 5.8
51gb|S76640.1| Saccharomyces cerevisiae bI4 RNA maturase gene, com... 40 5.8
52gb|AC154778.2| Mus musculus BAC clone RP24-459I17 from chromosom... 40 5.8
53gb|AC097454.2| Homo sapiens BAC clone RP11-2F17 from 4, complete... 40 5.8
54gb|AC116374.10| Mus musculus chromosome 1, clone RP23-294I9, com... 40 5.8
55gb|BC094153.1| Xenopus laevis cDNA clone MGC:115258 IMAGE:663983... 40 5.8
56gb|AE014846.1| Plasmodium falciparum 3D7 chromosome 12, section ... 40 5.8
57gb|AC007556.3| Homo sapiens BAC clone RP11-18C9 from 2, complete... 40 5.8
58gb|AC012445.6| Homo sapiens BAC clone RP11-86A21 from 2, complet... 40 5.8
59gb|AC091888.3| Homo sapiens chromosome 5 clone RP11-11K15, compl... 40 5.8
60emb|BX649264.4| Zebrafish DNA sequence from clone CH211-260K9 in... 40 5.8
61emb|CR974440.6| Zebrafish DNA sequence from clone CH73-78M16 in ... 40 5.8
62emb|CT030189.8| Mouse DNA sequence from clone RP24-402B23 on chr... 40 5.8
63gb|J01469.1|YSCMTCOB Yeast (S.cerevisiae) mitochondrial cob gene... 40 5.8 
>ref|XM_474131.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1377

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 346  ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 405
            ||||| |||||||||||| || |||||||||||| |||||| |||||||| |||  ||||
Sbjct: 1331 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 1272

                         
Query: 406  cacgttccctgct 418
            || ||||||||||
Sbjct: 1271 caggttccctgct 1259
to top
>dbj|AK098910.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002H09, full
            insert sequence
          Length = 1753

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 346  ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 405
            ||||| |||||||||||| || |||||||||||| |||||| |||||||| |||  ||||
Sbjct: 1396 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 1337

                         
Query: 406  cacgttccctgct 418
            || ||||||||||
Sbjct: 1336 caggttccctgct 1324



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Minus

                                                                        
Query: 76   agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 135
            |||||| ||||||||||||  || || ||||||||||||  ||||||||| | || ||||
Sbjct: 1667 agctgaattttacatatac--attcagaagcaaatttggcagttctgtaaccaactgaac 1610

                    
Query: 136  ccgatttt 143
            ||| ||||
Sbjct: 1609 ccgttttt 1602
to top
>dbj|AK071913.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013065M08, full
            insert sequence
          Length = 1774

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 346  ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 405
            ||||| |||||||||||| || |||||||||||| |||||| |||||||| |||  ||||
Sbjct: 1396 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 1337

                         
Query: 406  cacgttccctgct 418
            || ||||||||||
Sbjct: 1336 caggttccctgct 1324
to top
>dbj|AK061729.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-B12, full
           insert sequence
          Length = 976

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                       
Query: 346 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 405
           ||||| |||||||||||| || |||||||||||| |||||| |||||||| |||  ||||
Sbjct: 598 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 539

                        
Query: 406 cacgttccctgct 418
           || ||||||||||
Sbjct: 538 caggttccctgct 526



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Minus

                                                                       
Query: 76  agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 135
           |||||| ||||||||||||  || || ||||||||||||  ||||||||| | || ||||
Sbjct: 869 agctgaattttacatatac--attcagaagcaaatttggcagttctgtaaccaactgaac 812

                   
Query: 136 ccgatttt 143
           ||| ||||
Sbjct: 811 ccgttttt 804
to top
>dbj|D90406.1|RICOZA Oryza sativa (japonica cultivar-group) mRNA for oryzain alpha,
            complete cds
          Length = 1929

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 346  ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 405
            ||||| |||||||||||| || |||||||||||| |||||| |||||||| |||  ||||
Sbjct: 1376 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 1317

                         
Query: 406  cacgttccctgct 418
            || ||||||||||
Sbjct: 1316 caggttccctgct 1304



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Minus

                                                                        
Query: 76   agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 135
            |||||| ||||||||||||  || || ||||||||||||  ||||||||| | || ||||
Sbjct: 1647 agctgaattttacatatac--attcagaagcaaatttggcagttctgtaaccaactgaac 1590

                    
Query: 136  ccgatttt 143
            ||| ||||
Sbjct: 1589 ccgttttt 1582
to top
>gb|DQ430402.1| Sorghum propinquum locus pSHR0111.4 genomic sequence
          Length = 718

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 346 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 396
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 46.1 bits (23), Expect = 0.095
 Identities = 36/39 (92%), Gaps = 1/39 (2%)
 Strand = Plus / Minus

                                                  
Query: 76  agctgagttttacatatacatatgcaaaagcaaatttgg 114
           |||||| |||||||| || ||||||||||||||||||||
Sbjct: 561 agctgaattttacat-tatatatgcaaaagcaaatttgg 524
to top
>gb|DQ430401.1| Sorghum bicolor voucher PI585454 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 346 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 396
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 95  atatgcaaaagcaaatttgg 114
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430400.1| Sorghum bicolor voucher PI267539 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 346 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 396
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 95  atatgcaaaagcaaatttgg 114
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430399.1| Sorghum bicolor voucher PI267408 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 346 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 396
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 95  atatgcaaaagcaaatttgg 114
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430398.1| Sorghum bicolor voucher PI221607 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 346 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 396
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 95  atatgcaaaagcaaatttgg 114
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430397.1| Sorghum bicolor voucher PI152702 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 346 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 396
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 95  atatgcaaaagcaaatttgg 114
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430396.1| Sorghum bicolor voucher NSL92371 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 346 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 396
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 95  atatgcaaaagcaaatttgg 114
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430395.1| Sorghum bicolor voucher NSL87902b locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 346 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 396
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 95  atatgcaaaagcaaatttgg 114
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430394.1| Sorghum bicolor voucher NSL87902a locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 346 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 396
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 95  atatgcaaaagcaaatttgg 114
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430393.1| Sorghum bicolor voucher NSL87666b locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 346 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 396
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 95  atatgcaaaagcaaatttgg 114
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430392.1| Sorghum bicolor voucher NSL87666a locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 346 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 396
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 95  atatgcaaaagcaaatttgg 114
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430391.1| Sorghum bicolor voucher NSL77217 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 346 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 396
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 95  atatgcaaaagcaaatttgg 114
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430390.1| Sorghum bicolor voucher NSL77034 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 346 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 396
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 95  atatgcaaaagcaaatttgg 114
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430389.1| Sorghum bicolor voucher NSL56174 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 346 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 396
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 95  atatgcaaaagcaaatttgg 114
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430388.1| Sorghum bicolor voucher NSL56003 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 346 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 396
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 95  atatgcaaaagcaaatttgg 114
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430387.1| Sorghum bicolor voucher NSL55243 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 346 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 396
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 95  atatgcaaaagcaaatttgg 114
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430386.1| Sorghum bicolor voucher NSL51365 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 346 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 396
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 95  atatgcaaaagcaaatttgg 114
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430385.1| Sorghum bicolor voucher NSL51030 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 346 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 396
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 95  atatgcaaaagcaaatttgg 114
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430384.1| Sorghum bicolor voucher NSL50875 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 346 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 396
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 95  atatgcaaaagcaaatttgg 114
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430383.1| Sorghum bicolor voucher BTx623 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 346 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 396
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 95  atatgcaaaagcaaatttgg 114
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>dbj|AB020961.1| Zea mays mRNA for cysteine protease component of protease-inhibitor
            complex, complete cds
          Length = 1828

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 78/92 (84%), Gaps = 3/92 (3%)
 Strand = Plus / Minus

                                                                        
Query: 346  ggcttggccagggtacgcctctgagccttcactga---cagtgggctgtccttggccgcg 402
            |||||||||||||| ||| ||  ||||||||||||   |||||||||||||||| ||  |
Sbjct: 1452 ggcttggccagggttcgcttcgtagccttcactgaaagcagtgggctgtccttgcccatg 1393

                                            
Query: 403  aggcacgttccctgcttggtgttgcagatggg 434
            ||||| ||||||||| ||  ||||||||||||
Sbjct: 1392 aggcaggttccctgcctgacgttgcagatggg 1361
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                  
Query: 346      ggcttggccagggtacgcctctgagccttcactgacagtgggctgtcctt 395
                ||||| |||||||||||| || |||||||||||| |||||| ||||||||
Sbjct: 33157603 ggctttgccagggtacgcttcagagccttcactgccagtggactgtcctt 33157652



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Plus

                                                                            
Query: 76       agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 135
                |||||| ||||||||||||||   || ||||||||||||  ||||||||| | || ||||
Sbjct: 33157332 agctgaattttacatatacatt--cagaagcaaatttggcagttctgtaaccaactgaac 33157389

                        
Query: 136      ccgatttt 143
                ||| ||||
Sbjct: 33157390 ccgttttt 33157397
to top
>emb|AL442007.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0212B02, complete
             sequence
          Length = 118971

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 346   ggcttggccagggtacgcctctgagccttcactgacagtgggctgtcctt 395
             ||||| |||||||||||| || |||||||||||| |||||| ||||||||
Sbjct: 47996 ggctttgccagggtacgcttcagagccttcactgccagtggactgtcctt 48045



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Plus

                                                                         
Query: 76    agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 135
             |||||| ||||||||||||||   || ||||||||||||  ||||||||| | || ||||
Sbjct: 47725 agctgaattttacatatacatt--cagaagcaaatttggcagttctgtaaccaactgaac 47782

                     
Query: 136   ccgatttt 143
             ||| ||||
Sbjct: 47783 ccgttttt 47790
to top
>emb|AL606692.3|OSJN00105 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0059K02,
             complete sequence
          Length = 165745

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 346   ggcttggccagggtacgcctctgagccttcactgacagtgggctgtcctt 395
             ||||| |||||||||||| || |||||||||||| |||||| ||||||||
Sbjct: 40253 ggctttgccagggtacgcttcagagccttcactgccagtggactgtcctt 40302



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Plus

                                                                         
Query: 76    agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 135
             |||||| ||||||||||||||   || ||||||||||||  ||||||||| | || ||||
Sbjct: 39982 agctgaattttacatatacatt--cagaagcaaatttggcagttctgtaaccaactgaac 40039

                     
Query: 136   ccgatttt 143
             ||| ||||
Sbjct: 40040 ccgttttt 40047
to top
>gb|AY103676.1| Zea mays PCO102242 mRNA sequence
          Length = 1878

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 378  tgacagtgggctgtccttggccgcgaggcacgttccctgcttggtgttgcagatggg 434
            ||||||||||||||||||| ||  |||||| ||||||||| ||  ||||||||||||
Sbjct: 1453 tgacagtgggctgtccttgcccatgaggcaggttccctgcctgacgttgcagatggg 1397
to top
>gb|AF019147.1|AF019147 Zea mays cysteine proteinase Mir3 (mir3) mRNA, complete cds
          Length = 1830

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 347  gcttggccagggtacgcctctgagccttcactgacagtg 385
            ||||||||||||| ||| ||  |||||||||||||||||
Sbjct: 1455 gcttggccagggttcgcttcgtagccttcactgacagtg 1417



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                     
Query: 378  tgacagtgggctgtccttggccgcgaggcacgttccctgcttggtgttgcagatggg 434
            ||||||||||||||||||| ||  |||  | ||||||||| ||  ||||||||||||
Sbjct: 1418 tgacagtgggctgtccttgcccatgagcgaggttccctgcctgacgttgcagatggg 1362
to top
>gb|AC160120.2| Mus musculus BAC clone RP23-407B7 from chromosome 14, complete sequence
          Length = 202981

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 133   aacccgattttaggattatgtacaggagcat 163
             |||||||||||||||||| | ||||||||||
Sbjct: 65968 aacccgattttaggattaggaacaggagcat 65998
to top
>gb|AC150917.2| Bos taurus  BAC CH240-430L1 (Children's Hospital Oakland Research
              Institute Bovine BAC Library (male)) complete sequence
          Length = 186516

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 167    ttataaagaagatatttgaga 187
              |||||||||||||||||||||
Sbjct: 168523 ttataaagaagatatttgaga 168503
to top
>emb|CR391971.7| Zebrafish DNA sequence from clone CH211-260O6 in linkage group 21,
              complete sequence
          Length = 129478

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 83     ttttacatatacatatgcaaaagca 107
              |||||||| ||||||||||||||||
Sbjct: 119390 ttttacatttacatatgcaaaagca 119414
to top
>emb|AL845552.2|CNS08CBB Human chromosome 14 DNA sequence BAC C-2062F14 of library CalTech-D from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 130569

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 251    atcaccatggccgctggctgt 271
              |||||||||||||||||||||
Sbjct: 103502 atcaccatggccgctggctgt 103522
to top
>gb|AC111100.13| Mus musculus chromosome 3, clone RP23-179J8, complete sequence
          Length = 216852

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 39     cataataacaatggcagctc 58
              ||||||||||||||||||||
Sbjct: 120204 cataataacaatggcagctc 120185
to top
>gb|AY371484.1| Schistosoma mansoni Smad4 (Smad4) mRNA, complete cds
          Length = 3146

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 147  attatgtacaggagcatctattat 170
            |||| |||||||||||||||||||
Sbjct: 1972 attaggtacaggagcatctattat 1995
to top
>gb|AC162789.4| Mus musculus chromosome 1, clone RP24-323I23, complete sequence
          Length = 170236

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 87    acatatacatatgcaaaagcaaat 110
             ||||||||||||||||||| ||||
Sbjct: 96777 acatatacatatgcaaaagtaaat 96754
to top
>gb|AC146577.2| Pan troglodytes BAC clone CH251-189A13 from Y, complete sequence
          Length = 171643

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 171   aaagaagatatttgagagca 190
             ||||||||||||||||||||
Sbjct: 57977 aaagaagatatttgagagca 57958
to top
>gb|AC164882.2| Mus musculus BAC clone RP23-88F16 from chromosome 9, complete sequence
          Length = 203020

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 173    agaagatatttgagagcata 192
              ||||||||||||||||||||
Sbjct: 130830 agaagatatttgagagcata 130811
to top
>gb|AC145936.3| Pan troglodytes BAC clone RP43-10N24 from Y, complete sequence
          Length = 163676

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 171    aaagaagatatttgagagca 190
              ||||||||||||||||||||
Sbjct: 149616 aaagaagatatttgagagca 149597
to top
>emb|AJ011856.1|SCE011856 Saccharomyces cerevisiae complete mitochondrial genome
          Length = 85779

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 107   aaatttggtggttctgtaaa 126
             ||||||||||||||||||||
Sbjct: 41670 aaatttggtggttctgtaaa 41689
to top
>gb|AE014836.1| Plasmodium falciparum 3D7 chromosome 11 section 1 of 8 of the complete
              sequence
          Length = 250743

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 91     atacatatgcaaaagcaaat 110
              ||||||||||||||||||||
Sbjct: 171275 atacatatgcaaaagcaaat 171294
to top
>emb|AL355674.10| Human DNA sequence from clone RP11-171A24 on chromosome 9 Contains the
             5' end of the RORB gene for RAR-related orphan receptor B
             protein (RZRB, ROR-BETA), two novel genes and two CpG
             islands, complete sequence
          Length = 174874

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 231   gtgatcatttgcagaagttaatca 254
             |||||||||| |||||||||||||
Sbjct: 81873 gtgatcattttcagaagttaatca 81896
to top
>emb|AL354854.8| Human DNA sequence from clone RP11-572H4 on chromosome 9 Contains
             pseudogene similar to part of a novel gene (KIAA1688), a
             solute carrier family 25 (mitochondrial carrier; adenine
             nucleotide translocator), member 6 (SLC25A6) (ANT3)
             pseudogene and a CpG island, complete sequence
          Length = 169550

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 83    ttttacatatacatatgcaa 102
             ||||||||||||||||||||
Sbjct: 22532 ttttacatatacatatgcaa 22513
to top
>emb|V00696.1|MISC16 Yeast (S. cerevisiae) mitochondrial gene for cytochrome B extending
            from map position 71.3 to 80.2. (Strain D273-10B.)
          Length = 6264

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 107  aaatttggtggttctgtaaa 126
            ||||||||||||||||||||
Sbjct: 1475 aaatttggtggttctgtaaa 1494
to top
>dbj|BS000621.1| Pan troglodytes chromosome Y clone:PTBY-001L21, complete sequences
          Length = 69000

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 171   aaagaagatatttgagagca 190
             ||||||||||||||||||||
Sbjct: 64373 aaagaagatatttgagagca 64392
to top
>dbj|BS000577.1| Pan troglodytes chromosome Y clone:PTB-263L12, complete sequences
          Length = 175833

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 171  aaagaagatatttgagagca 190
            ||||||||||||||||||||
Sbjct: 3630 aaagaagatatttgagagca 3649
to top
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 171      aaagaagatatttgagagca 190
                ||||||||||||||||||||
Sbjct: 23270061 aaagaagatatttgagagca 23270042
to top
>gb|L36899.1|YSCMTCG15 Saccharomyces cerevisiae mitochondrion origin of replication (ori6)
            and oli1 gene, complete cds
          Length = 8316

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 107  aaatttggtggttctgtaaa 126
            ||||||||||||||||||||
Sbjct: 2631 aaatttggtggttctgtaaa 2650
to top
>gb|S76640.1| Saccharomyces cerevisiae bI4 RNA maturase gene, complete cds
          Length = 765

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 107 aaatttggtggttctgtaaa 126
           ||||||||||||||||||||
Sbjct: 184 aaatttggtggttctgtaaa 203
to top
>gb|AC154778.2| Mus musculus BAC clone RP24-459I17 from chromosome 12, complete
            sequence
          Length = 155367

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 27   cttgatgaattccataataa 46
            ||||||||||||||||||||
Sbjct: 8995 cttgatgaattccataataa 8976
to top
>gb|AC097454.2| Homo sapiens BAC clone RP11-2F17 from 4, complete sequence
          Length = 163486

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 19    tcatgtttcttgatgaattc 38
             ||||||||||||||||||||
Sbjct: 44937 tcatgtttcttgatgaattc 44918
to top
>gb|AC116374.10| Mus musculus chromosome 1, clone RP23-294I9, complete sequence
          Length = 179835

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 87     acatatacatatgcaaaagcaaat 110
              ||||||||||||||||||| ||||
Sbjct: 171309 acatatacatatgcaaaagtaaat 171286
to top
>gb|BC094153.1| Xenopus laevis cDNA clone MGC:115258 IMAGE:6639837, complete cds
          Length = 5263

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 84   tttacatatacatatgcaaa 103
            ||||||||||||||||||||
Sbjct: 3028 tttacatatacatatgcaaa 3009
to top
>gb|AE014846.1| Plasmodium falciparum 3D7 chromosome 12, section 3 of 9 of the complete
              sequence
          Length = 253132

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 165    tattataaagaagatatttg 184
              ||||||||||||||||||||
Sbjct: 176527 tattataaagaagatatttg 176508
to top
>gb|AC007556.3| Homo sapiens BAC clone RP11-18C9 from 2, complete sequence
          Length = 167358

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 85    ttacatatacatatgcaaaa 104
             ||||||||||||||||||||
Sbjct: 66744 ttacatatacatatgcaaaa 66763
to top
>gb|AC012445.6| Homo sapiens BAC clone RP11-86A21 from 2, complete sequence
          Length = 203428

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 87     acatatacatatgcaaaagcaaat 110
              |||||||||||| |||||||||||
Sbjct: 152020 acatatacatattcaaaagcaaat 151997
to top
>gb|AC091888.3| Homo sapiens chromosome 5 clone RP11-11K15, complete sequence
          Length = 151453

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   ccctgcttggtgttgcagat 431
             ||||||||||||||||||||
Sbjct: 20107 ccctgcttggtgttgcagat 20126
to top
>emb|BX649264.4| Zebrafish DNA sequence from clone CH211-260K9 in linkage group 20,
            complete sequence
          Length = 194320

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 171  aaagaagatatttgagagca 190
            ||||||||||||||||||||
Sbjct: 6172 aaagaagatatttgagagca 6153
to top
>emb|CR974440.6| Zebrafish DNA sequence from clone CH73-78M16 in linkage group 22,
              complete sequence
          Length = 123466

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 162    atctattataaagaagatat 181
              ||||||||||||||||||||
Sbjct: 119195 atctattataaagaagatat 119176



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 162   atctattataaagaagatat 181
             ||||||||||||||||||||
Sbjct: 38624 atctattataaagaagatat 38605
to top
>emb|CT030189.8| Mouse DNA sequence from clone RP24-402B23 on chromosome 12, complete
             sequence
          Length = 223910

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 27    cttgatgaattccataataa 46
             ||||||||||||||||||||
Sbjct: 60956 cttgatgaattccataataa 60975
to top
>gb|J01469.1|YSCMTCOB Yeast (S.cerevisiae) mitochondrial cob gene, intron 4
          Length = 1453

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 107 aaatttggtggttctgtaaa 126
           ||||||||||||||||||||
Sbjct: 598 aaatttggtggttctgtaaa 617


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,197,763
Number of Sequences: 3902068
Number of extensions: 4197763
Number of successful extensions: 81775
Number of sequences better than 10.0: 63
Number of HSP's better than 10.0 without gapping: 63
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 81560
Number of HSP's gapped (non-prelim): 207
length of query: 434
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 412
effective length of database: 17,147,199,772
effective search space: 7064646306064
effective search space used: 7064646306064
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top