Clone Name	rbart12c08
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AK120033.1| Oryza sativa (japonica cultivar-group) cDNA clon...	216	5e-53
2	emb|X64621.1|OSR22CDNA O.sativa R22 mRNA	216	5e-53
3	dbj|AK066128.1| Oryza sativa (japonica cultivar-group) cDNA clon...	216	5e-53
4	dbj|AK062208.1| Oryza sativa (japonica cultivar-group) cDNA clon...	216	5e-53
5	ref|XM_476047.1| Oryza sativa (japonica cultivar-group), predic...	206	4e-50
6	gb|BT016528.1| Zea mays clone Contig361 mRNA sequence	153	6e-34
7	gb|AF470356.1| Triticum aestivum QM mRNA, partial cds	151	2e-33
8	gb|AC084817.5| Oryza sativa (japonica cultivar-group) chromosome...	149	9e-33
9	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	149	9e-33
10	emb|X81692.1|OSSG12G O.sativa SG12 gene	149	9e-33
11	gb|U55048.1|OSU55048 Oryza sativa QM gene, complete cds	149	9e-33
12	gb|BT016423.1| Zea mays clone Contig256 mRNA sequence	137	3e-29
13	gb|AY103671.1| Zea mays PCO135454 mRNA sequence	137	3e-29
14	gb|U06108.1|ZMU06108 Zea mays B73 QM protein mRNA, complete cds	135	1e-28
15	gb|AF542972.1| Triticum aestivum SC34 tumor suppressor-like mRNA...	121	2e-24
16	dbj|AK102971.1| Oryza sativa (japonica cultivar-group) cDNA clon...	111	2e-21
17	dbj|AK060902.1| Oryza sativa (japonica cultivar-group) cDNA clon...	111	2e-21
18	gb|U55212.1|OSU55212 Oryza sativa Wilms' tumor-related protein Q...	111	2e-21
19	emb|X81691.1|OSSC34MR O.sativa SC34 mRNA for tumor suppressor	105	1e-19
20	gb|AY641430.1| Caragana jubata QM family protein (QM) mRNA, comp...	103	5e-19
21	gb|AY641733.1| Camellia sinensis QM-like protein mRNA, complete cds	103	5e-19
22	dbj|AK103710.1| Oryza sativa (japonica cultivar-group) cDNA clon...	103	5e-19
23	ref|NM_102455.1| Arabidopsis thaliana structural constituent of ...	92	2e-15
24	gb|BT024605.1| Arabidopsis thaliana At1g26910 mRNA, complete cds	92	2e-15
25	gb|AY087264.1| Arabidopsis thaliana clone 33391 mRNA, complete s...	84	4e-13
26	gb|AF180758.1|AF180758 Vitis riparia 60S ribosomal protein L10 (...	84	4e-13
27	ref|NM_101298.2| Arabidopsis thaliana structural constituent of ...	80	7e-12
28	gb|BT000679.1| Arabidopsis thaliana clone RAFL07-10-D02 (R10643)...	80	7e-12
29	gb|AY113989.1| Arabidopsis thaliana putative tumor suppressor pr...	80	7e-12
30	gb|AY045866.1| Arabidopsis thaliana putative tumor suppressor pr...	80	7e-12
31	gb|AF428470.1|AF428470 Arabidopsis thaliana At1g14320/F14L17_28 ...	80	7e-12
32	gb|AF428286.1|AF428286 Arabidopsis thaliana At1g14320/F14L17_28 ...	80	7e-12
33	gb|AY050482.1| Arabidopsis thaliana At1g14320/F14L17_28 mRNA, co...	80	7e-12
34	gb|AF378902.1|AF378902 Arabidopsis thaliana At1g14320/F14L17_28 ...	80	7e-12
35	emb|BX816389.1|CNS0AE93 Arabidopsis thaliana Full-length cDNA Co...	80	7e-12
36	emb|BX816136.1|CNS0AE2V Arabidopsis thaliana Full-length cDNA Co...	80	7e-12
37	emb|Z15157.1|ATWILMTSH A.thaliana mRNA for Wilm's tumor suppress...	80	7e-12
38	emb|Z14083.1|NTTRP N.tabacum mRNA for protein homologue to human...	76	1e-10
39	ref|NM_105329.1| Arabidopsis thaliana structural constituent of ...	72	2e-09
40	gb|AY055103.1| Arabidopsis thaliana At1g66580/T12I7_3 mRNA, comp...	72	2e-09
41	gb|AF367276.1|AF367276 Arabidopsis thaliana At1g66580/T12I7_3 mR...	72	2e-09
42	emb|BX816025.1|CNS0ABON Arabidopsis thaliana Full-length cDNA Co...	72	2e-09
43	emb|BX815625.1|CNS0ABEZ Arabidopsis thaliana Full-length cDNA Co...	72	2e-09
44	gb|AY087426.1| Arabidopsis thaliana clone 35307 mRNA, complete s...	72	2e-09
45	gb|DQ228354.1| Solanum tuberosum clone 150H09 60S ribosomal prot...	68	3e-08
46	gb|AC147460.1| Oryza sativa (japonica cultivar-group) chromosome...	68	3e-08
47	gb|AC123524.2| Oryza sativa (japonica cultivar-group) chromosome...	68	3e-08
48	gb|AF368032.1|AF368032 Heliothis virescens QM protein mRNA, comp...	68	3e-08
49	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	68	3e-08
50	gb|AC012188.2|F14L17 Sequence of BAC F14L17 from Arabidopsis tha...	68	3e-08
51	gb|AF227620.1|AF227620 Euphorbia esula 60S ribosomal protein L10...	68	3e-08
52	gb|AC005508.1|AC005508 Arabidopsis thaliana chromosome I BAC T2P...	68	3e-08
53	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	68	3e-08
54	dbj|AB001582.1| Solanum melongena mRNA for QM family protein, pa...	68	3e-08
55	dbj|AB001891.1| Solanum melongena mRNA for QM family protein, co...	68	3e-08
56	emb|CR937221.1| Single read from an extremity of a cDNA clone ma...	62	2e-06
57	gb|DQ440008.1| Aedes aegypti clone AE-200A ribosomal protein L10...	60	6e-06
58	gb|AY829778.1| Lonomia obliqua ribosomal protein L10 mRNA, compl...	60	6e-06
59	emb|BX071681.1|CNS09RH1 Single read from an extremity of a full-...	60	6e-06
60	emb|BX066414.1|CNS09NEQ Single read from an extremity of a full-...	60	6e-06
61	emb|BX066294.1|CNS09NBE Single read from an extremity of a full-...	60	6e-06
62	emb|BX062161.1|CNS09K4L Single read from an extremity of a full-...	60	6e-06
63	emb|BX054818.1|CNS09EGM Single read from an extremity of a full-...	60	6e-06
64	emb|BX054800.1|CNS09EG4 Single read from an extremity of a full-...	60	6e-06
65	emb|BX054799.1|CNS09EG3 Single read from an extremity of a full-...	60	6e-06
66	emb|BX046336.1|CNS097X0 Single read from an extremity of a full-...	60	6e-06
67	emb|BX045752.1|CNS097GS Single read from an extremity of a full-...	60	6e-06
68	emb|BX045505.1|CNS0979X Single read from an extremity of a full-...	60	6e-06
69	emb|BX043067.1|CNS095E7 Single read from an extremity of a full-...	60	6e-06
70	emb|BX043066.1|CNS095E6 Single read from an extremity of a full-...	60	6e-06
71	emb|BX044599.1|CNS096KR Single read from an extremity of a full-...	60	6e-06
72	emb|BX043398.1|CNS095NE Single read from an extremity of a full-...	60	6e-06
73	emb|BX038980.1|CNS0928O Single read from an extremity of a full-...	60	6e-06
74	emb|BX037545.1|CNS0914T Single read from an extremity of a full-...	60	6e-06
75	emb|BX037544.1|CNS0914S Single read from an extremity of a full-...	60	6e-06
76	emb|BX031114.1|CNS08W66 Single read from an extremity of a full-...	60	6e-06
77	emb|BX026834.1|CNS08SVA Single read from an extremity of a full-...	60	6e-06
78	emb|BX026833.1|CNS08SV9 Single read from an extremity of a full-...	60	6e-06
79	emb|BX025006.1|CNS08RGI Single read from an extremity of a full-...	60	6e-06
80	emb|BX025005.1|CNS08RGH Single read from an extremity of a full-...	60	6e-06
81	emb|BX024539.1|CNS08R3J Single read from an extremity of a full-...	60	6e-06
82	emb|BX020659.1|CNS08O3R Single read from an extremity of a full-...	60	6e-06
83	emb|BX019389.1|CNS08N4H Single read from an extremity of a full-...	60	6e-06
84	emb|BX018993.1|CNS08MTH Single read from an extremity of a full-...	60	6e-06
85	emb|BX017940.1|CNS08M08 Single read from an extremity of a full-...	60	6e-06
86	emb|BX017939.1|CNS08M07 Single read from an extremity of a full-...	60	6e-06
87	emb|BX018773.1|CNS08MND Single read from an extremity of a full-...	60	6e-06
88	emb|BX018772.1|CNS08MNC Single read from an extremity of a full-...	60	6e-06
89	emb|BX017778.1|CNS08LVQ Single read from an extremity of a full-...	60	6e-06
90	emb|BX017777.1|CNS08LVP Single read from an extremity of a full-...	60	6e-06
91	emb|BX016960.1|CNS08L90 Single read from an extremity of a full-...	60	6e-06
92	emb|BX012859.1|CNS08I33 Single read from an extremity of a full-...	60	6e-06
93	emb|BX012858.1|CNS08I32 Single read from an extremity of a full-...	60	6e-06
94	emb|BX010419.1|CNS08G7B Single read from an extremity of a full-...	60	6e-06
95	emb|BX008095.1|CNS08EER Single read from an extremity of a full-...	60	6e-06
96	emb|BX008094.1|CNS08EEQ Single read from an extremity of a full-...	60	6e-06
97	emb|BX005642.1|CNS08CIM Single read from an extremity of a full-...	60	6e-06
98	emb|CR938586.1| Single read from an extremity of a full-length c...	60	6e-06
99	emb|CR938540.1| Single read from an extremity of a full-length c...	60	6e-06
100	emb|CR938096.1| Single read from an extremity of a full-length c...	60	6e-06
101	emb|CR938095.1| Single read from an extremity of a full-length c...	60	6e-06
102	emb|CR937970.1| Single read from an extremity of a full-length c...	60	6e-06
103	emb|CR937222.1| Single read from an extremity of a cDNA clone ma...	60	6e-06
104	gb|AF295636.1|AF295636 Elaeis guineensis QM-like protein mRNA, c...	60	6e-06
105	ref|XM_312560.2| Anopheles gambiae str. PEST ENSANGP00000014921 ...	60	6e-06
106	gb|AF118822.1|AF118822 Arabidopsis thaliana senescence-associate...	58	3e-05
107	ref|XM_868582.1| PREDICTED: Bos taurus similar to ribosomal prot...	56	1e-04
108	gb|U60651.1| Hydra vulgaris ribosomal protein L10 mRNA, complete...	56	1e-04
109	emb|BX051816.1|CNS09C58 Single read from an extremity of a full-...	56	1e-04
110	emb|CR938702.1| Single read from an extremity of a full-length c...	56	1e-04
111	gb|AC079285.1|AC079285 Arabidopsis thaliana chromosome 1 BAC T12...	56	1e-04
112	gb|AY130416.1| Petromyzon marinus ribosomal protein L10 mRNA, pa...	56	1e-04
113	ref|XM_658595.1| Aspergillus nidulans FGSC A4 hypothetical prote...	54	4e-04
114	emb|BX038979.1|CNS0928N Single read from an extremity of a full-...	54	4e-04
115	gb|AY440350.1| Armigeres subalbatus ASAP ID: 41357 cytosolic lar...	52	0.002
116	emb|AM049018.1| Curculio glandium partial mRNA for ribosomal pro...	52	0.002
117	gb|BC086917.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo...	50	0.006
118	gb|AC122357.4| Mus musculus BAC clone RP23-403O8 from chromosome...	50	0.006
119	gb|BC083327.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo...	50	0.006
120	gb|BC082293.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo...	50	0.006
121	gb|AY701865.1| Gekko japonicus GekBS044P mRNA, complete cds	50	0.006
122	ref|XM_585834.2| PREDICTED: Bos taurus similar to ribosomal prot...	50	0.006
123	ref|XM_592251.2| PREDICTED: Bos taurus similar to ribosomal prot...	50	0.006
124	gb|BC024901.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo...	50	0.006
125	ref|NM_052835.1| Mus musculus ribosomal protein 10 (Rpl10), mRNA	50	0.006
126	ref|NM_174760.2| Bos taurus ribosomal protein L10 (RPL10), mRNA	50	0.006
127	ref|XM_862548.1| PREDICTED: Canis familiaris similar to ribosoma...	50	0.006
128	ref|XM_862530.1| PREDICTED: Canis familiaris similar to ribosoma...	50	0.006
129	ref|XM_862521.1| PREDICTED: Canis familiaris similar to ribosoma...	50	0.006
130	ref|XM_538206.2| PREDICTED: Canis familiaris similar to ribosoma...	50	0.006
131	ref|XM_848470.1| PREDICTED: Canis familiaris similar to ribosoma...	50	0.006
132	ref|XM_974001.1| PREDICTED: Mus musculus similar to ribosomal pr...	50	0.006
133	ref|XM_889722.2| PREDICTED: Mus musculus similar to ribosomal pr...	50	0.006
134	gb|AC113107.15| Mus musculus chromosome 10, clone RP23-325G13, c...	50	0.006
135	ref|XM_543494.2| PREDICTED: Canis familiaris similar to ribosoma...	50	0.006
136	ref|XM_542759.2| PREDICTED: Canis familiaris similar to ribosoma...	50	0.006
137	emb|CR974589.6| Mouse DNA sequence from clone RP23-77B14 on chro...	50	0.006
138	ref|XM_547794.2| PREDICTED: Canis familiaris similar to 60S ribo...	50	0.006
139	emb|AM049019.1| Scarabaeus laticollis mRNA for ribosomal protein...	50	0.006
140	gb|AC121872.2| Mus musculus BAC clone RP24-122E10 from 12, compl...	50	0.006
141	gb|BC058467.1| Rattus norvegicus ribosomal protein L10, mRNA (cD...	50	0.006
142	ref|XM_849677.1| PREDICTED: Canis familiaris similar to ribosoma...	50	0.006
143	gb|AC117679.8| Mus musculus chromosome 9, clone RP23-435I22, com...	50	0.006
144	emb|X75312.1|MMRNAQM M.musculus (C57BL/6) QM mRNA	50	0.006
145	gb|BC099437.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo...	50	0.006
146	gb|AC160997.5| Mus musculus BAC clone RP23-68E4 from chromosome ...	50	0.006
147	gb|BC098204.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo...	50	0.006
148	dbj|AB226277.1| Aspergillus oryzae cDNA, contig sequence: AoEST3138	50	0.006
149	dbj|AB223250.1| Aspergillus oryzae cDNA, contig sequence: AoEST0081	50	0.006
150	dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011	50	0.006
151	dbj|AK146217.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-...	50	0.006
152	dbj|AK151736.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	50	0.006
153	dbj|AK144831.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-...	50	0.006
154	dbj|AK152854.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	50	0.006
155	dbj|AK151655.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	50	0.006
156	gb|BC104528.1| Bos taurus ribosomal protein L10, mRNA (cDNA clon...	50	0.006
157	dbj|AK151416.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	50	0.006
158	dbj|AK153345.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	50	0.006
159	dbj|AK152123.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	50	0.006
160	dbj|AK168854.1| Mus musculus 17 days embryo heart cDNA, RIKEN fu...	50	0.006
161	dbj|AK166610.1| Mus musculus morula whole body morula cDNA, RIKE...	50	0.006
162	dbj|AK167239.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f...	50	0.006
163	dbj|AK160618.1| Mus musculus 11 days embryo whole body cDNA, RIK...	50	0.006
164	dbj|AK168250.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-...	50	0.006
165	dbj|AK167966.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-...	50	0.006
166	dbj|AK014054.1| Mus musculus 13 days embryo head cDNA, RIKEN ful...	50	0.006
167	dbj|AK088777.1| Mus musculus 2 days neonate thymus thymic cells ...	50	0.006
168	gb|AF143815.1|AF143815 Bos taurus ribosomal protein (QM) mRNA, c...	50	0.006
169	dbj|AK012561.1| Mus musculus 11 days embryo whole body cDNA, RIK...	50	0.006
170	ref|NG_000911.1| Homo sapiens ribosomal protein L10 pseudogene 1...	50	0.006
171	dbj|AK011022.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu...	50	0.006
172	emb|AL115669.1|CNS01CL9 Botrytis cinerea strain T4 cDNA library	50	0.006
173	emb|AL117032.1|CNS01DN4 Botrytis cinerea strain T4 cDNA library	50	0.006
174	emb|AL117016.1|CNS01DMO Botrytis cinerea strain T4 cDNA library	50	0.006
175	emb|AL116010.1|CNS01CUQ Botrytis cinerea strain T4 cDNA library	50	0.006
176	emb|AL116382.1|CNS01D52 Botrytis cinerea strain T4 cDNA library	50	0.006
177	emb|AL116380.1|CNS01D50 Botrytis cinerea strain T4 cDNA library	50	0.006
178	emb|AL115845.1|CNS01CQ5 Botrytis cinerea strain T4 cDNA library	50	0.006
179	emb|AL115361.1|CNS01CCP Botrytis cinerea strain T4 cDNA library	50	0.006
180	emb|AL114727.1|CNS01BV3 Botrytis cinerea strain T4 cDNA library	50	0.006
181	emb|AL114044.1|CNS01BC4 Botrytis cinerea strain T4 cDNA library	50	0.006
182	emb|AL114043.1|CNS01BC3 Botrytis cinerea strain T4 cDNA library	50	0.006
183	emb|AL112807.1|CNS01ADR Botrytis cinerea strain T4 cDNA library	50	0.006
184	emb|AL112775.1|CNS01ACV Botrytis cinerea strain T4 cDNA library	50	0.006
185	emb|AL111608.1|CNS019GG Botrytis cinerea strain T4 cDNA library	50	0.006
186	emb|AL111718.1|CNS019JI Botrytis cinerea strain T4 cDNA library	50	0.006
187	emb|AL111190.1|CNS0194U Botrytis cinerea strain T4 cDNA library	50	0.006
188	gb|AC153942.8| Mus musculus 10 BAC RP24-174M19 (Roswell Park Can...	50	0.006
189	gb|BC092383.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo...	50	0.006
190	gb|AY130414.1| Branchiostoma lanceolatum ribosomal protein L10 m...	50	0.006
191	gb|AY168758.1| Branchiostoma belcheri tsingtaunese ribosomal pro...	50	0.006
192	ref|XM_212832.3| PREDICTED: Rattus norvegicus ribosomal protein ...	50	0.006
193	ref|XM_574109.1| PREDICTED: Rattus norvegicus similar to ribosom...	50	0.006
194	ref|XM_578693.1| PREDICTED: Rattus norvegicus similar to ribosom...	50	0.006
195	gb|AY735455.1| Sus scrofa ribosomal protein L10 mRNA, complete cds	50	0.006
196	gb|AY911380.1| Bos taurus clone IMAGE:7961519 GekBS044P-like mRN...	50	0.006
197	emb|AL512582.7| Mouse DNA sequence from clone RP23-290H11 on chr...	50	0.006
198	dbj|BS000216.1| Pan troglodytes chromosome 22 clone:RP43-057N15,...	50	0.006
199	dbj|AK110755.1| Oryza sativa (japonica cultivar-group) cDNA clon...	50	0.006
200	gb|BC048872.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo...	50	0.006
201	gb|BT021081.1| Bos taurus ribosomal protein L10 (RPL10), mRNA, c...	50	0.006
202	gb|AC141642.4| Mus musculus BAC clone RP23-274K4 from chromosome...	50	0.006
203	dbj|AP001699.1| Homo sapiens genomic DNA, chromosome 21q, sectio...	50	0.006
204	dbj|AP000893.5| Homo sapiens genomic DNA, chromosome 11q, clone:...	50	0.006
205	dbj|AP001767.5| Homo sapiens genomic DNA, chromosome 11 clone:RP...	50	0.006
206	emb|CT573034.8| Mouse DNA sequence from clone RP23-156C20 on chr...	50	0.006
207	gb|AY610342.1| Sus scrofa clone rebs26c_k7.y1.abd, mRNA sequence	50	0.006
208	gb|BC006068.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo...	50	0.006
209	gb|AC131733.3| Mus musculus BAC clone RP23-98C9 from 8, complete...	50	0.006
210	gb|AF013804.1| Pinus taeda Wilm's tumor supressor homolog (lp20)...	50	0.006
211	gb|AC157945.2| Mus musculus BAC clone RP23-289C11 from chromosom...	50	0.006
212	gb|AC161238.7| Mus musculus chromosome 19, clone RP24-288C19, co...	50	0.006
213	gb|M93980.1|MUSADIPCT Mouse 24.6 kda protein mRNA, complete cds	50	0.006
214	dbj|AP001605.1| Homo sapiens genomic DNA, chromosome 21, clone:K...	50	0.006
215	dbj|AP001604.1| Homo sapiens genomic DNA, chromosome 21, clone:K...	50	0.006
216	ref|XM_522844.1| PREDICTED: Pan troglodytes similar to ribosomal...	48	0.024
217	gb|AY769278.1| Bombyx mori ribosomal protein L10 (RpL10) mRNA, c...	48	0.024
218	ref|XM_360593.1| Magnaporthe grisea 70-15 hypothetical protein (...	48	0.024
219	ref|XM_582414.2| PREDICTED: Bos taurus similar to ribosomal prot...	48	0.024
220	gb|BC014310.1| Homo sapiens ribosomal protein L10-like, mRNA (cD...	48	0.024
221	ref|NM_080746.2| Homo sapiens ribosomal protein L10-like (RPL10L...	48	0.024
222	gb|AC140545.26| Medicago truncatula clone mth2-11g18, complete s...	48	0.024
223	emb|BX071887.1|CNS09RMR Single read from an extremity of a full-...	48	0.024
224	emb|BX071440.1|CNS09RAC Single read from an extremity of a full-...	48	0.024
225	emb|BX071439.1|CNS09RAB Single read from an extremity of a full-...	48	0.024
226	emb|BX070864.1|CNS09QUC Single read from an extremity of a full-...	48	0.024
227	emb|BX070863.1|CNS09QUB Single read from an extremity of a full-...	48	0.024
228	emb|BX070583.1|CNS09QMJ Single read from an extremity of a full-...	48	0.024
229	emb|BX070408.1|CNS09QHO Single read from an extremity of a full-...	48	0.024
230	emb|BX070407.1|CNS09QHN Single read from an extremity of a full-...	48	0.024
231	emb|BX070073.1|CNS09Q8D Single read from an extremity of a full-...	48	0.024
232	emb|BX070072.1|CNS09Q8C Single read from an extremity of a full-...	48	0.024
233	emb|BX070039.1|CNS09Q7F Single read from an extremity of a full-...	48	0.024
234	emb|BX070038.1|CNS09Q7E Single read from an extremity of a full-...	48	0.024
235	emb|BX069787.1|CNS09Q0F Single read from an extremity of a full-...	48	0.024
236	emb|BX066234.1|CNS09N9Q Single read from an extremity of a full-...	48	0.024
237	emb|BX066200.1|CNS09N8S Single read from an extremity of a full-...	48	0.024
238	emb|BX065195.1|CNS09MGV Single read from an extremity of a full-...	48	0.024
239	emb|BX065194.1|CNS09MGU Single read from an extremity of a full-...	48	0.024
240	emb|BX065178.1|CNS09MGE Single read from an extremity of a full-...	48	0.024
241	emb|BX065177.1|CNS09MGD Single read from an extremity of a full-...	48	0.024
242	emb|BX065011.1|CNS09MBR Single read from an extremity of a full-...	48	0.024
243	emb|BX065010.1|CNS09MBQ Single read from an extremity of a full-...	48	0.024
244	emb|BX064957.1|CNS09MA9 Single read from an extremity of a full-...	48	0.024
245	emb|BX064956.1|CNS09MA8 Single read from an extremity of a full-...	48	0.024
246	emb|BX064177.1|CNS09LOL Single read from an extremity of a full-...	48	0.024
247	emb|BX064176.1|CNS09LOK Single read from an extremity of a full-...	48	0.024
248	emb|BX063991.1|CNS09LJF Single read from an extremity of a full-...	48	0.024
249	emb|BX063841.1|CNS09LF9 Single read from an extremity of a full-...	48	0.024
250	emb|BX063840.1|CNS09LF8 Single read from an extremity of a full-...	48	0.024
251	emb|BX063569.1|CNS09L7P Single read from an extremity of a full-...	48	0.024
252	emb|BX062882.1|CNS09KOM Single read from an extremity of a full-...	48	0.024
253	emb|BX062815.1|CNS09KMR Single read from an extremity of a full-...	48	0.024
254	emb|BX062474.1|CNS09KDA Single read from an extremity of a full-...	48	0.024
255	emb|BX062455.1|CNS09KCR Single read from an extremity of a full-...	48	0.024
256	emb|BX062454.1|CNS09KCQ Single read from an extremity of a full-...	48	0.024
257	emb|BX061131.1|CNS09JBZ Single read from an extremity of a full-...	48	0.024
258	emb|BX060081.1|CNS09IIT Single read from an extremity of a full-...	48	0.024
259	emb|BX060080.1|CNS09IIS Single read from an extremity of a full-...	48	0.024
260	emb|BX059294.1|CNS09HWY Single read from an extremity of a full-...	48	0.024
261	emb|BX059258.1|CNS09HVY Single read from an extremity of a full-...	48	0.024
262	emb|BX058831.1|CNS09HK3 Single read from an extremity of a full-...	48	0.024
263	emb|BX058215.1|CNS09H2Z Single read from an extremity of a full-...	48	0.024
264	emb|BX057966.1|CNS09GW2 Single read from an extremity of a full-...	48	0.024
265	emb|BX056215.1|CNS09FJF Single read from an extremity of a full-...	48	0.024
266	emb|BX054398.1|CNS09E4Y Single read from an extremity of a full-...	48	0.024
267	emb|BX052529.1|CNS09CP1 Single read from an extremity of a full-...	48	0.024
268	emb|BX051694.1|CNS09C1U Single read from an extremity of a full-...	48	0.024
269	emb|BX051693.1|CNS09C1T Single read from an extremity of a full-...	48	0.024
270	emb|BX051507.1|CNS09BWN Single read from an extremity of a full-...	48	0.024
271	emb|BX050768.1|CNS09BC4 Single read from an extremity of a full-...	48	0.024
272	emb|BX050767.1|CNS09BC3 Single read from an extremity of a full-...	48	0.024
273	emb|BX049897.1|CNS09ANX Single read from an extremity of a full-...	48	0.024
274	emb|BX046497.1|CNS0981H Single read from an extremity of a full-...	48	0.024
275	emb|BX048384.1|CNS099HW Single read from an extremity of a full-...	48	0.024
276	emb|BX048191.1|CNS099CJ Single read from an extremity of a full-...	48	0.024
277	emb|BX047773.1|CNS0990X Single read from an extremity of a full-...	48	0.024
278	emb|BX047772.1|CNS0990W Single read from an extremity of a full-...	48	0.024
279	emb|BX047148.1|CNS098JK Single read from an extremity of a full-...	48	0.024
280	emb|BX045949.1|CNS097M9 Single read from an extremity of a full-...	48	0.024
281	emb|BX045930.1|CNS097LQ Single read from an extremity of a full-...	48	0.024
282	emb|BX045929.1|CNS097LP Single read from an extremity of a full-...	48	0.024
283	emb|BX045069.1|CNS096XT Single read from an extremity of a full-...	48	0.024
284	emb|BX045068.1|CNS096XS Single read from an extremity of a full-...	48	0.024
285	emb|BX044940.1|CNS096U8 Single read from an extremity of a full-...	48	0.024
286	emb|BX044939.1|CNS096U7 Single read from an extremity of a full-...	48	0.024
287	emb|BX045236.1|CNS0972G Single read from an extremity of a full-...	48	0.024
288	emb|BX045235.1|CNS0972F Single read from an extremity of a full-...	48	0.024
289	emb|BX045210.1|CNS0971Q Single read from an extremity of a full-...	48	0.024
290	emb|BX045168.1|CNS0970K Single read from an extremity of a full-...	48	0.024
291	emb|BX045167.1|CNS0970J Single read from an extremity of a full-...	48	0.024
292	emb|BX044818.1|CNS096QU Single read from an extremity of a full-...	48	0.024
293	emb|BX044813.1|CNS096QP Single read from an extremity of a full-...	48	0.024
294	emb|BX044702.1|CNS096NM Single read from an extremity of a full-...	48	0.024
295	emb|BX043998.1|CNS09642 Single read from an extremity of a full-...	48	0.024
296	emb|BX043345.1|CNS095LX Single read from an extremity of a full-...	48	0.024
297	emb|BX043344.1|CNS095LW Single read from an extremity of a full-...	48	0.024
298	emb|BX043332.1|CNS095LK Single read from an extremity of a full-...	48	0.024
299	emb|BX042201.1|CNS094Q5 Single read from an extremity of a full-...	48	0.024
300	emb|BX041060.1|CNS093UG Single read from an extremity of a full-...	48	0.024
301	emb|BX040103.1|CNS0933V Single read from an extremity of a full-...	48	0.024
302	emb|BX039792.1|CNS092V8 Single read from an extremity of a full-...	48	0.024
303	emb|BX035748.1|CNS08ZQW Single read from an extremity of a full-...	48	0.024
304	emb|BX035747.1|CNS08ZQV Single read from an extremity of a full-...	48	0.024
305	emb|BX035295.1|CNS08ZEB Single read from an extremity of a full-...	48	0.024
306	emb|BX033806.1|CNS08Y8Y Single read from an extremity of a full-...	48	0.024
307	emb|BX033805.1|CNS08Y8X Single read from an extremity of a full-...	48	0.024
308	emb|BX032532.1|CNS08X9K Single read from an extremity of a full-...	48	0.024
309	emb|BX027292.1|CNS08T80 Single read from an extremity of a full-...	48	0.024
310	emb|BX027291.1|CNS08T7Z Single read from an extremity of a full-...	48	0.024
311	emb|BX020769.1|CNS08O6T Single read from an extremity of a full-...	48	0.024
312	emb|BX019929.1|CNS08NJH Single read from an extremity of a full-...	48	0.024
313	emb|BX019914.1|CNS08NJ2 Single read from an extremity of a full-...	48	0.024
314	emb|BX011291.1|CNS08GVJ Single read from an extremity of a full-...	48	0.024
315	emb|BX011290.1|CNS08GVI Single read from an extremity of a full-...	48	0.024
316	emb|BX011211.1|CNS08GTB Single read from an extremity of a full-...	48	0.024
317	emb|BX010775.1|CNS08GH7 Single read from an extremity of a full-...	48	0.024
318	emb|BX010321.1|CNS08G4L Single read from an extremity of a full-...	48	0.024
319	emb|BX010320.1|CNS08G4K Single read from an extremity of a full-...	48	0.024
320	emb|BX010145.1|CNS08FZP Single read from an extremity of a full-...	48	0.024
321	emb|BX008868.1|CNS08F08 Single read from an extremity of a full-...	48	0.024
322	emb|BX008784.1|CNS08EXW Single read from an extremity of a full-...	48	0.024
323	emb|BX007961.1|CNS08EB1 Single read from an extremity of a full-...	48	0.024
324	emb|BX006619.1|CNS08D9R Single read from an extremity of a full-...	48	0.024
325	gb|BC066312.1| Homo sapiens ribosomal protein L10-like, mRNA (cD...	48	0.024
326	dbj|AB195817.1| Coprinopsis cinerea dst1 gene for hypothetical p...	48	0.024
327	gb|BC109561.1| Bos taurus cDNA clone MGC:133542 IMAGE:8051598, c...	48	0.024
328	dbj|AB063608.1| Homo sapiens RPL10L mRNA for ribosomal protein L...	48	0.024
329	gb|AF395838.1|AF395838 Bombyx mori QM protein (QM) mRNA, complet...	48	0.024
330	dbj|AK130863.1| Homo sapiens cDNA FLJ27353 fis, clone TST05348, ...	48	0.024
331	ref|XM_309144.2| Anopheles gambiae str. PEST ENSANGP00000023750 ...	48	0.024
332	ref|XM_560169.1| Anopheles gambiae str. PEST ENSANGP00000029269 ...	48	0.024
333	emb|AL591769.3|CNS07EGM Human chromosome 14 DNA sequence BAC R-6...	48	0.024
334	gb|AF099012.1|AF099012 Bombyx mandarina QM protein mRNA, complet...	48	0.024
335	gb|AY850340.1| Magnaporthe grisea 60S ribosomal protein L10-A-li...	48	0.024
336	emb|AL591768.2|CNS07EGL Human chromosome 14 DNA sequence BAC R-2...	48	0.024
337	ref|XM_955693.1| Neurospora crassa OR74A hypothetical protein (N...	46	0.095
338	ref|XM_331355.1| Neurospora crassa OR74A hypothetical protein (N...	46	0.095
339	emb|BX054819.1|CNS09EGN Single read from an extremity of a full-...	46	0.095
340	emb|BX035296.1|CNS08ZEC Single read from an extremity of a full-...	46	0.095
341	emb|BX018994.1|CNS08MTI Single read from an extremity of a full-...	46	0.095
342	emb|BX014897.1|CNS08JNP Single read from an extremity of a full-...	46	0.095
343	emb|BX014896.1|CNS08JNO Single read from an extremity of a full-...	46	0.095
344	dbj|AK119983.1| Oryza sativa (japonica cultivar-group) cDNA clon...	46	0.095
345	gb|AC094668.10| Rattus norvegicus BAC CH230-5F18 (Children's Ho...	44	0.38
346	gb|AC091473.2| Mus musculus chromosome X clones RP21-114F21, RP2...	44	0.38
347	ref|XM_586876.2| PREDICTED: Bos taurus similar to ribosomal prot...	44	0.38
348	ref|XM_862539.1| PREDICTED: Canis familiaris similar to ribosoma...	44	0.38
349	ref|XM_862492.1| PREDICTED: Canis familiaris similar to ribosoma...	44	0.38
350	ref|XM_750162.1| Aspergillus fumigatus Af293 ribosomal protein L...	44	0.38
351	emb|Z48334.1|CEF10B5 Caenorhabditis elegans Cosmid F10B5, comple...	44	0.38
352	gb|AC126264.3| Mus musculus BAC clone RP23-376F13 from chromosom...	44	0.38
353	emb|AM049016.1| Biphyllus lunatus mRNA for ribosomal protein L10...	44	0.38
354	emb|BX045950.1|CNS097MA Single read from an extremity of a full-...	44	0.38
355	emb|BX031115.1|CNS08W67 Single read from an extremity of a full-...	44	0.38
356	gb|AY927536.1| Homo sapiens mRNA sequence	44	0.38
357	gb|AC103566.1| Caenorhabditis briggsae cosmid CB024E07, complete...	44	0.38
358	ref|NM_063306.2| Caenorhabditis elegans Ribosomal Protein, Large...	44	0.38
359	dbj|AB180439.1| Plutella xylostella mRNA for QM protein, complet...	44	0.38
360	gb|BT021505.1| Bos taurus similar to 60S ribosomal protein L10 (...	44	0.38
361	emb|AL807376.4| Mouse DNA sequence from clone RP23-436K3 on chro...	44	0.38
362	gb|AY794382.1| Valeriana sorbifolia trnK gene, intron; chloroplast	42	1.5
363	gb|AY794360.1| Valeriana nivalis trnK gene, intron; chloroplast	42	1.5
364	gb|AY650303.1| Macaca fascicularis ribosomal protein L10 mRNA, p...	42	1.5
365	ref|XM_528647.1| PREDICTED: Pan troglodytes similar to ribosomal...	42	1.5
366	ref|XM_521341.1| PREDICTED: Pan troglodytes similar to ribosomal...	42	1.5
367	ref|XM_524123.1| PREDICTED: Pan troglodytes similar to ribosomal...	42	1.5
368	ref|XM_512043.1| PREDICTED: Pan troglodytes similar to ribosomal...	42	1.5
369	ref|XM_518178.1| PREDICTED: Pan troglodytes LOC462360 (LOC462360...	42	1.5
370	ref|XM_518096.1| PREDICTED: Pan troglodytes similar to nucleopho...	42	1.5
371	ref|XM_516069.1| PREDICTED: Pan troglodytes similar to ribosomal...	42	1.5
372	gb|AC022775.16| Mus musculus chromosome 15, clone RP23-71O17, co...	42	1.5
373	gb|AY763500.1| Danio rerio QM protein (QM) mRNA, complete cds	42	1.5
374	ref|XM_866276.1| PREDICTED: Bos taurus similar to ribosomal prot...	42	1.5
375	ref|XM_867452.1| PREDICTED: Bos taurus similar to ribosomal prot...	42	1.5
376	ref|XM_597663.2| PREDICTED: Bos taurus similar to Ca2+-dependent...	42	1.5
377	gb|BC003358.1| Homo sapiens ribosomal protein L10, mRNA (cDNA cl...	42	1.5
378	ref|XM_599768.2| PREDICTED: Bos taurus similar to PHD finger pro...	42	1.5
379	ref|XM_549290.1| PREDICTED: Canis familiaris similar to ribosoma...	42	1.5
380	ref|XM_894175.2| PREDICTED: Mus musculus similar to ribosomal pr...	42	1.5
381	ref|XM_849448.1| PREDICTED: Canis familiaris similar to ribosoma...	42	1.5
382	ref|XM_980214.1| PREDICTED: Mus musculus similar to 60S ribosoma...	42	1.5
383	ref|XR_003944.1| PREDICTED: Mus musculus similar to ribosomal pr...	42	1.5
384	ref|XM_980331.1| PREDICTED: Mus musculus similar to 60S ribosoma...	42	1.5
385	ref|XM_001004982.1| PREDICTED: Mus musculus similar to 60S ribos...	42	1.5
386	ref|XM_390422.1| Gibberella zeae PH-1 chromosome 1 hypothetical ...	42	1.5
387	gb|AC007610.10| Homo sapiens chromosome 16 clone RP11-429P3, com...	42	1.5
388	gb|AC121831.3| Mus musculus BAC clone RP24-66F17 from chromosome...	42	1.5
389	ref|NM_006013.2| Homo sapiens ribosomal protein L10 (RPL10), mRNA	42	1.5
390	ref|XM_762783.1| Giardia lamblia ATCC 50803 hypothetical protein...	42	1.5
391	ref|XM_762784.1| Giardia lamblia ATCC 50803 60S ribosomal protei...	42	1.5
392	gb|BC015682.1| Homo sapiens cDNA clone IMAGE:4651465, **** WARNI...	42	1.5
393	gb|BC015618.1| Homo sapiens cDNA clone IMAGE:4841291, **** WARNI...	42	1.5
394	gb|AF548013.1| Spodoptera frugiperda QM protein mRNA, partial cds	42	1.5
395	ref|XM_782761.1| PREDICTED: Strongylocentrotus purpuratus simila...	42	1.5
396	emb|AL159163.40| Human DNA sequence from clone RP11-514O12 on ch...	42	1.5
397	emb|BX052495.1|CNS09CO3 Single read from an extremity of a full-...	42	1.5
398	emb|BX052494.1|CNS09CO2 Single read from an extremity of a full-...	42	1.5
399	emb|X87106.1|RNRPL10 R.norvegicus mRNA for ribosomal protein L10	42	1.5
400	emb|CR859565.1| Pongo pygmaeus mRNA; cDNA DKFZp468J045 (from clo...	42	1.5
401	gb|AC010653.10| Homo sapiens chromosome 16 clone RP11-417N10, co...	42	1.5
402	gb|AC010422.7| Homo sapiens chromosome 19 clone CTD-2192J16, com...	42	1.5
403	gb|AC008752.6| Homo sapiens chromosome 19 clone CTD-2623N2, comp...	42	1.5
404	emb|CR621751.1| full-length cDNA clone CS0DL002YD15 of B cells (...	42	1.5
405	emb|CR622051.1| full-length cDNA clone CS0DI035YF15 of Placenta ...	42	1.5
406	emb|CR614538.1| full-length cDNA clone CS0DJ007YD04 of T cells (...	42	1.5
407	emb|CR614058.1| full-length cDNA clone CS0DJ011YG02 of T cells (...	42	1.5
408	emb|CR612141.1| full-length cDNA clone CS0DB006YN08 of Neuroblas...	42	1.5
409	emb|CR610011.1| full-length cDNA clone CS0DH003YI21 of T cells (...	42	1.5
410	emb|CR603980.1| full-length cDNA clone CS0DM012YA22 of Fetal liv...	42	1.5
411	emb|CR602212.1| full-length cDNA clone CS0DC001YA10 of Neuroblas...	42	1.5
412	emb|CR598560.1| full-length cDNA clone CS0DF019YC14 of Fetal bra...	42	1.5
413	emb|CR596460.1| full-length cDNA clone CS0DF006YM08 of Fetal bra...	42	1.5
414	emb|CR596152.1| full-length cDNA clone CS0DJ006YD12 of T cells (...	42	1.5
415	emb|CR593302.1| full-length cDNA clone CS0DI087YC07 of Placenta ...	42	1.5
416	gb|AC008590.6| Homo sapiens chromosome 5 clone CTC-575D19, compl...	42	1.5
417	gb|AF486812.1| Homo sapiens ribosomal protein L10 (QM) mRNA, com...	42	1.5
418	gb|AC013603.17| Homo sapiens, clone RP11-10D7, complete sequence	42	1.5
419	gb|AC093246.3| Homo sapiens chromosome 5 clone RP11-117L6, compl...	42	1.5
420	gb|AC091980.4| Homo sapiens chromosome 5 clone RP11-546B8, compl...	42	1.5
421	ref|XM_944324.1| PREDICTED: Homo sapiens similar to ribosomal pr...	42	1.5
422	ref|XM_944319.1| PREDICTED: Homo sapiens similar to ribosomal pr...	42	1.5
423	ref|XM_939745.1| PREDICTED: Homo sapiens similar to ribosomal pr...	42	1.5
424	ref|XM_944311.1| PREDICTED: Homo sapiens similar to ribosomal pr...	42	1.5
425	ref|XM_934706.1| PREDICTED: Homo sapiens similar to ribosomal pr...	42	1.5
426	ref|XM_934705.1| PREDICTED: Homo sapiens similar to ribosomal pr...	42	1.5
427	ref|XM_209178.5| PREDICTED: Homo sapiens similar to ribosomal pr...	42	1.5
428	ref|XM_934704.1| PREDICTED: Homo sapiens similar to ribosomal pr...	42	1.5
429	ref|XM_373233.3| PREDICTED: Homo sapiens similar to 60S ribosoma...	42	1.5
430	ref|XM_686253.1| PREDICTED: Danio rerio similar to Ribosomal pro...	42	1.5
431	ref|XM_941010.1| PREDICTED: Homo sapiens similar to 60S ribosoma...	42	1.5
432	ref|XM_945800.1| PREDICTED: Homo sapiens similar to ribosomal pr...	42	1.5
433	ref|XM_945799.1| PREDICTED: Homo sapiens similar to ribosomal pr...	42	1.5
434	ref|XM_945798.1| PREDICTED: Homo sapiens similar to ribosomal pr...	42	1.5
435	ref|XM_942217.1| PREDICTED: Homo sapiens similar to ribosomal pr...	42	1.5
436	ref|XM_945797.1| PREDICTED: Homo sapiens similar to ribosomal pr...	42	1.5
437	ref|XM_928025.1| PREDICTED: Homo sapiens similar to 60S ribosoma...	42	1.5
438	ref|XM_371781.3| PREDICTED: Homo sapiens similar to ribosomal pr...	42	1.5
439	ref|XM_931535.1| PREDICTED: Homo sapiens similar to ribosomal pr...	42	1.5
440	ref|XM_931532.1| PREDICTED: Homo sapiens similar to ribosomal pr...	42	1.5
441	ref|XM_931525.1| PREDICTED: Homo sapiens similar to ribosomal pr...	42	1.5
442	ref|XM_931519.1| PREDICTED: Homo sapiens similar to ribosomal pr...	42	1.5
443	ref|XM_926723.1| PREDICTED: Homo sapiens similar to ribosomal pr...	42	1.5
444	ref|XM_931512.1| PREDICTED: Homo sapiens similar to ribosomal pr...	42	1.5
445	gb|AC175195.2| Sporobolomyces roseus clone JGIBAIF-17H21, comple...	42	1.5
446	emb|CR542069.1| Homo sapiens full open reading frame cDNA clone ...	42	1.5
447	emb|CR456797.1| Homo sapiens full open reading frame cDNA clone ...	42	1.5
448	dbj|AB168679.1| Macaca fascicularis testis cDNA clone: QtsA-1410...	42	1.5
449	dbj|AB178981.1| Macaca fascicularis testis cDNA clone: QtsA-1084...	42	1.5
450	gb|S35960.1| laminin receptor homolog {3' region} [human, mRNA P...	42	1.5
451	gb|BC045950.1| Danio rerio ribosomal protein L10, mRNA (cDNA clo...	42	1.5
452	gb|DQ369716.1| Homo sapiens cell-line BT-20 QM protein mRNA, com...	42	1.5
453	gb|DQ369715.1| Homo sapiens cell-line FG (Colo357 F.S) QM protei...	42	1.5
454	gb|DQ369714.1| Homo sapiens cell-line PC3 QM protein mRNA, compl...	42	1.5
455	gb|DQ369713.1| Homo sapiens clone Ove-203Asn QM protein isoform ...	42	1.5
456	gb|DQ369712.1| Homo sapiens cell-line BxPC3 QM protein mRNA, com...	42	1.5
457	gb|DQ369711.1| Homo sapiens cell-line PI QM protein mRNA, comple...	42	1.5
458	gb|DQ369710.1| Homo sapiens cell-line HPAC QM protein mRNA, comp...	42	1.5
459	gb|DQ369709.1| Homo sapiens cell-line PANC28 QM protein mRNA, co...	42	1.5
460	gb|DQ369708.1| Homo sapiens cell-line PANC1 QM protein mRNA, com...	42	1.5
461	gb|DQ369707.1| Homo sapiens cell-line T46D QM protein mRNA, comp...	42	1.5
462	gb|DQ369706.1| Homo sapiens cell-line MCF-7 QM protein mRNA, com...	42	1.5
463	gb|DQ369705.1| Homo sapiens cell-line OVCAR QM protein mRNA, com...	42	1.5
464	gb|DQ369704.1| Homo sapiens clone Ove-202Ser QM protein isoform ...	42	1.5
465	gb|DQ369703.1| Homo sapiens cell-line MDAMB 231 QM protein mRNA,...	42	1.5
466	ref|NM_200027.1| Danio rerio ribosomal protein L10 (rpl10), mRNA	42	1.5
467	gb|AC019176.4|AC019176 Homo sapiens BAC clone RP11-221H10 from 8...	42	1.5
468	gb|AC155657.8| Mus musculus 6 BAC RP24-113L15 (Roswell Park Canc...	42	1.5
469	gb|AC009097.9| Homo sapiens chromosome 16 clone RP11-432I5, comp...	42	1.5
470	gb|AC007597.3|AC007597 Homo sapiens chromosome 16 clone RP11-137...	42	1.5
471	ref|NM_031100.1| Rattus norvegicus ribosomal protein L10 (Rpl10)...	42	1.5
472	ref|XM_234245.2| PREDICTED: Rattus norvegicus ribosomal protein ...	42	1.5
473	ref|XM_575130.1| PREDICTED: Rattus norvegicus similar to ribosom...	42	1.5
474	ref|XM_345291.2| PREDICTED: Rattus norvegicus similar to 60S rib...	42	1.5
475	emb|AL162451.16| Human DNA sequence from clone RP11-145C1, compl...	42	1.5
476	gb|AY891756.1| Synthetic construct Homo sapiens clone FLH016426....	42	1.5
477	gb|AY889257.1| Synthetic construct Homo sapiens clone FLH016430....	42	1.5
478	emb|AL806515.7| Mouse DNA sequence from clone RP23-434M18 on chr...	42	1.5
479	dbj|AK026568.1| Homo sapiens cDNA: FLJ22915 fis, clone KAT06354,...	42	1.5
480	dbj|AK130582.1| Homo sapiens cDNA FLJ27072 fis, clone SPL01818, ...	42	1.5
481	gb|AY894061.1| Synthetic construct Homo sapiens clone FLH131216....	42	1.5
482	gb|BC071918.1| Homo sapiens ribosomal protein L10, mRNA (cDNA cl...	42	1.5
483	gb|AC155233.2| Mus musculus BAC clone RP24-381F23 from 12, compl...	42	1.5
484	emb|AJ634060.2| Bacillus amyloliquefaciens bae gene cluster dire...	42	1.5
485	emb|AL824710.10| Mouse DNA sequence from clone RP23-35E16 on chr...	42	1.5
486	gb|BC026276.1| Homo sapiens ribosomal protein L10, mRNA (cDNA cl...	42	1.5
487	emb|AL808123.9| Mouse DNA sequence from clone RP23-73K21 on chro...	42	1.5
488	emb|CT027663.2| Medicago truncatula chromosome 5 clone mth2-139g...	42	1.5
489	dbj|AP005431.3| Homo sapiens genomic DNA, chromosome 18 clone:RP...	42	1.5
490	emb|AL590418.16| Mouse DNA sequence from clone RP23-206I14 on ch...	42	1.5
491	gb|M64241.1|HUMQM Human Wilm's tumor-related protein (QM) mRNA, ...	42	1.5
492	emb|AL844495.6| Mouse DNA sequence from clone RP23-252L9 on chro...	42	1.5
493	gb|M73791.1|HUMNOVGENE Human novel gene mRNA, complete cds	42	1.5
494	ref|XM_522476.1| PREDICTED: Pan troglodytes similar to 60S ribos...	40	5.9
495	ref|XM_522460.1| PREDICTED: Pan troglodytes similar to ribosomal...	40	5.9
496	ref|XM_522544.1| PREDICTED: Pan troglodytes similar to ribosomal...	40	5.9
497	ref|XM_528403.1| PREDICTED: Pan troglodytes similar to astrotact...	40	5.9
498	ref|XM_525890.1| PREDICTED: Pan troglodytes LOC470509 (LOC470509...	40	5.9
499	gb|AC146536.3| Dasypus novemcinctus clone VMRC5-215B23, complete...	40	5.9
500	gb|BC075477.1| Xenopus tropicalis MGC89303 protein, mRNA (cDNA c...	40	5.9

---

>dbj|AK120033.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-188-A02, full
           insert sequence
          Length = 906

 Score =  216 bits (109), Expect = 5e-53
 Identities = 193/221 (87%)
 Strand = Plus / Minus

                                                                       
Query: 211 ccatggcatccgagcagcttagcattgactccatcaggcaagaccctgccctcactcttg 270
           |||||||| || || |||||||||||||| |||||||||| ||  || ||||| ||||| 
Sbjct: 670 ccatggcaaccaagtagcttagcattgacaccatcaggcatgattctaccctcgctctta 611

                                                                       
Query: 271 aacttgaggtagtcattgcggttgaacttggtgaaaccccacttcctgctctcaatgatc 330
           | | ||| ||| |||| |||| |||||||||||||||||||||| || ||||||||||||
Sbjct: 610 agcctgacgtattcatcgcggctgaacttggtgaaaccccactttctactctcaatgatc 551

                                                                       
Query: 331 ttttggcgaccagggaacttgaacttggcacgacaaaaagcctcagttgcatggatggca 390
           ||||||||||||||||||||||||||||||||||  |  || ||  | |||||||  |||
Sbjct: 550 ttttggcgaccagggaacttgaacttggcacgacggagggcttcgctggcatggacagca 491

                                                    
Query: 391 ttgttgggcttgcaccgcacagaaaggaggacctggccaat 431
           |||||||||||||||||||||||||||||||||||||||||
Sbjct: 490 ttgttgggcttgcaccgcacagaaaggaggacctggccaat 450

---

>emb|X64621.1|OSR22CDNA O.sativa R22 mRNA
          Length = 629

 Score =  216 bits (109), Expect = 5e-53
 Identities = 193/221 (87%)
 Strand = Plus / Minus

                                                                       
Query: 211 ccatggcatccgagcagcttagcattgactccatcaggcaagaccctgccctcactcttg 270
           |||||||| || || |||||||||||||| |||||||||| ||  || ||||| ||||| 
Sbjct: 383 ccatggcaaccaagtagcttagcattgacaccatcaggcatgattctaccctcgctctta 324

                                                                       
Query: 271 aacttgaggtagtcattgcggttgaacttggtgaaaccccacttcctgctctcaatgatc 330
           | | ||| ||| |||| |||| |||||||||||||||||||||| || ||||||||||||
Sbjct: 323 agcctgacgtattcatcgcggctgaacttggtgaaaccccactttctactctcaatgatc 264

                                                                       
Query: 331 ttttggcgaccagggaacttgaacttggcacgacaaaaagcctcagttgcatggatggca 390
           ||||||||||||||||||||||||||||||||||  |  || ||  | |||||||  |||
Sbjct: 263 ttttggcgaccagggaacttgaacttggcacgacggagggcttcgctggcatggacagca 204

                                                    
Query: 391 ttgttgggcttgcaccgcacagaaaggaggacctggccaat 431
           |||||||||||||||||||||||||||||||||||||||||
Sbjct: 203 ttgttgggcttgcaccgcacagaaaggaggacctggccaat 163

---

>dbj|AK066128.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013052E20, full
           insert sequence
          Length = 910

 Score =  216 bits (109), Expect = 5e-53
 Identities = 193/221 (87%)
 Strand = Plus / Minus

                                                                       
Query: 211 ccatggcatccgagcagcttagcattgactccatcaggcaagaccctgccctcactcttg 270
           |||||||| || || |||||||||||||| |||||||||| ||  || ||||| ||||| 
Sbjct: 674 ccatggcaaccaagtagcttagcattgacaccatcaggcatgattctaccctcgctctta 615

                                                                       
Query: 271 aacttgaggtagtcattgcggttgaacttggtgaaaccccacttcctgctctcaatgatc 330
           | | ||| ||| |||| |||| |||||||||||||||||||||| || ||||||||||||
Sbjct: 614 agcctgacgtattcatcgcggctgaacttggtgaaaccccactttctactctcaatgatc 555

                                                                       
Query: 331 ttttggcgaccagggaacttgaacttggcacgacaaaaagcctcagttgcatggatggca 390
           ||||||||||||||||||||||||||||||||||  |  || ||  | |||||||  |||
Sbjct: 554 ttttggcgaccagggaacttgaacttggcacgacggagggcttcgctggcatggacagca 495

                                                    
Query: 391 ttgttgggcttgcaccgcacagaaaggaggacctggccaat 431
           |||||||||||||||||||||||||||||||||||||||||
Sbjct: 494 ttgttgggcttgcaccgcacagaaaggaggacctggccaat 454

---

>dbj|AK062208.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-H08, full
           insert sequence
          Length = 555

 Score =  216 bits (109), Expect = 5e-53
 Identities = 193/221 (87%)
 Strand = Plus / Minus

                                                                       
Query: 211 ccatggcatccgagcagcttagcattgactccatcaggcaagaccctgccctcactcttg 270
           |||||||| || || |||||||||||||| |||||||||| ||  || ||||| ||||| 
Sbjct: 319 ccatggcaaccaagtagcttagcattgacaccatcaggcatgattctaccctcgctctta 260

                                                                       
Query: 271 aacttgaggtagtcattgcggttgaacttggtgaaaccccacttcctgctctcaatgatc 330
           | | ||| ||| |||| |||| |||||||||||||||||||||| || ||||||||||||
Sbjct: 259 agcctgacgtattcatcgcggctgaacttggtgaaaccccactttctactctcaatgatc 200

                                                                       
Query: 331 ttttggcgaccagggaacttgaacttggcacgacaaaaagcctcagttgcatggatggca 390
           ||||||||||||||||||||||||||||||||||  |  || ||  | |||||||  |||
Sbjct: 199 ttttggcgaccagggaacttgaacttggcacgacggagggcttcgctggcatggacagca 140

                                                    
Query: 391 ttgttgggcttgcaccgcacagaaaggaggacctggccaat 431
           |||||||||||||||||||||||||||||||||||||||||
Sbjct: 139 ttgttgggcttgcaccgcacagaaaggaggacctggccaat 99

---

>ref|XM_476047.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 618

 Score =  206 bits (104), Expect = 4e-50
 Identities = 179/204 (87%)
 Strand = Plus / Minus

                                                                       
Query: 228 cttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtagtcatt 287
           |||||||||||| |||||||||| ||  || ||||| ||||| | | ||| ||| |||| 
Sbjct: 594 cttagcattgacaccatcaggcatgattctaccctcgctcttaagcctgacgtattcatc 535

                                                                       
Query: 288 gcggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaa 347
           |||| |||||||||||||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 534 gcggctgaacttggtgaaaccccactttctactctcaatgatcttttggcgaccagggaa 475

                                                                       
Query: 348 cttgaacttggcacgacaaaaagcctcagttgcatggatggcattgttgggcttgcaccg 407
           |||||||||||||||||  |  || ||  | |||||||  ||||||||||||||||||||
Sbjct: 474 cttgaacttggcacgacggagggcttcgctggcatggacagcattgttgggcttgcaccg 415

                                   
Query: 408 cacagaaaggaggacctggccaat 431
           ||||||||||||||||||||||||
Sbjct: 414 cacagaaaggaggacctggccaat 391

---

>gb|BT016528.1| Zea mays clone Contig361 mRNA sequence
          Length = 814

 Score =  153 bits (77), Expect = 6e-34
 Identities = 179/213 (84%)
 Strand = Plus / Minus

                                                                       
Query: 220 ccgagcagcttagcattgactccatcaggcaagaccctgccctcactcttgaacttgagg 279
           ||||||||||| || ||||| |||||||| |  |  |||||||| |||||| |||| |||
Sbjct: 586 ccgagcagctttgcgttgacaccatcaggaacaattctgccctcgctcttgtacttcagg 527

                                                                       
Query: 280 tagtcattgcggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcga 339
           ||||||  |||| ||||||||||||| |||||||| ||||||||||||||||||||||| 
Sbjct: 526 tagtcagcgcggctgaacttggtgaagccccactttctgctctcaatgatcttttggcgg 467

                                                                       
Query: 340 ccagggaacttgaacttggcacgacaaaaagcctcagttgcatggatggcattgttgggc 399
           ||||||||||||||||| || ||||  | ||| ||  | ||||||   |||||||||  |
Sbjct: 466 ccagggaacttgaacttagcgcgacgcagagcttcgctggcatgggcagcattgttgtcc 407

                                            
Query: 400 ttgcaccgcacagaaaggaggacctggccaatg 432
           ||||| ||||| |||||||||||||| ||||||
Sbjct: 406 ttgcatcgcacggaaaggaggacctgaccaatg 374

---

>gb|AF470356.1| Triticum aestivum QM mRNA, partial cds
          Length = 537

 Score =  151 bits (76), Expect = 2e-33
 Identities = 107/117 (91%), Gaps = 1/117 (0%)
 Strand = Plus / Minus

                                                                       
Query: 322 tcaatgatcttttggcgaccagggaa-cttgaacttggcacgacaaaaagcctcagttgc 380
           ||||| ||||| ||||| |||||||| ||||||||||||||||  ||  |||||||| ||
Sbjct: 537 tcaatnatcttntggcggccagggaancttgaacttggcacgangaagggcctcagtggc 478

                                                                    
Query: 381 atggatggcattgttgggcttgcaccgcacagaaaggaggacctggccaatggcaac 437
           ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 477 atggatggcattgttgggcttgcaccgcacagaaaggaggacctgcccaatggcaac 421

---

>gb|AC084817.5| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0419C04,
             complete sequence
          Length = 136713

 Score =  149 bits (75), Expect = 9e-33
 Identities = 111/123 (90%)
 Strand = Plus / Minus

                                                                         
Query: 309   ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacaaaa 368
             |||||| || ||||||||||||||||||||||||||||||||||||||||||||||  | 
Sbjct: 59031 ccactttctactctcaatgatcttttggcgaccagggaacttgaacttggcacgacggag 58972

                                                                         
Query: 369   agcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctggcc 428
              || ||  | |||||||  |||||||||||||||||||||||||||||||||||||||||
Sbjct: 58971 ggcttcgctggcatggacagcattgttgggcttgcaccgcacagaaaggaggacctggcc 58912

                
Query: 429   aat 431
             |||
Sbjct: 58911 aat 58909



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                         
Query: 228   cttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtagtcatt 287
             |||||||||||| |||||||||| ||  || ||||| ||||| | | ||| ||| |||| 
Sbjct: 59216 cttagcattgacaccatcaggcatgattctaccctcgctcttaagcctgacgtattcatc 59157

                                    
Query: 288   gcggttgaacttggtgaaacccc 310
             |||| ||||||||||||||||||
Sbjct: 59156 gcggctgaacttggtgaaacccc 59134

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score =  149 bits (75), Expect = 9e-33
 Identities = 111/123 (90%)
 Strand = Plus / Minus

                                                                           
Query: 309     ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacaaaa 368
               |||||| || ||||||||||||||||||||||||||||||||||||||||||||||  | 
Sbjct: 4084337 ccactttctactctcaatgatcttttggcgaccagggaacttgaacttggcacgacggag 4084278

                                                                           
Query: 369     agcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctggcc 428
                || ||  | |||||||  |||||||||||||||||||||||||||||||||||||||||
Sbjct: 4084277 ggcttcgctggcatggacagcattgttgggcttgcaccgcacagaaaggaggacctggcc 4084218

                  
Query: 429     aat 431
               |||
Sbjct: 4084217 aat 4084215



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                           
Query: 228     cttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtagtcatt 287
               |||||||||||| |||||||||| ||  || ||||| ||||| | | ||| ||| |||| 
Sbjct: 4084522 cttagcattgacaccatcaggcatgattctaccctcgctcttaagcctgacgtattcatc 4084463

                                      
Query: 288     gcggttgaacttggtgaaacccc 310
               |||| ||||||||||||||||||
Sbjct: 4084462 gcggctgaacttggtgaaacccc 4084440

---

>emb|X81692.1|OSSG12G O.sativa SG12 gene
          Length = 1734

 Score =  149 bits (75), Expect = 9e-33
 Identities = 111/123 (90%)
 Strand = Plus / Minus

                                                                        
Query: 309  ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacaaaa 368
            |||||| || ||||||||||||||||||||||||||||||||||||||||||||||  | 
Sbjct: 1120 ccactttctactctcaatgatcttttggcgaccagggaacttgaacttggcacgacggag 1061

                                                                        
Query: 369  agcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctggcc 428
             || ||  | |||||||  |||||||||||||||||||||||||||||||||||||||||
Sbjct: 1060 ggcttcgctggcatggacagcattgttgggcttgcaccgcacagaaaggaggacctggcc 1001

               
Query: 429  aat 431
            |||
Sbjct: 1000 aat 998



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                        
Query: 228  cttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtagtcatt 287
            |||||||||||| |||||||||| ||  || ||||| ||||| | | ||| ||| |||| 
Sbjct: 1307 cttagcattgacaccatcaggcatgattctaccctcgctcttaagcctgacgtattcatc 1248

                                   
Query: 288  gcggttgaacttggtgaaacccc 310
            |||| ||||||||||||||||||
Sbjct: 1247 gcggctgaacttggtgaaacccc 1225

---

>gb|U55048.1|OSU55048 Oryza sativa QM gene, complete cds
          Length = 2542

 Score =  149 bits (75), Expect = 9e-33
 Identities = 111/123 (90%)
 Strand = Plus / Minus

                                                                        
Query: 309  ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacaaaa 368
            |||||| || ||||||||||||||||||||||||||||||||||||||||||||||  | 
Sbjct: 1862 ccactttctactctcaatgatcttttggcgaccagggaacttgaacttggcacgacggag 1803

                                                                        
Query: 369  agcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctggcc 428
             || ||  | |||||||  |||||||||||||||||||||||||||||||||||||||||
Sbjct: 1802 ggcttcgctggcatggacagcattgttgggcttgcaccgcacagaaaggaggacctggcc 1743

               
Query: 429  aat 431
            |||
Sbjct: 1742 aat 1740



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                        
Query: 228  cttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtagtcatt 287
            |||||||||||| |||||||||| ||  || ||||| ||||| | | ||| ||| |||| 
Sbjct: 2047 cttagcattgacaccatcaggcatgattctaccctcgctcttaagcctgacgtattcatc 1988

                                   
Query: 288  gcggttgaacttggtgaaacccc 310
            |||| ||||||||||||||||||
Sbjct: 1987 gcggctgaacttggtgaaacccc 1965

---

>gb|BT016423.1| Zea mays clone Contig256 mRNA sequence
          Length = 959

 Score =  137 bits (69), Expect = 3e-29
 Identities = 177/213 (83%)
 Strand = Plus / Minus

                                                                       
Query: 220 ccgagcagcttagcattgactccatcaggcaagaccctgccctcactcttgaacttgagg 279
           ||||||||||| || ||||| |||||||| |  |  || |||||||||||| |||| |||
Sbjct: 656 ccgagcagctttgcgttgacaccatcaggaacaattctaccctcactcttgtacttcagg 597

                                                                       
Query: 280 tagtcattgcggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcga 339
           |||||    ||| ||||||||||||| |||||||| ||||||||||| ||||||||||| 
Sbjct: 596 tagtcggcacggctgaacttggtgaagccccactttctgctctcaataatcttttggcgg 537

                                                                       
Query: 340 ccagggaacttgaacttggcacgacaaaaagcctcagttgcatggatggcattgttgggc 399
           |||||||||||||||||||| ||||  | ||| ||| | |||||    |||||||||  |
Sbjct: 536 ccagggaacttgaacttggcgcgacgcagagcttcactggcatgtgcagcattgttgtcc 477

                                            
Query: 400 ttgcaccgcacagaaaggaggacctggccaatg 432
           ||||| || ||||||||||||||||| ||||||
Sbjct: 476 ttgcatcgaacagaaaggaggacctgaccaatg 444

---

>gb|AY103671.1| Zea mays PCO135454 mRNA sequence
          Length = 1044

 Score =  137 bits (69), Expect = 3e-29
 Identities = 177/213 (83%)
 Strand = Plus / Minus

                                                                       
Query: 220 ccgagcagcttagcattgactccatcaggcaagaccctgccctcactcttgaacttgagg 279
           ||||||||||| || ||||| |||||||| |  |  || |||||||||||| |||| |||
Sbjct: 700 ccgagcagctttgcgttgacaccatcaggaacaattctaccctcactcttgtacttcagg 641

                                                                       
Query: 280 tagtcattgcggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcga 339
           |||||    ||| ||||||||||||| |||||||| ||||||||||| ||||||||||| 
Sbjct: 640 tagtcggcacggctgaacttggtgaagccccactttctgctctcaataatcttttggcgg 581

                                                                       
Query: 340 ccagggaacttgaacttggcacgacaaaaagcctcagttgcatggatggcattgttgggc 399
           |||||||||||||||||||| ||||  | ||| ||| | |||||    |||||||||  |
Sbjct: 580 ccagggaacttgaacttggcgcgacgcagagcttcactggcatgtgcagcattgttgtcc 521

                                            
Query: 400 ttgcaccgcacagaaaggaggacctggccaatg 432
           ||||| || ||||||||||||||||| ||||||
Sbjct: 520 ttgcatcgaacagaaaggaggacctgaccaatg 488

---

>gb|U06108.1|ZMU06108 Zea mays B73 QM protein mRNA, complete cds
          Length = 928

 Score =  135 bits (68), Expect = 1e-28
 Identities = 176/212 (83%)
 Strand = Plus / Minus

                                                                       
Query: 221 cgagcagcttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggt 280
           |||||||||| || ||||| |||||||| |  |  |||||||| |||||| |||| ||||
Sbjct: 634 cgagcagctttgcgttgacaccatcaggaacaattctgccctcgctcttgtacttcaggt 575

                                                                       
Query: 281 agtcattgcggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgac 340
           |||||  |||| ||||||||||||| |||||||| ||||||||||||||||| |||||  
Sbjct: 574 agtcagcgcggctgaacttggtgaagccccactttctgctctcaatgatcttctggcggg 515

                                                                       
Query: 341 cagggaacttgaacttggcacgacaaaaagcctcagttgcatggatggcattgttgggct 400
           |||||||||||||||| || ||||  | ||| ||  | ||||||   |||||||||  ||
Sbjct: 514 cagggaacttgaacttagcgcgacgcagagcttcgctggcatgggcagcattgttgtcct 455

                                           
Query: 401 tgcaccgcacagaaaggaggacctggccaatg 432
           |||| ||||| |||||||||||||| ||||||
Sbjct: 454 tgcagcgcacggaaaggaggacctgaccaatg 423

---

>gb|AF542972.1| Triticum aestivum SC34 tumor suppressor-like mRNA, complete
           sequence
          Length = 836

 Score =  121 bits (61), Expect = 2e-24
 Identities = 149/177 (84%), Gaps = 1/177 (0%)
 Strand = Plus / Minus

                                                                       
Query: 187 ccaggggcacggttcgcaagggggccatgg-catccgagcagcttagcattgactccatc 245
           |||||||| || || |||| |||||||||| || |  ||||||||||||||||| |||||
Sbjct: 690 ccaggggcgcgtttagcaatggggccatggacaccaaagcagcttagcattgacaccatc 631

                                                                       
Query: 246 aggcaagaccctgccctcactcttgaacttgaggtagtcattgcggttgaacttggtgaa 305
           ||||| ||  || |||||||||||| |||||| ||| |||     |||||||||||| ||
Sbjct: 630 aggcacgattcttccctcactcttgtacttgatgtaatcagccttgttgaacttggtaaa 571

                                                                    
Query: 306 accccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacg 362
            ||||||||||||||   |||||||||||| || |||||||||||||||||||||||
Sbjct: 570 gccccacttcctgctgcgaatgatcttttgacggccagggaacttgaacttggcacg 514

---

>dbj|AK102971.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033115J23, full
           insert sequence
          Length = 995

 Score =  111 bits (56), Expect = 2e-21
 Identities = 146/176 (82%)
 Strand = Plus / Minus

                                                                       
Query: 187 ccaggggcacggttcgcaagggggccatggcatccgagcagcttagcattgactccatca 246
           ||||||||||| ||||||||  | |||||  | || ||||||| ||||||||| ||||||
Sbjct: 695 ccaggggcacgcttcgcaagacgaccatgagaaccaagcagctgagcattgacaccatca 636

                                                                       
Query: 247 ggcaagaccctgccctcactcttgaacttgaggtagtcattgcggttgaacttggtgaaa 306
           | ||  |  |||||||||  ||| ||||||| ||| || |  ||| ||||||||||||| 
Sbjct: 635 gacataattctgccctcagccttcaacttgacgtactcctcacgggtgaacttggtgaag 576

                                                                   
Query: 307 ccccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacg 362
           |||||||||||||| |  ||||||||||| || |||||||||||||||||||||||
Sbjct: 575 ccccacttcctgctgtggatgatcttttgccggccagggaacttgaacttggcacg 520

---

>dbj|AK060902.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-D11, full
           insert sequence
          Length = 1034

 Score =  111 bits (56), Expect = 2e-21
 Identities = 146/176 (82%)
 Strand = Plus / Minus

                                                                       
Query: 187 ccaggggcacggttcgcaagggggccatggcatccgagcagcttagcattgactccatca 246
           ||||||||||| ||||||||  | |||||  | || ||||||| ||||||||| ||||||
Sbjct: 701 ccaggggcacgcttcgcaagacgaccatgagaaccaagcagctgagcattgacaccatca 642

                                                                       
Query: 247 ggcaagaccctgccctcactcttgaacttgaggtagtcattgcggttgaacttggtgaaa 306
           | ||  |  |||||||||  ||| ||||||| ||| || |  ||| ||||||||||||| 
Sbjct: 641 gacataattctgccctcagccttcaacttgacgtactcctcacgggtgaacttggtgaag 582

                                                                   
Query: 307 ccccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacg 362
           |||||||||||||| |  ||||||||||| || |||||||||||||||||||||||
Sbjct: 581 ccccacttcctgctgtggatgatcttttgccggccagggaacttgaacttggcacg 526

---

>gb|U55212.1|OSU55212 Oryza sativa Wilms' tumor-related protein QM mRNA, partial cds
          Length = 747

 Score =  111 bits (56), Expect = 2e-21
 Identities = 146/176 (82%)
 Strand = Plus / Minus

                                                                       
Query: 187 ccaggggcacggttcgcaagggggccatggcatccgagcagcttagcattgactccatca 246
           ||||||||||| ||||||||  | |||||  | || ||||||| ||||||||| ||||||
Sbjct: 483 ccaggggcacgcttcgcaagacgaccatgagaaccaagcagctgagcattgacaccatca 424

                                                                       
Query: 247 ggcaagaccctgccctcactcttgaacttgaggtagtcattgcggttgaacttggtgaaa 306
           | ||  |  |||||||||  ||| ||||||| ||| || |  ||| ||||||||||||| 
Sbjct: 423 gacataattctgccctcagccttcaacttgacgtactcctcacgggtgaacttggtgaag 364

                                                                   
Query: 307 ccccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacg 362
           |||||||||||||| |  ||||||||||| || |||||||||||||||||||||||
Sbjct: 363 ccccacttcctgctgtggatgatcttttgccggccagggaacttgaacttggcacg 308

---

>emb|X81691.1|OSSC34MR O.sativa SC34 mRNA for tumor suppressor
          Length = 971

 Score =  105 bits (53), Expect = 1e-19
 Identities = 148/177 (83%), Gaps = 2/177 (1%)
 Strand = Plus / Minus

                                                                       
Query: 187 ccaggggcacggttcgcaagggggccatggcatccgagcagcttagcattgactccatca 246
           ||||||||||| ||||||||  | |||||  | || ||||||||||||||||| ||||||
Sbjct: 679 ccaggggcacgcttcgcaagacgaccatgagaaccaagcagcttagcattgacaccatca 620

                                                                       
Query: 247 ggcaagaccctgccctcactcttgaacttgaggtagtcatt-gcggttgaacttggtgaa 305
           | ||  |  |||||||||  ||| |||||||| || ||    |||| |||||||||||||
Sbjct: 619 gacataattctgccctcagccttcaacttgag-tactctcacgcggctgaacttggtgaa 561

                                                                    
Query: 306 accccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacg 362
            |||||||||||||| | |||||||||||| || |||||||||||||||||||||||
Sbjct: 560 gccccacttcctgctgtgaatgatcttttgccggccagggaacttgaacttggcacg 504

---

>gb|AY641430.1| Caragana jubata QM family protein (QM) mRNA, complete cds
          Length = 977

 Score =  103 bits (52), Expect = 5e-19
 Identities = 70/76 (92%)
 Strand = Plus / Minus

                                                                       
Query: 289 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 348
           |||||| |||||||||| ||||||||||||||  ||||||||||||| ||||||||||||
Sbjct: 542 cggttgtacttggtgaatccccacttcctgctgacaatgatcttttgacgaccagggaac 483

                           
Query: 349 ttgaacttggcacgac 364
           |||||||| |||||||
Sbjct: 482 ttgaactttgcacgac 467

---

>gb|AY641733.1| Camellia sinensis QM-like protein mRNA, complete cds
          Length = 969

 Score =  103 bits (52), Expect = 5e-19
 Identities = 70/76 (92%)
 Strand = Plus / Minus

                                                                       
Query: 289 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 348
           |||||| |||||||||| ||||||||||||||  ||||||||||||| ||||||||||||
Sbjct: 533 cggttgtacttggtgaatccccacttcctgctgacaatgatcttttgacgaccagggaac 474

                           
Query: 349 ttgaacttggcacgac 364
           |||||||| |||||||
Sbjct: 473 ttgaactttgcacgac 458

---

>dbj|AK103710.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033136P16, full
           insert sequence
          Length = 973

 Score =  103 bits (52), Expect = 5e-19
 Identities = 145/176 (82%)
 Strand = Plus / Minus

                                                                       
Query: 187 ccaggggcacggttcgcaagggggccatggcatccgagcagcttagcattgactccatca 246
           ||||||||||| ||||||||  | |||||  | || ||||||| ||||||||| ||||||
Sbjct: 695 ccaggggcacgcttcgcaagacgaccatgagaaccaagcagctgagcattgacaccatca 636

                                                                       
Query: 247 ggcaagaccctgccctcactcttgaacttgaggtagtcattgcggttgaacttggtgaaa 306
           | ||  |  |||||||||  ||| ||||||| ||| || |  ||| ||||||||||||| 
Sbjct: 635 gacataattctgccctcagccttcaacttgacgtactcctcacgggtgaacttggtgaag 576

                                                                   
Query: 307 ccccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacg 362
           |||||||||||||| |   |||||||||| || |||||||||||||||||||||||
Sbjct: 575 ccccacttcctgctgtgggtgatcttttgccggccagggaacttgaacttggcacg 520

---

>ref|NM_102455.1| Arabidopsis thaliana structural constituent of ribosome AT1G26910
           mRNA, complete cds
          Length = 872

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 76/86 (88%)
 Strand = Plus / Minus

                                                                       
Query: 289 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 348
           ||||| ||||||||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 592 cggttaaacttggtgaacccccatttcctgctaacaatgatcttttgacgaccagggaac 533

                                     
Query: 349 ttgaacttggcacgacaaaaagcctc 374
           || ||||| ||||||| || ||||||
Sbjct: 532 ttaaacttagcacgacgaagagcctc 507

---

>gb|BT024605.1| Arabidopsis thaliana At1g26910 mRNA, complete cds
          Length = 666

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 76/86 (88%)
 Strand = Plus / Minus

                                                                       
Query: 289 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 348
           ||||| ||||||||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 533 cggttaaacttggtgaacccccatttcctgctaacaatgatcttttgacgaccagggaac 474

                                     
Query: 349 ttgaacttggcacgacaaaaagcctc 374
           || ||||| ||||||| || ||||||
Sbjct: 473 ttaaacttagcacgacgaagagcctc 448

---

>gb|AY087264.1| Arabidopsis thaliana clone 33391 mRNA, complete sequence
          Length = 872

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 75/86 (87%)
 Strand = Plus / Minus

                                                                       
Query: 289 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 348
           ||||| ||||||||||| ||||| ||||||||  ||||||||||||| ||||| ||||||
Sbjct: 592 cggttaaacttggtgaacccccatttcctgctaacaatgatcttttgacgacccgggaac 533

                                     
Query: 349 ttgaacttggcacgacaaaaagcctc 374
           || ||||| ||||||| || ||||||
Sbjct: 532 ttaaacttagcacgacgaagagcctc 507

---

>gb|AF180758.1|AF180758 Vitis riparia 60S ribosomal protein L10 (QM) mRNA, complete cds
          Length = 980

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 66/74 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291 gttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaactt 350
           ||||||||| ||||||||||||||||||||  ||||||||||||| ||  ||||||||||
Sbjct: 564 gttgaactttgtgaaaccccacttcctgctgacaatgatcttttgacgggcagggaactt 505

                         
Query: 351 gaacttggcacgac 364
           ||| || |||||||
Sbjct: 504 gaattttgcacgac 491



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 202 gcaagggggccatggcatccgagcagcttagcattgactccatcagg 248
           ||||| || |||||||||||||| ||||| |||||||| ||||||||
Sbjct: 653 gcaagaggtccatggcatccgagaagcttggcattgacaccatcagg 607

---

>ref|NM_101298.2| Arabidopsis thaliana structural constituent of ribosome AT1G14320
           mRNA, complete cds
          Length = 972

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 295 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 354
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 583 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 524

                               
Query: 355 ttggcacgacaaaaagcctc 374
           || ||||||| || ||||||
Sbjct: 523 ttagcacgacgaagagcctc 504

---

>gb|BT000679.1| Arabidopsis thaliana clone RAFL07-10-D02 (R10643) putative tumor
           suppressor (At1g14320) mRNA, complete cds
          Length = 920

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 295 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 354
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 571 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 512

                               
Query: 355 ttggcacgacaaaaagcctc 374
           || ||||||| || ||||||
Sbjct: 511 ttagcacgacgaagagcctc 492

---

>gb|AY113989.1| Arabidopsis thaliana putative tumor suppressor protein (At1g14320)
           mRNA, complete cds
          Length = 694

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 295 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 354
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 527 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 468

                               
Query: 355 ttggcacgacaaaaagcctc 374
           || ||||||| || ||||||
Sbjct: 467 ttagcacgacgaagagcctc 448

---

>gb|AY045866.1| Arabidopsis thaliana putative tumor suppressor protein (At1g14320)
           mRNA, complete cds
          Length = 966

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 295 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 354
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 574 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 515

                               
Query: 355 ttggcacgacaaaaagcctc 374
           || ||||||| || ||||||
Sbjct: 514 ttagcacgacgaagagcctc 495

---

>gb|AF428470.1|AF428470 Arabidopsis thaliana At1g14320/F14L17_28 mRNA, complete cds
          Length = 923

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 295 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 354
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 574 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 515

                               
Query: 355 ttggcacgacaaaaagcctc 374
           || ||||||| || ||||||
Sbjct: 514 ttagcacgacgaagagcctc 495

---

>gb|AF428286.1|AF428286 Arabidopsis thaliana At1g14320/F14L17_28 mRNA, complete cds
          Length = 882

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 295 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 354
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 574 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 515

                               
Query: 355 ttggcacgacaaaaagcctc 374
           || ||||||| || ||||||
Sbjct: 514 ttagcacgacgaagagcctc 495

---

>gb|AY050482.1| Arabidopsis thaliana At1g14320/F14L17_28 mRNA, complete cds
          Length = 360

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 295 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 354
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 224 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 165

                               
Query: 355 ttggcacgacaaaaagcctc 374
           || ||||||| || ||||||
Sbjct: 164 ttagcacgacgaagagcctc 145

---

>gb|AF378902.1|AF378902 Arabidopsis thaliana At1g14320/F14L17_28 mRNA, complete cds
          Length = 542

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 295 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 354
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 233 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 174

                               
Query: 355 ttggcacgacaaaaagcctc 374
           || ||||||| || ||||||
Sbjct: 173 ttagcacgacgaagagcctc 154

---

>emb|BX816389.1|CNS0AE93 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH45ZB11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 465

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 295 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 354
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 157 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 98

                               
Query: 355 ttggcacgacaaaaagcctc 374
           || ||||||| || ||||||
Sbjct: 97  ttagcacgacgaagagcctc 78

---

>emb|BX816136.1|CNS0AE2V Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH2ZH02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 869

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 295 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 354
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 561 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 502

                               
Query: 355 ttggcacgacaaaaagcctc 374
           || ||||||| || ||||||
Sbjct: 501 ttagcacgacgaagagcctc 482

---

>emb|Z15157.1|ATWILMTSH A.thaliana mRNA for Wilm's tumor suppressor homologue
          Length = 880

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 295 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 354
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 554 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 495

                               
Query: 355 ttggcacgacaaaaagcctc 374
           || ||||||| || ||||||
Sbjct: 494 ttagcacgacgaagagcctc 475

---

>emb|Z14083.1|NTTRP N.tabacum mRNA for protein homologue to human Wilm's tumor-related
           protein HUMQM (partial)
          Length = 615

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 293 tgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttga 352
           ||||||| ||||| ||||||||||||||  ||||||||||||| || | |||||||||||
Sbjct: 318 tgaacttagtgaacccccacttcctgctgacaatgatcttttgacggcgagggaacttga 259

                     
Query: 353 acttggcacg 362
           |||| |||||
Sbjct: 258 actttgcacg 249

---

>ref|NM_105329.1| Arabidopsis thaliana structural constituent of ribosome AT1G66580
           mRNA, complete cds
          Length = 882

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 289 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 348
           |||||||| || ||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 576 cggttgaatttagtgaatccccatttcctgctaacaatgatcttttgacgaccagggaac 517

                   
Query: 349 ttgaactt 356
           || |||||
Sbjct: 516 ttaaactt 509

---

>gb|AY055103.1| Arabidopsis thaliana At1g66580/T12I7_3 mRNA, complete cds
          Length = 666

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 289 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 348
           |||||||| || ||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 533 cggttgaatttagtgaatccccatttcctgctaacaatgatcttttgacgaccagggaac 474

                   
Query: 349 ttgaactt 356
           || |||||
Sbjct: 473 ttaaactt 466

---

>gb|AF367276.1|AF367276 Arabidopsis thaliana At1g66580/T12I7_3 mRNA, complete cds
          Length = 835

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 289 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 348
           |||||||| || ||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 576 cggttgaatttagtgaatccccatttcctgctaacaatgatcttttgacgaccagggaac 517

                   
Query: 349 ttgaactt 356
           || |||||
Sbjct: 516 ttaaactt 509

---

>emb|BX816025.1|CNS0ABON Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH23ZE11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 839

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 289 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 348
           |||||||| || ||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 557 cggttgaatttagtgaatccccatttcctgctaacaatgatcttttgacgaccagggaac 498

                   
Query: 349 ttgaactt 356
           || |||||
Sbjct: 497 ttaaactt 490

---

>emb|BX815625.1|CNS0ABEZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS78ZG01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 854

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 289 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 348
           |||||||| || ||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 549 cggttgaatttagtgaatccccatttcctgctaacaatgatcttttgacgaccagggaac 490

                   
Query: 349 ttgaactt 356
           || |||||
Sbjct: 489 ttaaactt 482

---

>gb|AY087426.1| Arabidopsis thaliana clone 35307 mRNA, complete sequence
          Length = 882

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 289 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 348
           |||||||| || ||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 576 cggttgaatttagtgaatccccatttcctgctaacaatgatcttttgacgaccagggaac 517

                   
Query: 349 ttgaactt 356
           || |||||
Sbjct: 516 ttaaactt 509

---

>gb|DQ228354.1| Solanum tuberosum clone 150H09 60S ribosomal protein L10-like
           protein mRNA, complete cds
          Length = 841

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 61/70 (87%)
 Strand = Plus / Minus

                                                                       
Query: 293 tgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttga 352
           ||||||| ||||| |||||||| |||||  ||||||||||||| || ||||||||||| |
Sbjct: 545 tgaacttagtgaacccccactttctgctgacaatgatcttttgtcggccagggaacttaa 486

                     
Query: 353 acttggcacg 362
           |||| |||||
Sbjct: 485 acttagcacg 476

---

>gb|AC147460.1| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNAb0050G15, complete sequence
          Length = 126156

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                   
Query: 309   ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacg 362
             |||||||||||| |  ||||||||||| || |||||||||||||||||||||||
Sbjct: 94758 ccacttcctgctgtggatgatcttttgccggccagggaacttgaacttggcacg 94705

---

>gb|AC123524.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0052C03, complete sequence
          Length = 157178

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                   
Query: 309   ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacg 362
             |||||||||||| |  ||||||||||| || |||||||||||||||||||||||
Sbjct: 28602 ccacttcctgctgtggatgatcttttgccggccagggaacttgaacttggcacg 28549

---

>gb|AF368032.1|AF368032 Heliothis virescens QM protein mRNA, complete cds
          Length = 711

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||||||||||||||||||||||||||
Sbjct: 495 gatcttctggcgaccagggaacttgaacttggcacgac 458

---

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                     
Query: 309     ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacg 362
               |||||||||||| |  ||||||||||| || |||||||||||||||||||||||
Sbjct: 6245324 ccacttcctgctgtggatgatcttttgccggccagggaacttgaacttggcacg 6245271

---

>gb|AC012188.2|F14L17 Sequence of BAC F14L17 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 111686

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                         
Query: 313   ttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacaaaaagcc 372
             ||||||||  |||| |||||||| |||||||||||||||||||| ||||||| || ||||
Sbjct: 20126 ttcctgctgacaataatcttttgacgaccagggaacttgaacttagcacgacgaagagcc 20067

               
Query: 373   tc 374
             ||
Sbjct: 20066 tc 20065

---

>gb|AF227620.1|AF227620 Euphorbia esula 60S ribosomal protein L10 mRNA, complete cds
          Length = 852

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 289 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 348
           |||||||  ||||||||||||||||| |||||  |||| |||||||||||||| || |||
Sbjct: 557 cggttgattttggtgaaaccccactttctgctgacaataatcttttggcgaccgggaaac 498

                         
Query: 349 ttgaacttggcacg 362
           || ||||| |||||
Sbjct: 497 ttaaacttagcacg 484

---

>gb|AC005508.1|AC005508 Arabidopsis thaliana chromosome I BAC T2P11 genomic sequence, complete
             sequence
          Length = 85372

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                         
Query: 313   ttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacaaaaagcc 372
             ||||||||  ||||||||||||| |||||||||||||| ||||| ||||||| || ||||
Sbjct: 30483 ttcctgctaacaatgatcttttgacgaccagggaacttaaacttagcacgacgaagagcc 30424

               
Query: 373   tc 374
             ||
Sbjct: 30423 tc 30422

---

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                     
Query: 309     ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacg 362
               |||||||||||| |  ||||||||||| || |||||||||||||||||||||||
Sbjct: 6311791 ccacttcctgctgtggatgatcttttgccggccagggaacttgaacttggcacg 6311738

---

>dbj|AB001582.1| Solanum melongena mRNA for QM family protein, partial cds
          Length = 413

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 61/70 (87%)
 Strand = Plus / Minus

                                                                       
Query: 293 tgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttga 352
           ||||||||||||| |||||||| |||||  ||||||||||||| || ||||| ||||| |
Sbjct: 317 tgaacttggtgaatccccactttctgctgacaatgatcttttgacggccaggaaacttaa 258

                     
Query: 353 acttggcacg 362
           |||| |||||
Sbjct: 257 acttagcacg 248

---

>dbj|AB001891.1| Solanum melongena mRNA for QM family protein, complete cds
          Length = 820

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 61/70 (87%)
 Strand = Plus / Minus

                                                                       
Query: 293 tgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttga 352
           ||||||||||||| |||||||| |||||  ||||||||||||| || ||||| ||||| |
Sbjct: 565 tgaacttggtgaatccccactttctgctgacaatgatcttttgacggccaggaaacttaa 506

                     
Query: 353 acttggcacg 362
           |||| |||||
Sbjct: 505 acttagcacg 496

---

>emb|CR937221.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 3-prime end of clone
           KW0AAB2YJ23BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 527

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 328 atcttttggcgaccagggaacttgaacttggcacgacaaaaagcctc 374
           ||||| |||||||| ||||||||||||||||||||||  ||||||||
Sbjct: 364 atcttctggcgaccggggaacttgaacttggcacgacgcaaagcctc 410

---

>gb|DQ440008.1| Aedes aegypti clone AE-200A ribosomal protein L10 mRNA, complete
           cds
          Length = 660

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 495 gatcttctggcgaccggggaacttgaacttggcacgac 458

---

>gb|AY829778.1| Lonomia obliqua ribosomal protein L10 mRNA, complete cds
          Length = 396

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| || ||||||||||||||||||||||||||||
Sbjct: 231 gatcttctgacgaccagggaacttgaacttggcacgac 194

---

>emb|BX071681.1|CNS09RH1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 541 gatcttctggcgacccgggaacttgaacttggcacgac 504

---

>emb|BX066414.1|CNS09NEQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 543 gatcttctggcgacccgggaacttgaacttggcacgac 506

---

>emb|BX066294.1|CNS09NBE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 534

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 205 gatcttctggcgacccgggaacttgaacttggcacgac 168

---

>emb|BX062161.1|CNS09K4L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 608

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 518 gatcttctggcgacccgggaacttgaacttggcacgac 481

---

>emb|BX054818.1|CNS09EGM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 554 gatcttctggcgacccgggaacttgaacttggcacgac 517

---

>emb|BX054800.1|CNS09EG4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 747

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 240 gatcttctggcgacccgggaacttgaacttggcacgac 277

---

>emb|BX054799.1|CNS09EG3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 865

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 556 gatcttctggcgacccgggaacttgaacttggcacgac 519

---

>emb|BX046336.1|CNS097X0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 264 gatcttctggcgacccgggaacttgaacttggcacgac 301

---

>emb|BX045752.1|CNS097GS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 529 gatcttctggcgacccgggaacttgaacttggcacgac 492

---

>emb|BX045505.1|CNS0979X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 599 gatcttctggcgacccgggaacttgaacttggcacgac 562

---

>emb|BX043067.1|CNS095E7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15BF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 263 gatcttctggcgacccgggaacttgaacttggcacgac 300

---

>emb|BX043066.1|CNS095E6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15BF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1022

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 704 gatcttctggcgacccgggaacttgaacttggcacgac 667

---

>emb|BX044599.1|CNS096KR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 618

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 550 gatcttctggcgacccgggaacttgaacttggcacgac 513

---

>emb|BX043398.1|CNS095NE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 740

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 514 gatcttctggcgacccgggaacttgaacttggcacgac 477

---

>emb|BX038980.1|CNS0928O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 586

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 297 gatcttctggcgacccgggaacttgaacttggcacgac 334

---

>emb|BX037545.1|CNS0914T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 690

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 299 gatcttctggcgacccgggaacttgaacttggcacgac 336

---

>emb|BX037544.1|CNS0914S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 747

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 559 gatcttctggcgacccgggaacttgaacttggcacgac 522

---

>emb|BX031114.1|CNS08W66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1046

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 955 gatcttctggcgacccgggaacttgaacttggcacgac 918

---

>emb|BX026834.1|CNS08SVA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 379

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 263 gatcttctggcgacccgggaacttgaacttggcacgac 300

---

>emb|BX026833.1|CNS08SV9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 661

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 547 gatcttctggcgacccgggaacttgaacttggcacgac 510

---

>emb|BX025006.1|CNS08RGI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 567

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 251 gatcttctggcgacccgggaacttgaacttggcacgac 288

---

>emb|BX025005.1|CNS08RGH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 831

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 540 gatcttctggcgacccgggaacttgaacttggcacgac 503

---

>emb|BX024539.1|CNS08R3J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 541 gatcttctggcgacccgggaacttgaacttggcacgac 504

---

>emb|BX020659.1|CNS08O3R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 542

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 149 gatcttctggcgacccgggaacttgaacttggcacgac 186

---

>emb|BX019389.1|CNS08N4H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 531 gatcttctggcgacccgggaacttgaacttggcacgac 494

---

>emb|BX018993.1|CNS08MTH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 536 gatcttctggcgacccgggaacttgaacttggcacgac 499

---

>emb|BX017940.1|CNS08M08 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 266 gatcttctggcgacccgggaacttgaacttggcacgac 303

---

>emb|BX017939.1|CNS08M07 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 864

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 535 gatcttctggcgacccgggaacttgaacttggcacgac 498

---

>emb|BX018773.1|CNS08MND Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 226

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 82  gatcttctggcgacccgggaacttgaacttggcacgac 119

---

>emb|BX018772.1|CNS08MNC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 553 gatcttctggcgacccgggaacttgaacttggcacgac 516

---

>emb|BX017778.1|CNS08LVQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 788

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 228 gatcttctggcgacccgggaacttgaacttggcacgac 265

---

>emb|BX017777.1|CNS08LVP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA26DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 962 gatcttctggcgacccgggaacttgaacttggcacgac 925

---

>emb|BX016960.1|CNS08L90 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 576 gatcttctggcgacccgggaacttgaacttggcacgac 539

---

>emb|BX012859.1|CNS08I33 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2BD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 595

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 266 gatcttctggcgacccgggaacttgaacttggcacgac 303

---

>emb|BX012858.1|CNS08I32 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2BD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 836

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 529 gatcttctggcgacccgggaacttgaacttggcacgac 492

---

>emb|BX010419.1|CNS08G7B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 538 gatcttctggcgacccgggaacttgaacttggcacgac 501

---

>emb|BX008095.1|CNS08EER Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 802

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 281 gatcttctggcgacccgggaacttgaacttggcacgac 318

---

>emb|BX008094.1|CNS08EEQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 692

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 362 gatcttctggcgacccgggaacttgaacttggcacgac 325

---

>emb|BX005642.1|CNS08CIM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA1AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 429

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 130 gatcttctggcgacccgggaacttgaacttggcacgac 93

---

>emb|CR938586.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YF21AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 768

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 561 gatcttctggcgaccggggaacttgaacttggcacgac 524

---

>emb|CR938540.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YI18AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 700

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 565 gatcttctggcgaccggggaacttgaacttggcacgac 528

---

>emb|CR938096.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YK16AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 944

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 568 gatcttctggcgaccggggaacttgaacttggcacgac 531

---

>emb|CR938095.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 3-prime end of clone
           KW0AAA2YK16BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 813

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 361 gatcttctggcgaccggggaacttgaacttggcacgac 398

---

>emb|CR937970.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YO19AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 932

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 561 gatcttctggcgaccggggaacttgaacttggcacgac 524

---

>emb|CR937222.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 5-prime end of clone
           KW0AAB2YJ23AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 812

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 567 gatcttctggcgaccggggaacttgaacttggcacgac 530

---

>gb|AF295636.1|AF295636 Elaeis guineensis QM-like protein mRNA, complete cds
          Length = 974

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 325 atgatcttttggcgaccagggaacttgaacttggcacg 362
           ||||||||||| || |||||||||||||||||||||||
Sbjct: 530 atgatcttttgacggccagggaacttgaacttggcacg 493

---

>ref|XM_312560.2| Anopheles gambiae str. PEST ENSANGP00000014921
           (ENSANGG00000012432), partial mRNA
          Length = 757

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| |||||||| ||||||||||||||||||||||
Sbjct: 598 gatcttctggcgacccgggaacttgaacttggcacgac 561

---

>gb|AF118822.1|AF118822 Arabidopsis thaliana senescence-associated protein (SAG24) mRNA,
           partial cds
          Length = 169

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 289 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 348
           |||| ||| || ||||| ||||| ||| ||||  ||||||||||||| ||||||||||||
Sbjct: 161 cggtngaatttagtgaatccccatttcgtgctaacaatgatcttttgacgaccagggaac 102

                   
Query: 349 ttgaactt 356
           || |||||
Sbjct: 101 ttaaactt 94

---

>ref|XM_868582.1| PREDICTED: Bos taurus similar to ribosomal protein L10 (LOC616541),
           mRNA
          Length = 489

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 328 atcttttggcgaccagggaacttgaacttggc 359
           ||||| ||||||||||||||||||||||||||
Sbjct: 338 atcttctggcgaccagggaacttgaacttggc 307

---

>gb|U60651.1| Hydra vulgaris ribosomal protein L10 mRNA, complete cds
          Length = 709

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 328 atcttttggcgaccagggaacttgaacttggc 359
           |||||||| |||||||||||||||||||||||
Sbjct: 511 atcttttgacgaccagggaacttgaacttggc 480

---

>emb|BX051816.1|CNS09C58 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||||||||| || ||||||||||||||||||||
Sbjct: 545 gatcttttggcggccggggaacttgaacttggcacg 510

---

>emb|CR938702.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YA10AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 705

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 329 tcttttggcgaccagggaacttgaacttggcacgac 364
           |||| |||||||| ||||||||||||||||||||||
Sbjct: 563 tcttctggcgaccggggaacttgaacttggcacgac 528

---

>gb|AC079285.1|AC079285 Arabidopsis thaliana chromosome 1 BAC T12I7 genomic sequence,
            complete sequence
          Length = 35308

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 313  ttcctgctctcaatgatcttttggcgaccagggaacttgaactt 356
            ||||||||  ||||||||||||| |||||||||||||| |||||
Sbjct: 9480 ttcctgctaacaatgatcttttgacgaccagggaacttaaactt 9437

---

>gb|AY130416.1| Petromyzon marinus ribosomal protein L10 mRNA, partial cds
          Length = 642

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgacaaaaagcctc 374
           |||||| |||||||| ||||||||||||||||| ||||  ||||||||
Sbjct: 495 gatcttctggcgacccgggaacttgaacttggcgcgacggaaagcctc 448

---

>ref|XM_658595.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN6083.2), mRNA
          Length = 753

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 325 atgatcttttggcgaccagggaacttg 351
           |||||||||||||||||||||||||||
Sbjct: 584 atgatcttttggcgaccagggaacttg 558

---

>emb|BX038979.1|CNS0928N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 554

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 334 tggcgaccagggaacttgaacttggcacgac 364
           |||||||| ||||||||||||||||||||||
Sbjct: 553 tggcgacccgggaacttgaacttggcacgac 523

---

>gb|AY440350.1| Armigeres subalbatus ASAP ID: 41357 cytosolic large ribosomal
           subunit L10 mRNA sequence
          Length = 927

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           |||||| || ||||| ||||||||||||||||||||||
Sbjct: 535 gatcttctgacgaccggggaacttgaacttggcacgac 498

---

>emb|AM049018.1| Curculio glandium partial mRNA for ribosomal protein L10e (rpL10e
           gene)
          Length = 321

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 327 gatcttttggcgaccagggaacttgaacttggcacgac 364
           ||||||||| || || ||||||||||||||||||||||
Sbjct: 156 gatcttttgacgtccggggaacttgaacttggcacgac 119

---

>gb|BC086917.1| Mus musculus ribosomal protein 10, mRNA (cDNA clone MGC:107630
           IMAGE:6768088), complete cds
          Length = 761

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 536 gatcttctggcggccagggaacttgaacttggc 504

---

>gb|AC122357.4| Mus musculus BAC clone RP23-403O8 from chromosome 13, complete sequence
          Length = 203039

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                               
Query: 327    gatcttttggcgaccagggaacttgaacttggc 359
              |||||| ||||| ||||||||||||||||||||
Sbjct: 162008 gatcttctggcggccagggaacttgaacttggc 162040

---

>gb|BC083327.1| Mus musculus ribosomal protein 10, mRNA (cDNA clone MGC:101996
           IMAGE:5684015), complete cds
          Length = 724

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 498 gatcttctggcggccagggaacttgaacttggc 466

---

>gb|BC082293.1| Mus musculus ribosomal protein 10, mRNA (cDNA clone MGC:103087
           IMAGE:6486491), complete cds
          Length = 730

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 498 gatcttctggcggccagggaacttgaacttggc 466

---

>gb|AY701865.1| Gekko japonicus GekBS044P mRNA, complete cds
          Length = 766

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 533 gatcttctggcggccagggaacttgaacttggc 501

---

>ref|XM_585834.2| PREDICTED: Bos taurus similar to ribosomal protein L10 (LOC508970),
           mRNA
          Length = 470

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 270 gatcttctggcggccagggaacttgaacttggc 238

---

>ref|XM_592251.2| PREDICTED: Bos taurus similar to ribosomal protein L10 (LOC514406),
           mRNA
          Length = 666

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 465 gatcttctggcggccagggaacttgaacttggc 433

---

>gb|BC024901.1| Mus musculus ribosomal protein 10, mRNA (cDNA clone MGC:25363
           IMAGE:4224016), complete cds
          Length = 735

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 498 gatcttctggcggccagggaacttgaacttggc 466

---

>ref|NM_052835.1| Mus musculus ribosomal protein 10 (Rpl10), mRNA
          Length = 764

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 537 gatcttctggcggccagggaacttgaacttggc 505

---

>ref|NM_174760.2| Bos taurus ribosomal protein L10 (RPL10), mRNA
          Length = 734

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 529 gatcttctggcggccagggaacttgaacttggc 497

---

>ref|XM_862548.1| PREDICTED: Canis familiaris similar to ribosomal protein L10,
           transcript variant 7 (LOC481085), mRNA
          Length = 1133

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 518 gatcttctggcggccagggaacttgaacttggc 486

---

>ref|XM_862530.1| PREDICTED: Canis familiaris similar to ribosomal protein L10,
           transcript variant 5 (LOC481085), mRNA
          Length = 1100

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 485 gatcttctggcggccagggaacttgaacttggc 453

---

>ref|XM_862521.1| PREDICTED: Canis familiaris similar to ribosomal protein L10,
           transcript variant 4 (LOC481085), mRNA
          Length = 1070

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 455 gatcttctggcggccagggaacttgaacttggc 423

---

>ref|XM_538206.2| PREDICTED: Canis familiaris similar to ribosomal protein L10,
           transcript variant 1 (LOC481085), mRNA
          Length = 1210

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 595 gatcttctggcggccagggaacttgaacttggc 563

---

>ref|XM_848470.1| PREDICTED: Canis familiaris similar to ribosomal protein L10,
           transcript variant 2 (LOC481085), mRNA
          Length = 1229

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 614 gatcttctggcggccagggaacttgaacttggc 582

---

>ref|XM_974001.1| PREDICTED: Mus musculus similar to ribosomal protein L10
           (LOC434434), mRNA
          Length = 773

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 539 gatcttctggcggccagggaacttgaacttggc 507

---

>ref|XM_889722.2| PREDICTED: Mus musculus similar to ribosomal protein L10,
           transcript variant 2 (LOC434434), mRNA
          Length = 773

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 539 gatcttctggcggccagggaacttgaacttggc 507

---

>gb|AC113107.15| Mus musculus chromosome 10, clone RP23-325G13, complete sequence
          Length = 207239

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 327   gatcttttggcgaccagggaacttgaacttggc 359
             |||||| ||||| ||||||||||||||||||||
Sbjct: 45628 gatcttctggcggccagggaacttgaacttggc 45596

---

>ref|XM_543494.2| PREDICTED: Canis familiaris similar to ribosomal protein L10
           (LOC486368), mRNA
          Length = 532

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 309 gatcttctggcggccagggaacttgaacttggc 277

---

>ref|XM_542759.2| PREDICTED: Canis familiaris similar to ribosomal protein L10
           (LOC485640), mRNA
          Length = 416

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 210 gatcttctggcggccagggaacttgaacttggc 178

---

>emb|CR974589.6| Mouse DNA sequence from clone RP23-77B14 on chromosome 12, complete
             sequence
          Length = 198849

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 327   gatcttttggcgaccagggaacttgaacttggc 359
             |||||| ||||| ||||||||||||||||||||
Sbjct: 92954 gatcttctggcggccagggaacttgaacttggc 92922

---

>ref|XM_547794.2| PREDICTED: Canis familiaris similar to 60S ribosomal protein L10
           (QM protein) (Tumor suppressor QM) (Laminin receptor
           homolog) (LOC490672), mRNA
          Length = 720

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 570 gatcttctggcggccagggaacttgaacttggc 538

---

>emb|AM049019.1| Scarabaeus laticollis mRNA for ribosomal protein L10e (rpL10e gene)
          Length = 657

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| |||||||| |||||||||||||||||
Sbjct: 495 gatcttctggcgaccggggaacttgaacttggc 463

---

>gb|AC121872.2| Mus musculus BAC clone RP24-122E10 from 12, complete sequence
          Length = 199519

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 327   gatcttttggcgaccagggaacttgaacttggc 359
             |||||| ||||| ||||||||||||||||||||
Sbjct: 67564 gatcttctggcggccagggaacttgaacttggc 67532

---

>gb|BC058467.1| Rattus norvegicus ribosomal protein L10, mRNA (cDNA clone MGC:72797
           IMAGE:6918973), complete cds
          Length = 788

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 542 gatcttctggcggccagggaacttgaacttggc 510

---

>ref|XM_849677.1| PREDICTED: Canis familiaris similar to ribosomal protein L10
           (LOC611957), mRNA
          Length = 392

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 171 gatcttctggcggccagggaacttgaacttggc 139

---

>gb|AC117679.8| Mus musculus chromosome 9, clone RP23-435I22, complete sequence
          Length = 213032

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                               
Query: 327    gatcttttggcgaccagggaacttgaacttggc 359
              |||||| ||||| ||||||||||||||||||||
Sbjct: 169117 gatcttctggcggccagggaacttgaacttggc 169149

---

>emb|X75312.1|MMRNAQM M.musculus (C57BL/6) QM mRNA
          Length = 736

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 529 gatcttctggcggccagggaacttgaacttggc 497

---

>gb|BC099437.1| Mus musculus ribosomal protein 10, mRNA (cDNA clone MGC:117625
           IMAGE:30843551), complete cds
          Length = 734

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 501 gatcttctggcggccagggaacttgaacttggc 469

---

>gb|AC160997.5| Mus musculus BAC clone RP23-68E4 from chromosome 9, complete
           sequence
          Length = 179142

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 363 gatcttctggcggccagggaacttgaacttggc 331

---

>gb|BC098204.1| Mus musculus ribosomal protein 10, mRNA (cDNA clone MGC:106448
           IMAGE:6410755), complete cds
          Length = 777

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 522 gatcttctggcggccagggaacttgaacttggc 490

---

>dbj|AB226277.1| Aspergillus oryzae cDNA, contig sequence: AoEST3138
          Length = 916

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 327 gatcttttggcgaccagggaacttg 351
           |||||||||||||||||||||||||
Sbjct: 581 gatcttttggcgaccagggaacttg 557

---

>dbj|AB223250.1| Aspergillus oryzae cDNA, contig sequence: AoEST0081
          Length = 802

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 327 gatcttttggcgaccagggaacttg 351
           |||||||||||||||||||||||||
Sbjct: 520 gatcttttggcgaccagggaacttg 496

---

>dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011
          Length = 2505489

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                        
Query: 327     gatcttttggcgaccagggaacttg 351
               |||||||||||||||||||||||||
Sbjct: 1970364 gatcttttggcgaccagggaacttg 1970388

---

>dbj|AK146217.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched
           library, clone:I730035D10 product:ribosomal protein 10,
           full insert sequence
          Length = 751

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 538 gatcttctggcggccagggaacttgaacttggc 506

---

>dbj|AK151736.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830035M24 product:ribosomal
           protein 10, full insert sequence
          Length = 748

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 536 gatcttctggcggccagggaacttgaacttggc 504

---

>dbj|AK144831.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched
           library, clone:G730040A02 product:ribosomal protein 10,
           full insert sequence
          Length = 752

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 537 gatcttctggcggccagggaacttgaacttggc 505

---

>dbj|AK152854.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830087L08 product:ribosomal
           protein 10, full insert sequence
          Length = 744

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 537 gatcttctggcggccagggaacttgaacttggc 505

---

>dbj|AK151655.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830032M03 product:ribosomal
           protein 10, full insert sequence
          Length = 754

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 537 gatcttctggcggccagggaacttgaacttggc 505

---

>gb|BC104528.1| Bos taurus ribosomal protein L10, mRNA (cDNA clone MGC:128842
           IMAGE:8119588), complete cds
          Length = 757

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 520 gatcttctggcggccagggaacttgaacttggc 488

---

>dbj|AK151416.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830029J07 product:ribosomal
           protein 10, full insert sequence
          Length = 754

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 537 gatcttctggcggccagggaacttgaacttggc 505

---

>dbj|AK153345.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830142J07 product:ribosomal
           protein 10, full insert sequence
          Length = 754

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 537 gatcttctggcggccagggaacttgaacttggc 505

---

>dbj|AK152123.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830048G21 product:ribosomal
           protein 10, full insert sequence
          Length = 744

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 537 gatcttctggcggccagggaacttgaacttggc 505

---

>dbj|AK168854.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched
           library, clone:I920061F03 product:ribosomal protein 10,
           full insert sequence
          Length = 744

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 537 gatcttctggcggccagggaacttgaacttggc 505

---

>dbj|AK166610.1| Mus musculus morula whole body morula cDNA, RIKEN full-length
           enriched library, clone:I0C0037B18 product:ribosomal
           protein 10, full insert sequence
          Length = 749

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 536 gatcttctggcggccagggaacttgaacttggc 504

---

>dbj|AK167239.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0044N07 product:ribosomal protein 10,
           full insert sequence
          Length = 780

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 573 gatcttctggcggccagggaacttgaacttggc 541

---

>dbj|AK160618.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700030I22 product:ribosomal
           protein 10, full insert sequence
          Length = 754

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 537 gatcttctggcggccagggaacttgaacttggc 505

---

>dbj|AK168250.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched
           library, clone:I730071I06 product:ribosomal protein 10,
           full insert sequence
          Length = 743

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 536 gatcttctggcggccagggaacttgaacttggc 504

---

>dbj|AK167966.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched
           library, clone:I730043L24 product:ribosomal protein 10,
           full insert sequence
          Length = 754

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 537 gatcttctggcggccagggaacttgaacttggc 505

---

>dbj|AK014054.1| Mus musculus 13 days embryo head cDNA, RIKEN full-length enriched
           library, clone:3110015J05 product:ribosomal protein 10,
           full insert sequence
          Length = 753

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 539 gatcttctggcggccagggaacttgaacttggc 507

---

>dbj|AK088777.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430025N10
           product:ribosomal protein 10, full insert sequence
          Length = 755

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 538 gatcttctggcggccagggaacttgaacttggc 506

---

>gb|AF143815.1|AF143815 Bos taurus ribosomal protein (QM) mRNA, complete cds
          Length = 734

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 529 gatcttctggcggccagggaacttgaacttggc 497

---

>dbj|AK012561.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700084E11 product:ribosomal
           protein 10, full insert sequence
          Length = 750

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 534 gatcttctggcggccagggaacttgaacttggc 502

---

>ref|NG_000911.1| Homo sapiens ribosomal protein L10 pseudogene 1 (RPL10P1) on
           chromosome 21
          Length = 942

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 308 gatcttctggcggccagggaacttgaacttggc 340

---

>dbj|AK011022.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:2510029G06 product:ribosomal protein 10,
           full insert sequence
          Length = 764

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 537 gatcttctggcggccagggaacttgaacttggc 505

---

>emb|AL115669.1|CNS01CL9 Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 323 caatgatcttttggcgaccagggaacttg 351
           ||||||||||||||||||| |||||||||
Sbjct: 521 caatgatcttttggcgacctgggaacttg 493

---

>emb|AL117032.1|CNS01DN4 Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 323 caatgatcttttggcgaccagggaacttg 351
           ||||||||||||||||||| |||||||||
Sbjct: 535 caatgatcttttggcgacctgggaacttg 507

---

>emb|AL117016.1|CNS01DMO Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 323 caatgatcttttggcgaccagggaacttg 351
           ||||||||||||||||||| |||||||||
Sbjct: 540 caatgatcttttggcgacctgggaacttg 512

---

>emb|AL116010.1|CNS01CUQ Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 323 caatgatcttttggcgaccagggaacttg 351
           ||||||||||||||||||| |||||||||
Sbjct: 529 caatgatcttttggcgacctgggaacttg 501

---

>emb|AL116382.1|CNS01D52 Botrytis cinerea strain T4 cDNA library
          Length = 540

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 323 caatgatcttttggcgaccagggaacttg 351
           ||||||||||||||||||| |||||||||
Sbjct: 250 caatgatcttttggcgacctgggaacttg 222

---

>emb|AL116380.1|CNS01D50 Botrytis cinerea strain T4 cDNA library
          Length = 540

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 323 caatgatcttttggcgaccagggaacttg 351
           ||||||||||||||||||| |||||||||
Sbjct: 250 caatgatcttttggcgacctgggaacttg 222

---

>emb|AL115845.1|CNS01CQ5 Botrytis cinerea strain T4 cDNA library
          Length = 420

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 323 caatgatcttttggcgaccagggaacttg 351
           ||||||||||||||||||| |||||||||
Sbjct: 134 caatgatcttttggcgacctgggaacttg 106

---

>emb|AL115361.1|CNS01CCP Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 323 caatgatcttttggcgaccagggaacttg 351
           ||||||||||||||||||| |||||||||
Sbjct: 339 caatgatcttttggcgacctgggaacttg 311

---

>emb|AL114727.1|CNS01BV3 Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 323 caatgatcttttggcgaccagggaacttg 351
           ||||||||||||||||||| |||||||||
Sbjct: 515 caatgatcttttggcgacctgggaacttg 487

---

>emb|AL114044.1|CNS01BC4 Botrytis cinerea strain T4 cDNA library
          Length = 360

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 323 caatgatcttttggcgaccagggaacttg 351
           ||||||||||||||||||| |||||||||
Sbjct: 66  caatgatcttttggcgacctgggaacttg 38

---

>emb|AL114043.1|CNS01BC3 Botrytis cinerea strain T4 cDNA library
          Length = 360

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 323 caatgatcttttggcgaccagggaacttg 351
           ||||||||||||||||||| |||||||||
Sbjct: 66  caatgatcttttggcgacctgggaacttg 38

---

>emb|AL112807.1|CNS01ADR Botrytis cinerea strain T4 cDNA library
          Length = 480

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 323 caatgatcttttggcgaccagggaacttg 351
           ||||||||||||||||||| |||||||||
Sbjct: 228 caatgatcttttggcgacctgggaacttg 200

---

>emb|AL112775.1|CNS01ACV Botrytis cinerea strain T4 cDNA library
          Length = 420

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 323 caatgatcttttggcgaccagggaacttg 351
           ||||||||||||||||||| |||||||||
Sbjct: 137 caatgatcttttggcgacctgggaacttg 109

---

>emb|AL111608.1|CNS019GG Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 323 caatgatcttttggcgaccagggaacttg 351
           ||||||||||||||||||| |||||||||
Sbjct: 527 caatgatcttttggcgacctgggaacttg 499

---

>emb|AL111718.1|CNS019JI Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 323 caatgatcttttggcgaccagggaacttg 351
           ||||||||||||||||||| |||||||||
Sbjct: 522 caatgatcttttggcgacctgggaacttg 494

---

>emb|AL111190.1|CNS0194U Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 323 caatgatcttttggcgaccagggaacttg 351
           ||||||||||||||||||| |||||||||
Sbjct: 335 caatgatcttttggcgacctgggaacttg 307

---

>gb|AC153942.8| Mus musculus 10 BAC RP24-174M19 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 146201

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                              
Query: 327   gatcttttggcgaccagggaacttgaacttggc 359
             |||||| ||||| ||||||||||||||||||||
Sbjct: 11542 gatcttctggcggccagggaacttgaacttggc 11574

---

>gb|BC092383.1| Mus musculus ribosomal protein 10, mRNA (cDNA clone MGC:106653
           IMAGE:5710462), complete cds
          Length = 782

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 522 gatcttctggcggccagggaacttgaacttggc 490

---

>gb|AY130414.1| Branchiostoma lanceolatum ribosomal protein L10 mRNA, partial cds
          Length = 581

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 463 gatcttctggcgtccagggaacttgaacttggc 431

---

>gb|AY168758.1| Branchiostoma belcheri tsingtaunese ribosomal protein L10 mRNA,
           complete cds
          Length = 763

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 512 gatcttctggcggccagggaacttgaacttggc 480

---

>ref|XM_212832.3| PREDICTED: Rattus norvegicus ribosomal protein L10 (Rpl10), mRNA
          Length = 761

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 552 gatcttctggcggccagggaacttgaacttggc 520

---

>ref|XM_574109.1| PREDICTED: Rattus norvegicus similar to ribosomal protein L10
           (LOC498828), mRNA
          Length = 756

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 541 gatcttctggcggccagggaacttgaacttggc 509

---

>ref|XM_578693.1| PREDICTED: Rattus norvegicus similar to ribosomal protein L10
           (LOC503169), mRNA
          Length = 942

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 792 gatcttctggcggccagggaacttgaacttggc 760



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 292 ttgaacttggtgaaacccca 311
           ||||||||||||||||||||
Sbjct: 827 ttgaacttggtgaaacccca 808

---

>gb|AY735455.1| Sus scrofa ribosomal protein L10 mRNA, complete cds
          Length = 907

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 666 gatcttctggcggccagggaacttgaacttggc 634

---

>gb|AY911380.1| Bos taurus clone IMAGE:7961519 GekBS044P-like mRNA, complete cds
          Length = 742

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 537 gatcttctggcggccagggaacttgaacttggc 505

---

>emb|AL512582.7| Mouse DNA sequence from clone RP23-290H11 on chromosome 2, complete
             sequence
          Length = 115075

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                              
Query: 327   gatcttttggcgaccagggaacttgaacttggc 359
             |||||| ||||| ||||||||||||||||||||
Sbjct: 58774 gatcttctggcggccagggaacttgaacttggc 58806

---

>dbj|BS000216.1| Pan troglodytes chromosome 22 clone:RP43-057N15, map 22, complete
              sequences
          Length = 164711

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                               
Query: 327    gatcttttggcgaccagggaacttgaacttggc 359
              |||||| ||||| ||||||||||||||||||||
Sbjct: 132522 gatcttctggcggccagggaacttgaacttggc 132554

---

>dbj|AK110755.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-G12, full
           insert sequence
          Length = 870

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 323 caatgatcttttggcgaccagggaacttg 351
           ||||||||||||||||||| |||||||||
Sbjct: 564 caatgatcttttggcgaccggggaacttg 536

---

>gb|BC048872.1| Mus musculus ribosomal protein 10, mRNA (cDNA clone MGC:58990
           IMAGE:5052784), complete cds
          Length = 729

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 501 gatcttctggcggccagggaacttgaacttggc 469

---

>gb|BT021081.1| Bos taurus ribosomal protein L10 (RPL10), mRNA, complete cds
          Length = 718

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 509 gatcttctggcggccagggaacttgaacttggc 477

---

>gb|AC141642.4| Mus musculus BAC clone RP23-274K4 from chromosome 12, complete sequence
          Length = 175025

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                               
Query: 327    gatcttttggcgaccagggaacttgaacttggc 359
              |||||| ||||| ||||||||||||||||||||
Sbjct: 171862 gatcttctggcggccagggaacttgaacttggc 171830

---

>dbj|AP001699.1| Homo sapiens genomic DNA, chromosome 21q, section 43/105
          Length = 340000

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                               
Query: 327    gatcttttggcgaccagggaacttgaacttggc 359
              |||||| ||||| ||||||||||||||||||||
Sbjct: 132714 gatcttctggcggccagggaacttgaacttggc 132746

---

>dbj|AP000893.5| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-659G9, complete
              sequence
          Length = 198024

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                               
Query: 327    gatcttttggcgaccagggaacttgaacttggc 359
              |||||| ||| ||||||||||||||||||||||
Sbjct: 187382 gatcttctggtgaccagggaacttgaacttggc 187414

---

>dbj|AP001767.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-113K21, complete
            sequence
          Length = 154312

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                             
Query: 327  gatcttttggcgaccagggaacttgaacttggc 359
            |||||| ||| ||||||||||||||||||||||
Sbjct: 3110 gatcttctggtgaccagggaacttgaacttggc 3142

---

>emb|CT573034.8| Mouse DNA sequence from clone RP23-156C20 on chromosome 13, complete
              sequence
          Length = 117658

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                               
Query: 327    gatcttttggcgaccagggaacttgaacttggc 359
              |||||| ||||| ||||||||||||||||||||
Sbjct: 113602 gatcttctggcggccagggaacttgaacttggc 113570

---

>gb|AY610342.1| Sus scrofa clone rebs26c_k7.y1.abd, mRNA sequence
          Length = 719

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 520 gatcttctggcggccagggaacttgaacttggc 488

---

>gb|BC006068.1| Mus musculus ribosomal protein 10, mRNA (cDNA clone IMAGE:3593057)
          Length = 728

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 496 gatcttctggcggccagggaacttgaacttggc 464

---

>gb|AC131733.3| Mus musculus BAC clone RP23-98C9 from 8, complete sequence
          Length = 203486

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                               
Query: 327    gatcttttggcgaccagggaacttgaacttggc 359
              |||||| ||||| ||||||||||||||||||||
Sbjct: 158169 gatcttctggcggccagggaacttgaacttggc 158137

---

>gb|AF013804.1| Pinus taeda Wilm's tumor supressor homolog (lp20) mRNA, complete
           cds
          Length = 1055

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 340 ccagggaacttgaacttggcacgac 364
           |||||||||||||||||||||||||
Sbjct: 705 ccagggaacttgaacttggcacgac 681

---

>gb|AC157945.2| Mus musculus BAC clone RP23-289C11 from chromosome 9, complete sequence
          Length = 216396

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                              
Query: 327   gatcttttggcgaccagggaacttgaacttggc 359
             |||||| ||||| ||||||||||||||||||||
Sbjct: 75731 gatcttctggcggccagggaacttgaacttggc 75763

---

>gb|AC161238.7| Mus musculus chromosome 19, clone RP24-288C19, complete sequence
          Length = 193445

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 327   gatcttttggcgaccagggaacttgaacttggc 359
             |||||| ||||| ||||||||||||||||||||
Sbjct: 50857 gatcttctggcggccagggaacttgaacttggc 50825

---

>gb|M93980.1|MUSADIPCT Mouse 24.6 kda protein mRNA, complete cds
          Length = 757

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 327 gatcttttggcgaccagggaacttgaacttggc 359
           |||||| ||||| ||||||||||||||||||||
Sbjct: 536 gatcttctggcggccagggaacttgaacttggc 504

---

>dbj|AP001605.1| Homo sapiens genomic DNA, chromosome 21, clone:KB1987H1, APP-D21S292
             region, complete sequence
          Length = 165942

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                              
Query: 327   gatcttttggcgaccagggaacttgaacttggc 359
             |||||| ||||| ||||||||||||||||||||
Sbjct: 34736 gatcttctggcggccagggaacttgaacttggc 34768

---

>dbj|AP001604.1| Homo sapiens genomic DNA, chromosome 21, clone:KB1648B8, APP-D21S292
              region, complete sequence
          Length = 186930

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                               
Query: 327    gatcttttggcgaccagggaacttgaacttggc 359
              |||||| ||||| ||||||||||||||||||||
Sbjct: 160501 gatcttctggcggccagggaacttgaacttggc 160533

---

>ref|XM_522844.1| PREDICTED: Pan troglodytes similar to ribosomal protein L10-like
           protein (LOC467447), mRNA
          Length = 672

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 328 atcttttggcgaccagggaacttgaacttggc 359
           ||||| ||||| ||||||||||||||||||||
Sbjct: 521 atcttctggcgtccagggaacttgaacttggc 490

---

>gb|AY769278.1| Bombyx mori ribosomal protein L10 (RpL10) mRNA, complete cds
          Length = 726

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           ||||||||| || || ||||||||||||||||||||
Sbjct: 513 gatcttttgacgtccggggaacttgaacttggcacg 478

---

>ref|XM_360593.1| Magnaporthe grisea 70-15 hypothetical protein (MG03136.4) partial
           mRNA
          Length = 660

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 324 aatgatcttttggcgaccagggaacttg 351
           |||||||||||||||||| |||||||||
Sbjct: 498 aatgatcttttggcgaccggggaacttg 471

---

>ref|XM_582414.2| PREDICTED: Bos taurus similar to ribosomal protein L10 (LOC538748),
           mRNA
          Length = 646

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 328 atcttttggcgaccagggaacttgaacttggc 359
           ||||| ||||| ||||||||||||||||||||
Sbjct: 495 atcttctggcgcccagggaacttgaacttggc 464

---

>gb|BC014310.1| Homo sapiens ribosomal protein L10-like, mRNA (cDNA clone MGC:22634
           IMAGE:3935452), complete cds
          Length = 838

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 328 atcttttggcgaccagggaacttgaacttggc 359
           ||||| ||||| ||||||||||||||||||||
Sbjct: 583 atcttctggcgtccagggaacttgaacttggc 552

---

>ref|NM_080746.2| Homo sapiens ribosomal protein L10-like (RPL10L), mRNA
          Length = 838

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 328 atcttttggcgaccagggaacttgaacttggc 359
           ||||| ||||| ||||||||||||||||||||
Sbjct: 583 atcttctggcgtccagggaacttgaacttggc 552

---

>gb|AC140545.26| Medicago truncatula clone mth2-11g18, complete sequence
          Length = 129414

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                      
Query: 325    atgatcttttggcgaccagggaacttgaacttggcacgac 364
              ||||||||||| || ||||||||||| ||||| |||||||
Sbjct: 106479 atgatcttttgacggccagggaacttaaacttagcacgac 106518

---

>emb|BX071887.1|CNS09RMR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 549 gatcttctggcggccggggaacttgaacttggcacg 514

---

>emb|BX071440.1|CNS09RAC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 750

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 346 gatcttctggcggccggggaacttgaacttggcacg 381

---

>emb|BX071439.1|CNS09RAB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 840

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 558 gatcttctggcggccggggaacttgaacttggcacg 523

---

>emb|BX070864.1|CNS09QUC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8AG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 736

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 295 gatcttctggcggccggggaacttgaacttggcacg 330

---

>emb|BX070863.1|CNS09QUB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 556

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 368 gatcttctggcggccggggaacttgaacttggcacg 333

---

>emb|BX070583.1|CNS09QMJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 552 gatcttctggcggccggggaacttgaacttggcacg 517

---

>emb|BX070408.1|CNS09QHO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 703

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 306 gatcttctggcggccggggaacttgaacttggcacg 341

---

>emb|BX070407.1|CNS09QHN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 797

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 542 gatcttctggcggccggggaacttgaacttggcacg 507

---

>emb|BX070073.1|CNS09Q8D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 422

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 356 gatcttctggcggccggggaacttgaacttggcacg 391

---

>emb|BX070072.1|CNS09Q8C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 685

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 549 gatcttctggcggccggggaacttgaacttggcacg 514

---

>emb|BX070039.1|CNS09Q7F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 675

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 312 gatcttctggcggccggggaacttgaacttggcacg 347

---

>emb|BX070038.1|CNS09Q7E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 783

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 555 gatcttctggcggccggggaacttgaacttggcacg 520

---

>emb|BX069787.1|CNS09Q0F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 547 gatcttctggcggccggggaacttgaacttggcacg 512

---

>emb|BX066234.1|CNS09N9Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 837

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 547 gatcttctggcggccggggaacttgaacttggcacg 512

---

>emb|BX066200.1|CNS09N8S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 543 gatcttctggcggccggggaacttgaacttggcacg 508

---

>emb|BX065195.1|CNS09MGV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48DH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 622

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 327 gatcttctggcggccggggaacttgaacttggcacg 362

---

>emb|BX065194.1|CNS09MGU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 603

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 549 gatcttctggcggccggggaacttgaacttggcacg 514

---

>emb|BX065178.1|CNS09MGE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 855

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 296 gatcttctggcggccggggaacttgaacttggcacg 331

---

>emb|BX065177.1|CNS09MGD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 864

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 542 gatcttctggcggccggggaacttgaacttggcacg 507

---

>emb|BX065011.1|CNS09MBR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 843

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 260 gatcttctggcggccggggaacttgaacttggcacg 295

---

>emb|BX065010.1|CNS09MBQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 852

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 446 gatcttctggcggccggggaacttgaacttggcacg 411

---

>emb|BX064957.1|CNS09MA9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 906

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 302 gatcttctggcggccggggaacttgaacttggcacg 337

---

>emb|BX064956.1|CNS09MA8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 538 gatcttctggcggccggggaacttgaacttggcacg 503

---

>emb|BX064177.1|CNS09LOL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 334 gatcttctggcggccggggaacttgaacttggcacg 369

---

>emb|BX064176.1|CNS09LOK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 523 gatcttctggcggccggggaacttgaacttggcacg 488

---

>emb|BX063991.1|CNS09LJF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 564 gatcttctggcggccggggaacttgaacttggcacg 529

---

>emb|BX063841.1|CNS09LF9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 460

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 324 gatcttctggcggccggggaacttgaacttggcacg 359

---

>emb|BX063840.1|CNS09LF8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 687

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 327 gatcttttggcgaccagggaacttgaacttggcacg 362
           |||||| ||||| || ||||||||||||||||||||
Sbjct: 546 gatcttctggcggccggggaacttgaacttggcacg 511


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,245,644
Number of Sequences: 3902068
Number of extensions: 4245644
Number of successful extensions: 79497
Number of sequences better than 10.0: 789
Number of HSP's better than 10.0 without gapping: 788
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 78139
Number of HSP's gapped (non-prelim): 1348
length of query: 437
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 415
effective length of database: 17,147,199,772
effective search space: 7116087905380
effective search space used: 7116087905380
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---