ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart12b03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|BX640677.1|HSM806736 Homo sapiens genomic DNA; cDNA DKFZp686... 44 0.18
2gb|AC091565.10| Homo sapiens chromosome 15, clone RP11-228M15, c... 44 0.18
3gb|AC025138.14| Homo sapiens chromosome 15, clone RP11-291O21, c... 44 0.18
4gb|AC137568.8| Homo sapiens chromosome 15, clone RP11-1217C12, c... 44 0.18
5gb|AC055876.16| Homo sapiens chromosome 15, clone RP11-578F21, c... 44 0.18
6gb|AC126332.9| Homo sapiens chromosome 15, clone RP11-665A22, co... 44 0.18
7gb|AE017157.1| Chlamydophila pneumoniae TW-183, section 1 of 4 o... 42 0.73
8gb|AE002161.1| Chlamydophila pneumoniae AR39, complete genome 42 0.73
9gb|AE001363.1| Chlamydophila pneumoniae CWL029, complete genome 42 0.73
10dbj|BA000008.3| Chlamydophila pneumoniae J138 genomic DNA, compl... 42 0.73
11emb|AL033514.1|CEY75B8A Caenorhabditis elegans YAC Y75B8A, compl... 42 0.73
12gb|U64833.1| Caenorhabditis elegans cosmid B0507, complete sequence 40 2.9
13emb|CR378680.1| Photobacterium profundum SS9 chromosome 2; segme... 40 2.9
14gb|AC106897.5| Homo sapiens BAC clone RP11-279O9 from 4, complet... 40 2.9
15gb|AC154128.3| Tribolium castaneum BAC T.cast_C36A24 (Clemson U... 40 2.9

>emb|BX640677.1|HSM806736 Homo sapiens genomic DNA; cDNA DKFZp686K1692 (from clone
            DKFZp686K1692)
          Length = 5959

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 30   atttttgaaaagtctttttgct 51
            ||||||||||||||||||||||
Sbjct: 2313 atttttgaaaagtctttttgct 2334



to top

>gb|AC091565.10| Homo sapiens chromosome 15, clone RP11-228M15, complete sequence
          Length = 180741

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 30     atttttgaaaagtctttttgct 51
              ||||||||||||||||||||||
Sbjct: 109988 atttttgaaaagtctttttgct 109967



to top

>gb|AC025138.14| Homo sapiens chromosome 15, clone RP11-291O21, complete sequence
          Length = 173173

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 30    atttttgaaaagtctttttgct 51
             ||||||||||||||||||||||
Sbjct: 33795 atttttgaaaagtctttttgct 33774



to top

>gb|AC137568.8| Homo sapiens chromosome 15, clone RP11-1217C12, complete sequence
          Length = 199045

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 30    atttttgaaaagtctttttgct 51
             ||||||||||||||||||||||
Sbjct: 98265 atttttgaaaagtctttttgct 98244



to top

>gb|AC055876.16| Homo sapiens chromosome 15, clone RP11-578F21, complete sequence
          Length = 192533

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 30    atttttgaaaagtctttttgct 51
             ||||||||||||||||||||||
Sbjct: 16414 atttttgaaaagtctttttgct 16435



to top

>gb|AC126332.9| Homo sapiens chromosome 15, clone RP11-665A22, complete sequence
          Length = 161099

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 30    atttttgaaaagtctttttgct 51
             ||||||||||||||||||||||
Sbjct: 42892 atttttgaaaagtctttttgct 42871



to top

>gb|AE017157.1| Chlamydophila pneumoniae TW-183, section 1 of 4 of the complete genome
          Length = 300923

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 26     tcaaatttttgaaaagtcttt 46
              |||||||||||||||||||||
Sbjct: 136224 tcaaatttttgaaaagtcttt 136244



to top

>gb|AE002161.1| Chlamydophila pneumoniae AR39, complete genome
          Length = 1229853

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 26     tcaaatttttgaaaagtcttt 46
              |||||||||||||||||||||
Sbjct: 702472 tcaaatttttgaaaagtcttt 702452



to top

>gb|AE001363.1| Chlamydophila pneumoniae CWL029, complete genome
          Length = 1230230

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 26     tcaaatttttgaaaagtcttt 46
              |||||||||||||||||||||
Sbjct: 138729 tcaaatttttgaaaagtcttt 138749



to top

>dbj|BA000008.3| Chlamydophila pneumoniae J138 genomic DNA, complete sequence
          Length = 1226565

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 26     tcaaatttttgaaaagtcttt 46
              |||||||||||||||||||||
Sbjct: 138440 tcaaatttttgaaaagtcttt 138460



to top

>emb|AL033514.1|CEY75B8A Caenorhabditis elegans YAC Y75B8A, complete sequence
          Length = 298406

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 28     aaatttttgaaaagtcttttt 48
              |||||||||||||||||||||
Sbjct: 168333 aaatttttgaaaagtcttttt 168353



to top

>gb|U64833.1| Caenorhabditis elegans cosmid B0507, complete sequence
          Length = 36709

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    ttcaaatttttgaaaagtct 44
             ||||||||||||||||||||
Sbjct: 29114 ttcaaatttttgaaaagtct 29133



to top

>emb|CR378680.1| Photobacterium profundum SS9 chromosome 2; segment 6/7
          Length = 349751

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 25     ttcaaatttttgaaaagtcttttt 48
              ||||||||||||||||| ||||||
Sbjct: 148547 ttcaaatttttgaaaaggcttttt 148570



to top

>gb|AC106897.5| Homo sapiens BAC clone RP11-279O9 from 4, complete sequence
          Length = 161572

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 30    atttttgaaaagtctttttgctta 53
             ||||||||||||||||||| ||||
Sbjct: 23979 atttttgaaaagtctttttactta 23956



to top

>gb|AC154128.3| Tribolium castaneum  BAC T.cast_C36A24 (Clemson University Genomics
              Institute Tribolium castaneum BAC Library (Red Flour
              Beetle)) complete sequence
          Length = 154107

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 30     atttttgaaaagtctttttg 49
              ||||||||||||||||||||
Sbjct: 103295 atttttgaaaagtctttttg 103314


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,014,648
Number of Sequences: 3902068
Number of extensions: 2014648
Number of successful extensions: 140967
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 140896
Number of HSP's gapped (non-prelim): 71
length of query: 225
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 203
effective length of database: 17,147,199,772
effective search space: 3480881553716
effective search space used: 3480881553716
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top