ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart11f02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|BX005269.4| Zebrafish DNA sequence from clone CH211-160L17 i... 44 0.16
2gb|AC122268.5| Mus musculus BAC clone RP23-216B15 from 14, compl... 42 0.63
3gb|AC025669.19| Mus musculus chromosome 14, clone RP23-5O16, com... 42 0.63
4gb|AC099645.11| Mus musculus chromosome 15, clone RP23-426G4, co... 40 2.5
5gb|AC122309.5| Mus musculus BAC clone RP23-293G2 from chromosome... 40 2.5
6gb|AC163008.9| Mus musculus chromosome 15, clone RP23-105P11, co... 40 2.5
7gb|AC116657.3| Mus musculus BAC clone RP23-289E18 from 15, compl... 40 2.5
8ref|XM_725354.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 2.5
9emb|AL596306.4| Human DNA sequence from clone RP11-304M3 on chro... 40 2.5
10gb|AC011586.9| Homo sapiens, clone RP11-13N12, complete sequence 40 2.5
11gb|AC008209.5|AC008209 Drosophila melanogaster, chromosome 3R, r... 40 2.5
12gb|AC010580.5|AC010580 Drosophila melanogaster, chromosome 3R, r... 40 2.5
13gb|AE003753.3| Drosophila melanogaster chromosome 3R, section 91... 40 2.5
14gb|U18055.1|LEU18055 Lycopersicon esculentum 1-aminocyclopropane... 40 2.5
15gb|L34171.1|TOMACS3A Lycopersicon esculentum 1-aminocyclopropane... 40 2.5
16gb|AC166107.4| Mus musculus BAC clone RP23-205A7 from chromosome... 38 9.8
17gb|AC146030.3| Pan troglodytes BAC clone RP43-124E21 from chromo... 38 9.8
18ref|XM_664500.1| Plasmodium berghei strain ANKA hypothetical pro... 38 9.8
19gb|AF228759.1| Escherichia coli O157:H- plasmid pSFO157, partial... 38 9.8
20emb|AL354830.8| Human DNA sequence from clone RP11-193G17 on chr... 38 9.8
21gb|CP000087.1| Rickettsia bellii RML369-C, complete genome 38 9.8
22emb|AJ131667.1|ECO131667 Escherichia coli plasmid pSFO157 38 9.8
23gb|AC013562.6| Homo sapiens chromosome 8, clone RP11-313C15, com... 38 9.8
24gb|AC116529.16| Mus musculus chromosome 8, clone RP24-380O18, co... 38 9.8
25gb|DQ068068.1| Uncultured bacterium BAC17H8, complete sequence 38 9.8
26gb|AC006918.9| Arabidopsis thaliana chromosome 2 clone F18P14 ma... 38 9.8
27gb|AC103794.2| Homo sapiens chromosome 11, clone CTD-3096P4, com... 38 9.8
28gb|AC046175.6| Homo sapiens chromosome 8, clone RP11-577O23, com... 38 9.8
29gb|AC073468.9| Homo sapiens BAC clone RP11-405I21 from 7, comple... 38 9.8
30gb|AC092360.2| Homo sapiens chromosome 5 clone RP11-346B2, compl... 38 9.8
31gb|AC026951.5|AC026951 Homo sapiens chromosome 15, clone RP11-45... 38 9.8
32gb|AC104069.3| Homo sapiens BAC clone RP11-279B11 from 2, comple... 38 9.8
33gb|AF296829.1|F3D18 Arabidopsis thaliana BAC F3D18 38 9.8
34gb|AC020646.2|AC020646 Genomic sequence for Arabidopsis thaliana... 38 9.8
35emb|AL590390.5| Mouse DNA sequence from clone RP23-294H14 on chr... 38 9.8
36emb|AL928990.4| Zebrafish DNA sequence from clone CH211-11F8, co... 38 9.8
37dbj|AB062091.1| Arabidopsis thaliana DNA, chromosome 1 centromer... 38 9.8
38dbj|AB046433.1| Arabidopsis thaliana DNA, chromosome 5 centromer... 38 9.8
39gb|AC154800.2| Mus musculus BAC clone RP24-496O9 from 14, comple... 38 9.8
40gb|AY103953.1| Zea mays PCO098564 mRNA sequence 38 9.8
41gb|AC114589.30| Mus musculus chromosome 8, clone RP23-365O13, co... 38 9.8
42emb|AL732628.18| Zebrafish DNA sequence from clone CH211-144F18 ... 38 9.8
43gb|AC147899.2| Xenopus tropicalis clone CH216-53A2, complete seq... 38 9.8 
>emb|BX005269.4| Zebrafish DNA sequence from clone CH211-160L17 in linkage group 2,
             complete sequence
          Length = 185170

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 86    taaagttatttaaatattggaa 107
             ||||||||||||||||||||||
Sbjct: 14179 taaagttatttaaatattggaa 14200
to top
>gb|AC122268.5| Mus musculus BAC clone RP23-216B15 from 14, complete sequence
          Length = 207136

 Score = 42.1 bits (21), Expect = 0.63
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 31    actaaaatacgacattgttca 51
             |||||||||||||||||||||
Sbjct: 10131 actaaaatacgacattgttca 10111
to top
>gb|AC025669.19| Mus musculus chromosome 14, clone RP23-5O16, complete sequence
          Length = 203826

 Score = 42.1 bits (21), Expect = 0.63
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 31     actaaaatacgacattgttca 51
              |||||||||||||||||||||
Sbjct: 138493 actaaaatacgacattgttca 138473
to top
>gb|AC099645.11| Mus musculus chromosome 15, clone RP23-426G4, complete sequence
          Length = 208095

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 86    taaagttatttaaatattgg 105
             ||||||||||||||||||||
Sbjct: 80399 taaagttatttaaatattgg 80418
to top
>gb|AC122309.5| Mus musculus BAC clone RP23-293G2 from chromosome 14, complete sequence
          Length = 208443

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 85     ataaagttatttaaatattg 104
              ||||||||||||||||||||
Sbjct: 164635 ataaagttatttaaatattg 164616
to top
>gb|AC163008.9| Mus musculus chromosome 15, clone RP23-105P11, complete sequence
          Length = 211071

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 86     taaagttatttaaatattgg 105
              ||||||||||||||||||||
Sbjct: 208456 taaagttatttaaatattgg 208437
to top
>gb|AC116657.3| Mus musculus BAC clone RP23-289E18 from 15, complete sequence
          Length = 184557

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 86    taaagttatttaaatattgg 105
             ||||||||||||||||||||
Sbjct: 24071 taaagttatttaaatattgg 24052
to top
>ref|XM_725354.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY00246)
           partial mRNA
          Length = 1404

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 93  atttaaatattggaatcaagggaa 116
           ||||||| ||||||||||||||||
Sbjct: 641 atttaaaaattggaatcaagggaa 664
to top
>emb|AL596306.4| Human DNA sequence from clone RP11-304M3 on chromosome 13 Contains the
             3' end of the COG6 gene for component of oligomeric golgi
             complex 6 (KIAA1134, COD2) and a novel protein similar to
             RIKEN cDNA A430101B06 gene (MGC1307) pseudogene, complete
             sequence
          Length = 69027

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 93    atttaaatattggaatcaag 112
             ||||||||||||||||||||
Sbjct: 31071 atttaaatattggaatcaag 31052
to top
>gb|AC011586.9| Homo sapiens, clone RP11-13N12, complete sequence
          Length = 167475

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 92     tatttaaatattggaatcaa 111
              ||||||||||||||||||||
Sbjct: 107841 tatttaaatattggaatcaa 107822
to top
>gb|AC008209.5|AC008209 Drosophila melanogaster, chromosome 3R, region 96F-96F, BAC clone
             BACR06K17, complete sequence
          Length = 169902

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 134   aagtgactaaagtactgggataaa 157
             ||||||||||||||| ||||||||
Sbjct: 11152 aagtgactaaagtaccgggataaa 11129
to top
>gb|AC010580.5|AC010580 Drosophila melanogaster, chromosome 3R, region 96F-96F, BAC clone
             BACR48J06, complete sequence
          Length = 163970

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 134   aagtgactaaagtactgggataaa 157
             ||||||||||||||| ||||||||
Sbjct: 81921 aagtgactaaagtaccgggataaa 81898
to top
>gb|AE003753.3| Drosophila melanogaster chromosome 3R, section 91 of 118 of the
             complete sequence
          Length = 226793

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 134   aagtgactaaagtactgggataaa 157
             ||||||||||||||| ||||||||
Sbjct: 76937 aagtgactaaagtaccgggataaa 76914
to top
>gb|U18055.1|LEU18055 Lycopersicon esculentum 1-aminocyclopropane-1-carboxylate synthase
            (LE-ACS3) DNA, partial cds
          Length = 4782

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   aaaatacgacattgttcaat 53
            ||||||||||||||||||||
Sbjct: 4430 aaaatacgacattgttcaat 4449
to top
>gb|L34171.1|TOMACS3A Lycopersicon esculentum 1-aminocyclopropane-1-carboxylate synthase
            (LE-ACS3) gene, complete cds
          Length = 4801

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   aaaatacgacattgttcaat 53
            ||||||||||||||||||||
Sbjct: 4687 aaaatacgacattgttcaat 4706
to top
>gb|AC166107.4| Mus musculus BAC clone RP23-205A7 from chromosome 6, complete sequence
          Length = 177843

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 7     gcacaaatatatcaaaggt 25
             |||||||||||||||||||
Sbjct: 28396 gcacaaatatatcaaaggt 28414
to top
>gb|AC146030.3| Pan troglodytes BAC clone RP43-124E21 from chromosome 7, complete
              sequence
          Length = 169275

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 77     attttacgataaagttatt 95
              |||||||||||||||||||
Sbjct: 111332 attttacgataaagttatt 111350
to top
>ref|XM_664500.1| Plasmodium berghei strain ANKA hypothetical protein (PB300911.00.0)
           partial mRNA
          Length = 621

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 89  agttatttaaatattggaa 107
           |||||||||||||||||||
Sbjct: 148 agttatttaaatattggaa 166
to top
>gb|AF228759.1| Escherichia coli O157:H- plasmid pSFO157, partial sequence
          Length = 32021

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 4     aaagcacaaatatatcaaa 22
             |||||||||||||||||||
Sbjct: 22433 aaagcacaaatatatcaaa 22451
to top
>emb|AL354830.8| Human DNA sequence from clone RP11-193G17 on chromosome 13 Contains the
              gene for a novel protein similar to prothymosin, complete
              sequence
          Length = 152555

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 11     aaatatatcaaaggttggc 29
              |||||||||||||||||||
Sbjct: 118236 aaatatatcaaaggttggc 118254
to top
>gb|CP000087.1| Rickettsia bellii RML369-C, complete genome
          Length = 1522076

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 84     gataaagttatttaaatat 102
              |||||||||||||||||||
Sbjct: 129822 gataaagttatttaaatat 129804
to top
>emb|AJ131667.1|ECO131667 Escherichia coli plasmid pSFO157
          Length = 8632

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 4    aaagcacaaatatatcaaa 22
            |||||||||||||||||||
Sbjct: 8504 aaagcacaaatatatcaaa 8522
to top
>gb|AC013562.6| Homo sapiens chromosome 8, clone RP11-313C15, complete sequence
          Length = 188755

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 165   ggaagtgacaattcattca 183
             |||||||||||||||||||
Sbjct: 24803 ggaagtgacaattcattca 24821
to top
>gb|AC116529.16| Mus musculus chromosome 8, clone RP24-380O18, complete sequence
          Length = 166863

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 103   tggaatcaagggaagggta 121
             |||||||||||||||||||
Sbjct: 30222 tggaatcaagggaagggta 30204
to top
>gb|DQ068068.1| Uncultured bacterium BAC17H8, complete sequence
          Length = 135294

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 168   agtgacaattcattcaccg 186
             |||||||||||||||||||
Sbjct: 48627 agtgacaattcattcaccg 48645
to top
>gb|AC006918.9| Arabidopsis thaliana chromosome 2 clone F18P14 map ve013, complete
             sequence
          Length = 104292

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 25    ttggcgactaaaatacgac 43
             |||||||||||||||||||
Sbjct: 75890 ttggcgactaaaatacgac 75872
to top
>gb|AC103794.2| Homo sapiens chromosome 11, clone CTD-3096P4, complete sequence
          Length = 211445

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 125   gggcatctgaagtgactaaagta 147
             |||| ||||||||||||||||||
Sbjct: 30787 gggcttctgaagtgactaaagta 30765
to top
>gb|AC046175.6| Homo sapiens chromosome 8, clone RP11-577O23, complete sequence
          Length = 194972

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 1     tcaaaagcacaaatatatcaaag 23
             |||||||||| ||||||||||||
Sbjct: 41752 tcaaaagcactaatatatcaaag 41730
to top
>gb|AC073468.9| Homo sapiens BAC clone RP11-405I21 from 7, complete sequence
          Length = 138435

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 77    attttacgataaagttatt 95
             |||||||||||||||||||
Sbjct: 54502 attttacgataaagttatt 54520
to top
>gb|AC092360.2| Homo sapiens chromosome 5 clone RP11-346B2, complete sequence
          Length = 130737

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 87   aaagttatttaaatattggaatc 109
            ||||||||||||||||| |||||
Sbjct: 9007 aaagttatttaaatatttgaatc 8985
to top
>gb|AC026951.5|AC026951 Homo sapiens chromosome 15, clone RP11-456J20, complete sequence
          Length = 206590

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 136   gtgactaaagtactgggataaac 158
             |||||| ||||||||||||||||
Sbjct: 70818 gtgactgaagtactgggataaac 70840
to top
>gb|AC104069.3| Homo sapiens BAC clone RP11-279B11 from 2, complete sequence
          Length = 155106

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 148   ctgggataaactggaaggg 166
             |||||||||||||||||||
Sbjct: 79552 ctgggataaactggaaggg 79534
to top
>gb|AF296829.1|F3D18 Arabidopsis thaliana BAC F3D18
          Length = 88126

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 25    ttggcgactaaaatacgac 43
             |||||||||||||||||||
Sbjct: 53542 ttggcgactaaaatacgac 53560
to top
>gb|AC020646.2|AC020646 Genomic sequence for Arabidopsis thaliana BAC T32E20 from chromosome I,
             complete sequence
          Length = 103931

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 25    ttggcgactaaaatacgac 43
             |||||||||||||||||||
Sbjct: 30317 ttggcgactaaaatacgac 30299
to top
>emb|AL590390.5| Mouse DNA sequence from clone RP23-294H14 on chromosome X, complete
             sequence
          Length = 114156

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 95    ttaaatattggaatcaagg 113
             |||||||||||||||||||
Sbjct: 78786 ttaaatattggaatcaagg 78804
to top
>emb|AL928990.4| Zebrafish DNA sequence from clone CH211-11F8, complete sequence
          Length = 185618

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 85     ataaagttatttaaatatt 103
              |||||||||||||||||||
Sbjct: 110585 ataaagttatttaaatatt 110603
to top
>dbj|AB062091.1| Arabidopsis thaliana DNA, chromosome 1 centromere region, BAC
             clone:F9A12
          Length = 96161

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 25    ttggcgactaaaatacgac 43
             |||||||||||||||||||
Sbjct: 79583 ttggcgactaaaatacgac 79601
to top
>dbj|AB046433.1| Arabidopsis thaliana DNA, chromosome 5 centromere region, clone:F11C12
          Length = 116966

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 25     ttggcgactaaaatacgac 43
              |||||||||||||||||||
Sbjct: 113353 ttggcgactaaaatacgac 113371
to top
>gb|AC154800.2| Mus musculus BAC clone RP24-496O9 from 14, complete sequence
          Length = 175264

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 87    aaagttatttaaatattgg 105
             |||||||||||||||||||
Sbjct: 15208 aaagttatttaaatattgg 15190
to top
>gb|AY103953.1| Zea mays PCO098564 mRNA sequence
          Length = 1646

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 142  aaagtactgggataaactggaag 164
            |||| ||||||||||||||||||
Sbjct: 1034 aaaggactgggataaactggaag 1056
to top
>gb|AC114589.30| Mus musculus chromosome 8, clone RP23-365O13, complete sequence
          Length = 213866

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 103   tggaatcaagggaagggta 121
             |||||||||||||||||||
Sbjct: 17462 tggaatcaagggaagggta 17480
to top
>emb|AL732628.18| Zebrafish DNA sequence from clone CH211-144F18 in linkage group 19,
              complete sequence
          Length = 174130

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 85     ataaagttatttaaatatt 103
              |||||||||||||||||||
Sbjct: 162283 ataaagttatttaaatatt 162301
to top
>gb|AC147899.2| Xenopus tropicalis clone CH216-53A2, complete sequence
          Length = 158405

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 1     tcaaaagcacaaatatatc 19
             |||||||||||||||||||
Sbjct: 28597 tcaaaagcacaaatatatc 28579


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,852,620
Number of Sequences: 3902068
Number of extensions: 1852620
Number of successful extensions: 158485
Number of sequences better than 10.0: 43
Number of HSP's better than 10.0 without gapping: 43
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 158363
Number of HSP's gapped (non-prelim): 122
length of query: 197
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 175
effective length of database: 17,147,199,772
effective search space: 3000759960100
effective search space used: 3000759960100
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top