ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart11f01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X84056.1|HVPAF93 H.vulgare paf93 gene 892 0.0
2gb|AF043093.1|AF043093 Hordeum vulgare dehydrin 8 (dhn8) gene, c... 543 e-151
3gb|U73211.1|TAU73211 Triticum aestivum cold acclimation protein ... 426 e-116
4gb|U73210.1|TAU73210 Triticum aestivum cold acclimation protein ... 408 e-111
5gb|AF181458.1|AF181458 Hordeum vulgare dehydrin (Dhn8) mRNA, com... 406 e-110
6gb|L29152.1|WHTWCOR Triticum aestivum cold acclimation protein (... 402 e-109
7gb|L19419.1|LHPESI Lophopyrum elongatum ES135 mRNA sequence 377 e-101
8emb|AJ890140.1| Triticum turgidum subsp. durum mRNA for dehydrin... 341 1e-90
9gb|AY574032.1| Triticum aestivum dehydrin-like gene, partial seq... 143 6e-31
10gb|AY587109.1| Oryza sativa (japonica cultivar-group) dehydratio... 105 1e-19
11gb|AY786415.1| Oryza sativa (japonica cultivar-group) SK3-type d... 105 1e-19
12dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 105 1e-19
13dbj|AP004858.3| Oryza sativa (japonica cultivar-group) genomic D... 105 1e-19
14dbj|AP005055.2| Oryza sativa (japonica cultivar-group) genomic D... 105 1e-19
15dbj|AK070197.1| Oryza sativa (japonica cultivar-group) cDNA clon... 105 1e-19
16dbj|AB011367.1| Oryza sativa mRNA for LIP9, partial cds 105 1e-19
17gb|AY105067.1| Zea mays PCO081051 mRNA sequence 88 3e-14
18gb|BT019045.1| Zea mays clone Contig566.F mRNA sequence 64 4e-07
19gb|L35913.1|MZELIPASE Zea mays dehydrin (dhn-2) mRNA, complete cds 64 4e-07
20gb|AY111114.1| Zea mays CL2452_1 mRNA sequence 64 4e-07
21emb|AJ439990.1|OSA439990 Oryza sativa partial mRNA for putative ... 60 7e-06
22emb|AL808127.4| Mouse DNA sequence from clone RP23-263L18 on chr... 48 0.026
23dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.40
24dbj|AK073885.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.40
25gb|AC102686.7| Mus musculus chromosome 1, clone RP24-467J24, com... 42 1.6
26gb|AY349246.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559 ... 42 1.6
27gb|AY349245.1| Hordeum vulgare subsp. spontaneum NPGS PI 560556 ... 42 1.6
28gb|AY349244.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 ... 42 1.6
29gb|AY349243.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 ... 42 1.6
30gb|AY349242.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 ... 42 1.6
31gb|AY349241.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 ... 42 1.6
32gb|AY349240.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 ... 42 1.6
33gb|AY349239.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 ... 42 1.6
34gb|AY349238.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 ... 42 1.6
35gb|AY349237.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 ... 42 1.6
36gb|AY349236.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 ... 42 1.6
37gb|AY349235.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 ... 42 1.6
38gb|AY349234.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 ... 42 1.6
39gb|AY349233.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 ... 42 1.6
40gb|AY349232.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 ... 42 1.6
41gb|AY349231.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 ... 42 1.6
42gb|AY349230.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 ... 42 1.6
43gb|AY349229.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 ... 42 1.6
44gb|AY349228.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 ... 42 1.6
45gb|AY349227.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 ... 42 1.6
46gb|AY349226.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 ... 42 1.6
47gb|AY349225.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 ... 42 1.6
48gb|AY349224.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 ... 42 1.6
49gb|AY349223.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 ... 42 1.6
50gb|AY349222.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 ... 42 1.6
51gb|AY349221.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 ... 42 1.6
52gb|AY349220.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 ... 42 1.6
53emb|AL138725.19| Human DNA sequence from clone RP11-528A10 on ch... 42 1.6
54emb|AL772148.6| Zebrafish DNA sequence from clone CH211-153C20 i... 42 1.6
55gb|DQ015701.1| Ovis aries endothelial nitric oxide synthase mRNA... 42 1.6
56gb|AF031247.1|AF031247 Lophopyrum elongatum dehydrin-/LEA group ... 42 1.6
57emb|BX322785.6| Zebrafish DNA sequence from clone DKEYP-78B1 in ... 42 1.6
58gb|AC147034.2| Mus musculus BAC clone RP23-189C2 from chromosome... 42 1.6
59gb|AF181455.1|AF181455 Hordeum vulgare dehydrin (Dhn5) gene, com... 42 1.6
60gb|AY105409.1| Zea mays PCO095801 mRNA sequence 42 1.6
61gb|AF043096.1|AF043096 Hordeum vulgare dehydrin 5 (dhn5) gene, c... 42 1.6
62gb|AF058794.1|AF058794 Triticum aestivum COR39 (cor39) mRNA, com... 42 1.6
63gb|M95810.1|BLYDHN5 Hordeum vulgare dehydrin DHN5 (Dhn5) gene, c... 42 1.6
64gb|M99057.1|BOVNIOXSY Bovine nitric oxide synthase mRNA, complet... 42 1.6
65gb|M89952.1|BOVECNOS Bos taurus endothelial nitric oxide synthas... 42 1.6
66gb|AC145325.3| Oryza sativa (japonica cultivar-group) chromosome... 40 6.3
67gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, com... 40 6.3
68gb|AC164098.4| Mus musculus BAC clone RP23-341D24 from chromosom... 40 6.3
69ref|XM_760938.1| Theileria parva strain Muguga chromosome 1 hypo... 40 6.3
70gb|AC144479.1| Pan troglodytes BAC clone RP43-126P12 from 7, com... 40 6.3
71emb|CR339044.19| Zebrafish DNA sequence from clone CH211-122G23 ... 40 6.3
72emb|BX927212.11| Zebrafish DNA sequence from clone CH211-262A5 i... 40 6.3
73gb|AE012230.1| Xanthomonas campestris pv. campestris str. ATCC 3... 40 6.3
74gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 40 6.3
75dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
76dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
77gb|AF031248.1|AF031248 Lophopyrum elongatum dehydrin-/LEA group ... 40 6.3
78dbj|AP003263.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
79dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 40 6.3
80dbj|AB105039.1| Daucus carota CAISE1 mRNA for dehydrin protein, ... 40 6.3
81gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 6.3
82dbj|BS000095.1| Pan troglodytes chromosome 22 clone:RP43-177D07,... 40 6.3
83dbj|BS000094.1| Pan troglodytes chromosome 22 clone:PTB-240N13, ... 40 6.3
84emb|Y00842.1|OSRAB21 Rice rab21 gene for water-stress inducible ... 40 6.3
85emb|X78429.1|TDDEH16 T.durum Desf. (Siliana) Dehydrin mRNA, clon... 40 6.3
86emb|X15287.1|HVDHN18 Barley mRNA for dehydrin (dhn18) 40 6.3
87emb|X15286.1|HVDHN17 Barley mRNA for dehydrin (dhn17) 40 6.3
88gb|U60097.2|OSU60097 Oryza sativa dehydrin mRNA, complete cds 40 6.3
89gb|AF181453.1|AF181453 Hordeum vulgare dehydrin (Dhn3) gene, com... 40 6.3
90gb|AC140483.3| Mus musculus BAC clone RP24-145A22 from 1, comple... 40 6.3
91gb|AF043089.1|AF043089 Hordeum vulgare dehydrin 3 (dhn3) gene, c... 40 6.3
92dbj|AP001690.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 6.3
93dbj|AP000469.3| Homo sapiens genomic DNA, chromosome 21q, clone:... 40 6.3
94gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 6.3

>emb|X84056.1|HVPAF93 H.vulgare paf93 gene
          Length = 1154

 Score =  892 bits (450), Expect = 0.0
 Identities = 462/466 (99%)
 Strand = Plus / Minus

                                                                        
Query: 2    ggcggaaatctttaatatcaaggcataatgcccagcaataaaccaatacacaaagtgccc 61
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1154 ggcggaaatctttaatatcaaggcataatgcccagcaataaaccaatacacaaagtgccc 1095

                                                                        
Query: 62   gtaataataagcaaataaacttaaacaacatccaggacctgactctggaccaaactgaag 121
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1094 gtaataataagcaaataaacttaaacaacatccaggacctgactctggaccaaactgaag 1035

                                                                        
Query: 122  cccgtatacccaaactgaacacaagcatccgtcacctaacgggcttcacagaccggacct 181
            |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 1034 cccgtatacccaaactgaacacaagcatccgtcacctaacggacttcacagaccggacct 975

                                                                        
Query: 182  tcaaagacgatcaatccctccatcttgacacggacttaaacttaaagcaaacacgacaca 241
            |||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||
Sbjct: 974  tcaaagacgatcaatccctccatcttgacacggacttagacgtaaagcaaacacgacaca 915

                                                                        
Query: 242  cgccaacaatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctct 301
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 914  cgccaacaatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctct 855

                                                                        
Query: 302  gggcttgtgctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaacc 361
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 854  gggcttgtgctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaacc 795

                                                                        
Query: 362  gggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgct 421
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 794  gggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgct 735

                                                          
Query: 422  cacctcctcggcggccggcgcaagcgcgtgcactggcgctggagca 467
            |||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 734  cacctcctcggcggccggcgcaggcgcgtgcactggcgctggagca 689



to top

>gb|AF043093.1|AF043093 Hordeum vulgare dehydrin 8 (dhn8) gene, complete cds
          Length = 2254

 Score =  543 bits (274), Expect = e-151
 Identities = 277/278 (99%)
 Strand = Plus / Minus

                                                                        
Query: 190  gatcaatccctccatcttgacacggacttaaacttaaagcaaacacgacacacgccaaca 249
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2246 gatcaatccctccatcttgacacggacttaaacttaaagcaaacacgacacacgccaaca 2187

                                                                        
Query: 250  atttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgt 309
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2186 atttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgt 2127

                                                                        
Query: 310  gctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagct 369
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2126 gctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagct 2067

                                                                        
Query: 370  tgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcct 429
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2066 tgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcct 2007

                                                  
Query: 430  cggcggccggcgcaagcgcgtgcactggcgctggagca 467
            |||||||||||||| |||||||||||||||||||||||
Sbjct: 2006 cggcggccggcgcaggcgcgtgcactggcgctggagca 1969



to top

>gb|U73211.1|TAU73211 Triticum aestivum cold acclimation protein WCOR410c (Wcor410c) mRNA,
            complete cds
          Length = 1242

 Score =  426 bits (215), Expect = e-116
 Identities = 312/339 (92%), Gaps = 4/339 (1%)
 Strand = Plus / Minus

                                                                        
Query: 131  ccaaactgaa-cacaagcatccgtcacctaacgggcttcacagaccggaccttcaaagac 189
            |||||||||| ||||||||||||||||  |||||||||||| ||||| ||||||||||||
Sbjct: 1037 ccaaactgaaacacaagcatccgtcactgaacgggcttcacggaccgaaccttcaaagac 978

                                                                        
Query: 190  gatcaatccctcc-atcttgacacggacttaaacttaaagcaaacacgacacacgccaac 248
            |||||| |||||| | ||||||||  |||||| | |||||||||||| ||||||||||||
Sbjct: 977  gatcaacccctcccaccttgacaccaacttaa-cgtaaagcaaacacaacacacgccaac 919

                                                                        
Query: 249  aatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttg 308
            |||| ||| |||||||||| | |||||||||| ||||||||||||||||| |||||||||
Sbjct: 918  aattcaatcgaggtccggtcacgagtctcggg-cacggcggcgatcaagcgctgggcttg 860

                                                                        
Query: 309  tgctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagc 368
            |||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 859  tgctcgcctgcagcggcggcggccttgtcctcctcccctgtcttgtggtaaccaggcagc 800

                                                                        
Query: 369  ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcc 428
            |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 799  ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtcagggctgctcacctcc 740

                                                   
Query: 429  tcggcggccggcgcaagcgcgtgcactggcgctggagca 467
            |||||||| |||||  ||||||||||||| |||||||||
Sbjct: 739  tcggcggctggcgccggcgcgtgcactggtgctggagca 701



 Score =  123 bits (62), Expect = 5e-25
 Identities = 105/116 (90%), Gaps = 5/116 (4%)
 Strand = Plus / Minus

                                                                        
Query: 5    ggaaatctttaatatcaaggcataatgcccagcaataaaccaatacacaaagtgcccgta 64
            |||||||||||||||||||||||||||||||||||  ||||||||||| ||| ||||   
Sbjct: 1138 ggaaatctttaatatcaaggcataatgcccagcaaataaccaatacac-aagcgccc--- 1083

                                                                    
Query: 65   ataataagcaaataaacttaaacaacatccaggacctgactctggaccaaactgaa 120
            |||||||| ||| |||||| |||||||||||||||||||||||| |||||||||||
Sbjct: 1082 ataataagtaaacaaactt-aacaacatccaggacctgactctgaaccaaactgaa 1028



to top

>gb|U73210.1|TAU73210 Triticum aestivum cold acclimation protein WCOR410b (Wcor410b) mRNA,
            complete cds
          Length = 1181

 Score =  408 bits (206), Expect = e-111
 Identities = 301/330 (91%), Gaps = 2/330 (0%)
 Strand = Plus / Minus

                                                                        
Query: 139  aacacaagcatccgtcacctaacgggcttcacagaccggaccttcaaagacgatcaatcc 198
            |||| ||||| |||||||  |||||||||||| |||||||||||||||||||||||| ||
Sbjct: 1038 aacagaagcacccgtcactcaacgggcttcacggaccggaccttcaaagacgatcaaccc 979

                                                                        
Query: 199  ctcc-atcttgacacggacttaaacttaaagcaaacacgacacacgccaacaatttaatg 257
            |||| | ||||||||  ||||| || |||||||||||| |||||||||||||||| ||| 
Sbjct: 978  ctcccaccttgacaccaacttagacgtaaagcaaacacaacacacgccaacaattcaatc 919

                                                                        
Query: 258  gaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgtgctcgcct 317
            |||||||||| | | |||||||| ||||||||||||||||| ||||||||||||||||||
Sbjct: 918  gaggtccggtcacgggtctcggg-cacggcggcgatcaagcgctgggcttgtgctcgcct 860

                                                                        
Query: 318  gaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagcttgtccatg 377
            | || ||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 859  gtagcggcggcggccttgtcctcctcccctgtcttgtggtaaccaggcagcttgtccatg 800

                                                                        
Query: 378  atcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcctcggcggcc 437
            ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 799  atcttgcccagcaggcccttcttctccttcgcgtcagggctgctcacctcctcggcggcc 740

                                          
Query: 438  ggcgcaagcgcgtgcactggcgctggagca 467
            |||||  |||||||||| || |||||||||
Sbjct: 739  ggcgccggcgcgtgcaccggtgctggagca 710



 Score =  107 bits (54), Expect = 3e-20
 Identities = 54/54 (100%)
 Strand = Plus / Minus

                                                                  
Query: 1    gggcggaaatctttaatatcaaggcataatgcccagcaataaaccaatacacaa 54
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1142 gggcggaaatctttaatatcaaggcataatgcccagcaataaaccaatacacaa 1089



to top

>gb|AF181458.1|AF181458 Hordeum vulgare dehydrin (Dhn8) mRNA, complete cds
          Length = 808

 Score =  406 bits (205), Expect = e-110
 Identities = 211/213 (99%)
 Strand = Plus / Minus

                                                                       
Query: 255 atggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgtgctcg 314
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 808 atggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgtgctcg 749

                                                                       
Query: 315 cctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagcttgtcc 374
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 748 cctgaaggggcggcggccttgtcctcctcctctgtcttgtggtaaccgggcagcttgtcc 689

                                                                       
Query: 375 atgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcctcggcg 434
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 688 atgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcctcggcg 629

                                            
Query: 435 gccggcgcaagcgcgtgcactggcgctggagca 467
           ||||||||| |||||||||||||||||||||||
Sbjct: 628 gccggcgcaggcgcgtgcactggcgctggagca 596



to top

>gb|L29152.1|WHTWCOR Triticum aestivum cold acclimation protein (WCOR410) mRNA, complete
            cds
          Length = 1136

 Score =  402 bits (203), Expect = e-109
 Identities = 308/339 (90%), Gaps = 3/339 (0%)
 Strand = Plus / Minus

                                                                        
Query: 131  ccaaactgaa-cacaagcatccgtcacctaacgggcttcacagaccggaccttcaaagac 189
            |||||||||| || ||||| |||||||  |||||||||||| ||||||||||||||||||
Sbjct: 1038 ccaaactgaaacagaagcacccgtcactgaacgggcttcacggaccggaccttcaaagac 979

                                                                        
Query: 190  gatcaatccctcc-atcttgacacggacttaaacttaaagcaaacacgacacacgccaac 248
            |||||| |||||| | ||||||||  ||||| || |||||||||||| ||||||||||||
Sbjct: 978  gatcaacccctcccaccttgacaccaacttagacgtaaagcaaacacaacacacgccaac 919

                                                                        
Query: 249  aatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttg 308
            |||| ||| |||||||||| | | |||||||| ||||||||||||||||| |||||||||
Sbjct: 918  aattcaatcgaggtccggtcacgggtctcggg-cacggcggcgatcaagcgctgggcttg 860

                                                                        
Query: 309  tgctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagc 368
            |||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 859  tgctcgcctgtagcggcggcggccttgtcctcctcccctgtcttgtggtaaccaggcagc 800

                                                                        
Query: 369  ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcc 428
            |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 799  ttgtccatgatcttgcccagcaggcccttcttctccttcgcgtcagggctgctcacctcc 740

                                                   
Query: 429  tcggcggccggcgcaagcgcgtgcactggcgctggagca 467
            |||| ||||||| |  ||||||||||||| |||||||||
Sbjct: 739  tcgggggccggcaccggcgcgtgcactggtgctggagca 701



 Score =  121 bits (61), Expect = 2e-24
 Identities = 104/116 (89%), Gaps = 8/116 (6%)
 Strand = Plus / Minus

                                                                        
Query: 5    ggaaatctttaatatcaaggcataatgcccagcaataaaccaatacacaaagtgcccgta 64
            |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||   
Sbjct: 1136 ggaaatctttaatatcaaggcataatgcccagcaataaaccaatacac-aagtgccc--- 1081

                                                                    
Query: 65   ataataagcaaataaacttaaacaacatccaggacctgactctggaccaaactgaa 120
               ||||| ||| ||||||  ||||||||||||||||||||||| |||||||||||
Sbjct: 1080 ---ataagtaaacaaactt-gacaacatccaggacctgactctgaaccaaactgaa 1029



to top

>gb|L19419.1|LHPESI Lophopyrum elongatum ES135 mRNA sequence
          Length = 1130

 Score =  377 bits (190), Expect = e-101
 Identities = 287/314 (91%), Gaps = 4/314 (1%)
 Strand = Plus / Minus

                                                                        
Query: 131  ccaaactgaa-cacaagcatccgtcacctaacgggcttcacagaccggaccttcaaagac 189
            |||||||||| ||||| ||||||||||  ||||||||||||||||||||||||||| |||
Sbjct: 1009 ccaaactgaaacacaaacatccgtcactgaacgggcttcacagaccggaccttcaa-gac 951

                                                                        
Query: 190  gatcaatccctcc-atcttgacacggacttaaacttaaagcaaacacgacacacgccaac 248
            |||||| |||||| | ||||||||  ||||| || |||||||||||| ||||||||||||
Sbjct: 950  gatcaacccctcccaccttgacaccaacttagacgtaaagcaaacacaacacacgccaac 891

                                                                        
Query: 249  aatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttg 308
            |||| ||| ||| |||||| | |||||||||| |||||||||||| |||| |||||||||
Sbjct: 890  aattcaatcgagctccggtcacgagtctcggg-cacggcggcgattaagcgctgggcttg 832

                                                                        
Query: 309  tgctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagc 368
            |||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 831  tgctcgcctgcaggggcggcggccttgtcctcctcccctgtcttgtggtaaccaggcagc 772

                                                                        
Query: 369  ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcc 428
            |||||||||||||||||||| | ||||||||||||||||||||| ||||||||||| |||
Sbjct: 771  ttgtccatgatcttgcccagcaagcccttcttctccttcgcgtcagggctgctcacttcc 712

                          
Query: 429  tcggcggccggcgc 442
            ||||||||||||||
Sbjct: 711  tcggcggccggcgc 698



 Score =  137 bits (69), Expect = 4e-29
 Identities = 109/120 (90%), Gaps = 8/120 (6%)
 Strand = Plus / Minus

                                                                        
Query: 1    gggcggaaatctttaatatcaaggcataatgcccagcaataaaccaatacacaaagtgcc 60
            |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 1111 gggcggaaatctttaatatcaaggcataatgcccagcaataaaccaatacac-aagtgcc 1053

                                                                        
Query: 61   cgtaataataagcaaataaacttaaacaacatccaggacctgactctggaccaaactgaa 120
            |      ||||| ||| |||||| |||||||||||||||||||||||| |||||||||||
Sbjct: 1052 c------ataagtaaacaaactt-aacaacatccaggacctgactctgaaccaaactgaa 1000



to top

>emb|AJ890140.1| Triticum turgidum subsp. durum mRNA for dehydrin (dhn11 gene)
          Length = 1127

 Score =  341 bits (172), Expect = 1e-90
 Identities = 303/340 (89%), Gaps = 5/340 (1%)
 Strand = Plus / Minus

                                                                        
Query: 131  ccaaactgaa-cacaagcatccgtcacctaacgggcttcacagaccggaccttcaaagac 189
            |||||||||| ||||||||||||||||  |||||||||||| ||||| ||||||||||||
Sbjct: 1035 ccaaactgaaacacaagcatccgtcactgaacgggcttcacggaccgaaccttcaaagac 976

                                                                        
Query: 190  gatcaatccctcc-atcttgacacggacttaaacttaaagcaaacacgacacacgccaac 248
            |||||| |||||| | ||||||||  |||||| | |||||||||||| ||||||||||||
Sbjct: 975  gatcaacccctcccaccttgacaccaacttaa-cgtaaagcaaacacaacacacgccaac 917

                                                                        
Query: 249  aatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttg 308
            |||| ||| | |||||||| | |||||||||| |||||||||| ||||||  |||| |||
Sbjct: 916  aattcaatcggggtccggtcacgagtctcggg-cacggcggcgttcaagcgttgggattg 858

                                                                        
Query: 309  tgctcgcc-tgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcag 367
            |||||||| || || |||||||| |||||||||||||||||||||||||||||| |||||
Sbjct: 857  tgctcgccctgcagcggcggcggacttgtcctcctcccctgtcttgtggtaaccaggcag 798

                                                                        
Query: 368  cttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctc 427
            ||||||||||||||||||||||||||||||||||||||||| ||| ||| || |||||||
Sbjct: 797  cttgtccatgatcttgcccagtaggcccttcttctccttcgggtcagggatggtcacctc 738

                                                    
Query: 428  ctcggcggccggcgcaagcgcgtgcactggcgctggagca 467
            ||||||||  |||||  ||||||||||||| |||||||||
Sbjct: 737  ctcggcggatggcgccggcgcgtgcactggtgctggagca 698



 Score =  105 bits (53), Expect = 1e-19
 Identities = 96/107 (89%), Gaps = 5/107 (4%)
 Strand = Plus / Minus

                                                                        
Query: 14   taatatcaaggcataatgcccagcaataaaccaatacacaaagtgcccgtaataataagc 73
            ||||||||||||||||||||||||||  ||||||||||| ||| ||||   |||||||| 
Sbjct: 1127 taatatcaaggcataatgcccagcaaataaccaatacac-aagcgccc---ataataagt 1072

                                                           
Query: 74   aaataaacttaaacaacatccaggacctgactctggaccaaactgaa 120
            ||| |||||| |||||||||||||||||||||||| |||||||||||
Sbjct: 1071 aaacaaactt-aacaacatccaggacctgactctgaaccaaactgaa 1026



to top

>gb|AY574032.1| Triticum aestivum dehydrin-like gene, partial sequence
          Length = 391

 Score =  143 bits (72), Expect = 6e-31
 Identities = 94/100 (94%), Gaps = 1/100 (1%)
 Strand = Plus / Minus

                                                                       
Query: 369 ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcc 428
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 390 ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtcagggctgctcacctcc 331

                                                   
Query: 429 tcggcggccggcgcaagcgcgtgc-actggcgctggagca 467
           |||||||| |||||  |||||||| ||||| |||||||||
Sbjct: 330 tcggcggctggcgccggcgcgtgctactggtgctggagca 291



to top

>gb|AY587109.1| Oryza sativa (japonica cultivar-group) dehydration-stress inducible
           protein 1 mRNA, complete cds
          Length = 1315

 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                       
Query: 350 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 409
           |||||||||||||||||| || |||||||||||||||||||  ||||||||||||||| |
Sbjct: 918 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 859

                                
Query: 410 gtccgggctgctcacctcctc 430
            |||||||||||||| |||||
Sbjct: 858 atccgggctgctcacttcctc 838



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 1    gggcggaaatctttaatatcaaggcataatgcccagcaataaaccaataca 51
            |||| |||||| |||||| ||||||| ||||||||||   |||||||||||
Sbjct: 1263 gggcagaaatcattaataccaaggcagaatgcccagcccaaaaccaataca 1213



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 360 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 405
           ||||||||||| ||| |||||||| | || | ||||||||||||||
Sbjct: 734 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 689



to top

>gb|AY786415.1| Oryza sativa (japonica cultivar-group) SK3-type dehydrin 1 (Dhn1)
           mRNA, complete cds
          Length = 1117

 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                       
Query: 350 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 409
           |||||||||||||||||| || |||||||||||||||||||  ||||||||||||||| |
Sbjct: 908 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 849

                                
Query: 410 gtccgggctgctcacctcctc 430
            |||||||||||||| |||||
Sbjct: 848 atccgggctgctcacttcctc 828



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 360 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 405
           ||||||||||| ||| |||||||| | || | ||||||||||||||
Sbjct: 724 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 679



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Plus

                                                                            
Query: 350      cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 409
                |||||||||||||||||| || |||||||||||||||||||  ||||||||||||||| |
Sbjct: 27184369 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 27184428

                                     
Query: 410      gtccgggctgctcacctcctc 430
                 |||||||||||||| |||||
Sbjct: 27184429 atccgggctgctcacttcctc 27184449



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                   
Query: 1        gggcggaaatctttaatatcaaggcataatgcccagcaataaaccaataca 51
                |||| |||||| |||||| ||||||| ||||||||||   |||||||||||
Sbjct: 27184024 gggcagaaatcattaataccaaggcagaatgcccagcccaaaaccaataca 27184074



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                              
Query: 360      ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 405
                ||||||||||| ||| |||||||| | || | ||||||||||||||
Sbjct: 27184553 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 27184598



to top

>dbj|AP004858.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1725_H08
          Length = 155431

 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Plus

                                                                         
Query: 350   cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 409
             |||||||||||||||||| || |||||||||||||||||||  ||||||||||||||| |
Sbjct: 80818 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 80877

                                  
Query: 410   gtccgggctgctcacctcctc 430
              |||||||||||||| |||||
Sbjct: 80878 atccgggctgctcacttcctc 80898



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                           
Query: 360   ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 405
             ||||||||||| ||| |||||||| | || | ||||||||||||||
Sbjct: 81002 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 81047



to top

>dbj|AP005055.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0684A08
          Length = 137841

 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Plus

                                                                         
Query: 350   cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 409
             |||||||||||||||||| || |||||||||||||||||||  ||||||||||||||| |
Sbjct: 35040 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 35099

                                  
Query: 410   gtccgggctgctcacctcctc 430
              |||||||||||||| |||||
Sbjct: 35100 atccgggctgctcacttcctc 35120



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                
Query: 1     gggcggaaatctttaatatcaaggcataatgcccagcaataaaccaataca 51
             |||| |||||| |||||| ||||||| ||||||||||   |||||||||||
Sbjct: 34695 gggcagaaatcattaataccaaggcagaatgcccagcccaaaaccaataca 34745



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                           
Query: 360   ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 405
             ||||||||||| ||| |||||||| | || | ||||||||||||||
Sbjct: 35224 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 35269



to top

>dbj|AK070197.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023042N13, full
           insert sequence
          Length = 1292

 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                       
Query: 350 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 409
           |||||||||||||||||| || |||||||||||||||||||  ||||||||||||||| |
Sbjct: 930 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 871

                                
Query: 410 gtccgggctgctcacctcctc 430
            |||||||||||||| |||||
Sbjct: 870 atccgggctgctcacttcctc 850



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 1    gggcggaaatctttaatatcaaggcataatgcccagcaataaaccaataca 51
            |||| |||||| |||||| ||||||| ||||||||||   |||||||||||
Sbjct: 1275 gggcagaaatcattaataccaaggcagaatgcccagcccaaaaccaataca 1225



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 360 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 405
           ||||||||||| ||| |||||||| | || | ||||||||||||||
Sbjct: 746 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 701



to top

>dbj|AB011367.1| Oryza sativa mRNA for LIP9, partial cds
          Length = 680

 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                       
Query: 350 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 409
           |||||||||||||||||| || |||||||||||||||||||  ||||||||||||||| |
Sbjct: 351 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 292

                                
Query: 410 gtccgggctgctcacctcctc 430
            |||||||||||||| |||||
Sbjct: 291 atccgggctgctcacttcctc 271



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 360 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 405
           ||||||||||| ||| |||||||| | || | ||||||||||||||
Sbjct: 167 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 122



to top

>gb|AY105067.1| Zea mays PCO081051 mRNA sequence
          Length = 1398

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                       
Query: 349 tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcg 408
           |||||||||| ||||| | ||||||||||||||||||||| | |||||||||||||||  
Sbjct: 928 tcttgtggtagccgggtatcttgtccatgatcttgcccagcaagcccttcttctccttgc 869

                           
Query: 409 cgtccgggctgctcac 424
           | ||||||||||||||
Sbjct: 868 catccgggctgctcac 853



to top

>gb|BT019045.1| Zea mays clone Contig566.F mRNA sequence
          Length = 722

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 349 tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttctt 400
           |||||||||| ||||| | ||||||||||||||||||||| | |||||||||
Sbjct: 353 tcttgtggtagccgggtatcttgtccatgatcttgcccagcaagcccttctt 302



to top

>gb|L35913.1|MZELIPASE Zea mays dehydrin (dhn-2) mRNA, complete cds
          Length = 1277

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 349 tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttctt 400
           |||||||||| ||||| | ||||||||||||||||||||| | |||||||||
Sbjct: 864 tcttgtggtagccgggtatcttgtccatgatcttgcccagcaagcccttctt 813



to top

>gb|AY111114.1| Zea mays CL2452_1 mRNA sequence
          Length = 1256

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 349 tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttctt 400
           |||||||||| ||||| | ||||||||||||||||||||| | |||||||||
Sbjct: 843 tcttgtggtagccgggtatcttgtccatgatcttgcccagcaagcccttctt 792



to top

>emb|AJ439990.1|OSA439990 Oryza sativa partial mRNA for putative cold acclimation protein
           (cap-L gene)
          Length = 504

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 350 cttgtggtaaccgggcagcttgtccatgatcttgcccagta 390
           |||||||||||||||||| || | |||||||||||||||||
Sbjct: 123 cttgtggtaaccgggcagtttctncatgatcttgcccagta 83



to top

>emb|AL808127.4| Mouse DNA sequence from clone RP23-263L18 on chromosome 2, complete
              sequence
          Length = 205838

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 100    ctgactctggaccaaactgaagcc 123
              ||||||||||||||||||||||||
Sbjct: 138293 ctgactctggaccaaactgaagcc 138316



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 421      tcacctcctcggcggccggcgc 442
                ||||||||||||||||||||||
Sbjct: 18517274 tcacctcctcggcggccggcgc 18517253



to top

>dbj|AK073885.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033073G16, full
           insert sequence
          Length = 976

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 421 tcacctcctcggcggccggcgc 442
           ||||||||||||||||||||||
Sbjct: 526 tcacctcctcggcggccggcgc 505



to top

>gb|AC102686.7| Mus musculus chromosome 1, clone RP24-467J24, complete sequence
          Length = 156547

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 129    acccaaactgaacacaagcat 149
              |||||||||||||||||||||
Sbjct: 134241 acccaaactgaacacaagcat 134261



to top

>gb|AY349246.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



to top

>gb|AY349245.1| Hordeum vulgare subsp. spontaneum NPGS PI 560556 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



to top

>gb|AY349244.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



to top

>gb|AY349243.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



to top

>gb|AY349242.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



to top

>gb|AY349241.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



to top

>gb|AY349240.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



to top

>gb|AY349239.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



to top

>gb|AY349238.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



to top

>gb|AY349237.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1055

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957



to top

>gb|AY349236.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 446

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 388 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 348



to top

>gb|AY349235.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 446

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 388 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 348



to top

>gb|AY349234.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1055

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957



to top

>gb|AY349233.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



to top

>gb|AY349232.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



to top

>gb|AY349231.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



to top

>gb|AY349230.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1061

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 363  ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
            |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 1003 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 963



to top

>gb|AY349229.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



to top

>gb|AY349228.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1055

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957



to top

>gb|AY349227.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



to top

>gb|AY349226.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 446

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 388 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 348



to top

>gb|AY349225.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 446

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 388 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 348



to top

>gb|AY349224.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



to top

>gb|AY349223.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1055

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957



to top

>gb|AY349222.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



to top

>gb|AY349221.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



to top

>gb|AY349220.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1055

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 363 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957



to top

>emb|AL138725.19| Human DNA sequence from clone RP11-528A10 on chromosome 6 Contains an
             IMPDH1 (IMP (inosine monophosphate) dehydrogenase 1)
             pseudogene, an RNA helicase pseudogene and part of a novel
             gene similar to KIAA0161, complete sequence
          Length = 165653

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 381   ttgcccagtaggcccttcttc 401
             |||||||||||||||||||||
Sbjct: 48697 ttgcccagtaggcccttcttc 48717



to top

>emb|AL772148.6| Zebrafish DNA sequence from clone CH211-153C20 in linkage group 24
              Contains part of a novel gene similar to human DECR2
              (peroxisomal 2,4-dienoyl CoA reductase 2),  a novel gene
              similar to human KIAA0665, a novel gene similar to human
              KIAA0683, a novel gene similar to human KIAA0590, part of a
              novel gene and three CpG islands, complete sequence
          Length = 161218

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 37     caataaaccaatacacaaagt 57
              |||||||||||||||||||||
Sbjct: 156591 caataaaccaatacacaaagt 156571



to top

>gb|DQ015701.1| Ovis aries endothelial nitric oxide synthase mRNA, complete cds
          Length = 4097

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 322  gggcggcggccttgtcctcctcccc 346
            |||||||||||||| ||||||||||
Sbjct: 2195 gggcggcggccttggcctcctcccc 2171



to top

>gb|AF031247.1|AF031247 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-2)
            mRNA, complete cds
          Length = 1518

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 363  ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
            |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 1282 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 1242



to top

>emb|BX322785.6| Zebrafish DNA sequence from clone DKEYP-78B1 in linkage group 24,
             complete sequence
          Length = 176602

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 37    caataaaccaatacacaaagt 57
             |||||||||||||||||||||
Sbjct: 34762 caataaaccaatacacaaagt 34782



to top

>gb|AC147034.2| Mus musculus BAC clone RP23-189C2 from chromosome 7, complete sequence
          Length = 213581

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 25    cataatgcccagcaataaacc 45
             |||||||||||||||||||||
Sbjct: 49844 cataatgcccagcaataaacc 49824



to top

>gb|AF181455.1|AF181455 Hordeum vulgare dehydrin (Dhn5) gene, complete cds
          Length = 3447

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 363  ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
            |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 2313 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 2273



to top

>gb|AY105409.1| Zea mays PCO095801 mRNA sequence
          Length = 741

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 421 tcacctcctcggcggccggcg 441
           |||||||||||||||||||||
Sbjct: 215 tcacctcctcggcggccggcg 235



to top

>gb|AF043096.1|AF043096 Hordeum vulgare dehydrin 5 (dhn5) gene, complete cds
          Length = 2814

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 363  ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
            |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 2311 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 2271



to top

>gb|AF058794.1|AF058794 Triticum aestivum COR39 (cor39) mRNA, complete cds
          Length = 1243

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 363  ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
            |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 1213 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 1173



to top

>gb|M95810.1|BLYDHN5 Hordeum vulgare dehydrin DHN5 (Dhn5) gene, complete cds
          Length = 2432

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 363  ggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
            |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 2306 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 2266



to top

>gb|M99057.1|BOVNIOXSY Bovine nitric oxide synthase mRNA, complete cds
          Length = 4096

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 322  gggcggcggccttgtcctcctcccc 346
            |||||||||||||| ||||||||||
Sbjct: 2196 gggcggcggccttggcctcctcccc 2172



to top

>gb|M89952.1|BOVECNOS Bos taurus endothelial nitric oxide synthase mRNA, complete cds
          Length = 3738

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 322  gggcggcggccttgtcctcctcccc 346
            |||||||||||||| ||||||||||
Sbjct: 2186 gggcggcggccttggcctcctcccc 2162



to top

>gb|AC145325.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0034E03 map near 50283S, complete sequence
          Length = 134074

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                         
Query: 360   ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
             ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 60504 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 60461



to top

>gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, complete sequence
          Length = 574126

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 325   cggcggccttgtcctcctcc 344
             ||||||||||||||||||||
Sbjct: 72754 cggcggccttgtcctcctcc 72735



to top

>gb|AC164098.4| Mus musculus BAC clone RP23-341D24 from chromosome 1, complete sequence
          Length = 221754

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 67     aataagcaaataaacttaaa 86
              ||||||||||||||||||||
Sbjct: 153660 aataagcaaataaacttaaa 153679



to top

>ref|XM_760938.1| Theileria parva strain Muguga chromosome 1 hypothetical protein
            (TP01_0511) partial mRNA
          Length = 5448

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 74   aaataaacttaaacaacatc 93
            ||||||||||||||||||||
Sbjct: 4865 aaataaacttaaacaacatc 4884



to top

>gb|AC144479.1| Pan troglodytes BAC clone RP43-126P12 from 7, complete sequence
          Length = 211515

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 62     gtaataataagcaaataaacttaaacaa 89
              |||||||||||||||| || ||||||||
Sbjct: 140814 gtaataataagcaaattaaattaaacaa 140841



to top

>emb|CR339044.19| Zebrafish DNA sequence from clone CH211-122G23 in linkage group 5,
             complete sequence
          Length = 177385

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 63    taataataagcaaataaacttaaa 86
             |||||||||| |||||||||||||
Sbjct: 63646 taataataagtaaataaacttaaa 63623



to top

>emb|BX927212.11| Zebrafish DNA sequence from clone CH211-262A5 in linkage group 5,
             complete sequence
          Length = 157791

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 63    taataataagcaaataaacttaaa 86
             |||||||||| |||||||||||||
Sbjct: 81135 taataataagtaaataaacttaaa 81112



to top

>gb|AE012230.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 138 of
             460 of the complete genome
          Length = 10813

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 446   cgcgtgcactggcgctggag 465
             ||||||||||||||||||||
Sbjct: 10209 cgcgtgcactggcgctggag 10190



to top

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 446     cgcgtgcactggcgctggag 465
               ||||||||||||||||||||
Sbjct: 3509653 cgcgtgcactggcgctggag 3509672



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                            
Query: 360      ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
                ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 14766556 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 14766599



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 373      ccatgatcttgcccagtagg 392
                ||||||||||||||||||||
Sbjct: 42400771 ccatgatcttgcccagtagg 42400752



to top

>gb|AF031248.1|AF031248 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-3)
           mRNA, complete cds
          Length = 793

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 360 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 473 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 430



to top

>dbj|AP003263.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0483G10
          Length = 190721

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 373   ccatgatcttgcccagtagg 392
             ||||||||||||||||||||
Sbjct: 60109 ccatgatcttgcccagtagg 60090



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 416     gctgctcacctcctcggcgg 435
               ||||||||||||||||||||
Sbjct: 7122494 gctgctcacctcctcggcgg 7122475



to top

>dbj|AB105039.1| Daucus carota CAISE1 mRNA for dehydrin protein, complete cds
          Length = 771

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 359 accgggcagcttgtccatgatctt 382
           |||||||||||||||| |||||||
Sbjct: 506 accgggcagcttgtccttgatctt 483



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 395     cttcttctccttcgcgtccgggct 418
               |||||||||||||||| |||||||
Sbjct: 4529751 cttcttctccttcgcggccgggct 4529728



to top

>dbj|BS000095.1| Pan troglodytes chromosome 22 clone:RP43-177D07, map 22, complete
            sequences
          Length = 181678

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 94   caggacctgactctggaccaaactgaag 121
            |||||| ||||||||||||| |||||||
Sbjct: 3276 caggacttgactctggaccagactgaag 3249



to top

>dbj|BS000094.1| Pan troglodytes chromosome 22 clone:PTB-240N13, map 22, complete
              sequences
          Length = 155513

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 94     caggacctgactctggaccaaactgaag 121
              |||||| ||||||||||||| |||||||
Sbjct: 131204 caggacttgactctggaccagactgaag 131177



to top

>emb|Y00842.1|OSRAB21 Rice rab21 gene for water-stress inducible protein RAB21
          Length = 2537

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 360  ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
            ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 2163 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 2120



to top

>emb|X78429.1|TDDEH16 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd16
          Length = 814

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 360 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 505 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 462



to top

>emb|X15287.1|HVDHN18 Barley mRNA for dehydrin (dhn18)
          Length = 1049

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 360 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 742 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 699



to top

>emb|X15286.1|HVDHN17 Barley mRNA for dehydrin (dhn17)
          Length = 812

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 360 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 535 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 492



to top

>gb|U60097.2|OSU60097 Oryza sativa dehydrin mRNA, complete cds
          Length = 864

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 360 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
           ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 572 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 529



to top

>gb|AF181453.1|AF181453 Hordeum vulgare dehydrin (Dhn3) gene, complete cds
          Length = 1575

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 360  ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
            ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 1350 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 1307



to top

>gb|AC140483.3| Mus musculus BAC clone RP24-145A22 from 1, complete sequence
          Length = 176649

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 67     aataagcaaataaacttaaa 86
              ||||||||||||||||||||
Sbjct: 121495 aataagcaaataaacttaaa 121476



to top

>gb|AF043089.1|AF043089 Hordeum vulgare dehydrin 3 (dhn3) gene, complete cds
          Length = 1560

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 360  ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
            ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 1313 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 1270



to top

>dbj|AP001690.1| Homo sapiens genomic DNA, chromosome 21q, section 34/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 94    caggacctgactctggaccaaactgaag 121
             |||||| ||||||||||||| |||||||
Sbjct: 80688 caggacttgactctggaccagactgaag 80661



to top

>dbj|AP000469.3| Homo sapiens genomic DNA, chromosome 21q, clone:RP11-132H24, complete
              sequence
          Length = 136804

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 94     caggacctgactctggaccaaactgaag 121
              |||||| ||||||||||||| |||||||
Sbjct: 102805 caggacttgactctggaccagactgaag 102778



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                            
Query: 360      ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 403
                ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 14846993 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 14847036


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,951,599
Number of Sequences: 3902068
Number of extensions: 3951599
Number of successful extensions: 85888
Number of sequences better than 10.0: 94
Number of HSP's better than 10.0 without gapping: 94
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 85289
Number of HSP's gapped (non-prelim): 585
length of query: 467
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 445
effective length of database: 17,147,199,772
effective search space: 7630503898540
effective search space used: 7630503898540
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top