Clone Name | rbart11e06 |
---|---|
Clone Library Name | barley_pub |
>emb|AJ310841.1|HVU310841 Hordeum vulgare partial CA2 gene for P-type ATPase Length = 1686 Score = 67.9 bits (34), Expect = 3e-08 Identities = 34/34 (100%) Strand = Plus / Minus Query: 504 tcaggaggacccaacaggaatgagcttgacgacg 537 |||||||||||||||||||||||||||||||||| Sbjct: 1686 tcaggaggacccaacaggaatgagcttgacgacg 1653
>gb|AC115709.11| Mus musculus chromosome 12, clone RP23-76M3, complete sequence Length = 193170 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 85 aatccaacatggttccaacat 105 ||||||||||||||||||||| Sbjct: 121031 aatccaacatggttccaacat 121011
>emb|BX830450.1|CNS0A25Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB82ZD12 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1733 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 384 gctcttctcaggcttgctctc 404 ||||||||||||||||||||| Sbjct: 1402 gctcttctcaggcttgctctc 1422
>gb|CP000029.1| Staphylococcus epidermidis RP62A, complete genome Length = 2616530 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 11 attaccatacattatctcaaa 31 ||||||||||||||||||||| Sbjct: 1653719 attaccatacattatctcaaa 1653739
>emb|CR974583.24| Mouse DNA sequence from clone RP23-118G7 on chromosome 12, complete sequence Length = 219072 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 85 aatccaacatggttccaacat 105 ||||||||||||||||||||| Sbjct: 115812 aatccaacatggttccaacat 115792
>emb|AL080274.21|HS1012F16 Human DNA sequence from clone RP5-1012F16 on chromosome 20 Contains a novel gene, ESTs, STSs and GSSs, complete sequence Length = 74539 Score = 40.1 bits (20), Expect = 7.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 41 gacattcttacaagagttcaagaa 64 ||||||||||||||||||| |||| Sbjct: 25767 gacattcttacaagagttccagaa 25790
>gb|AC156557.8| Mus musculus chromosome 7, clone RP23-321F8, complete sequence Length = 209053 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 140 tgcactccattcctggaagg 159 |||||||||||||||||||| Sbjct: 113931 tgcactccattcctggaagg 113912
>dbj|AB011482.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUA2 Length = 83478 Score = 40.1 bits (20), Expect = 7.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 218 gatccgcaaaatatacatcttttc 241 ||||||||||||||| |||||||| Sbjct: 36461 gatccgcaaaatataaatcttttc 36438
>gb|AF163823.1|AF163823 Arabidopsis thaliana endoxyloglucan transferase (XTR3) gene, complete cds Length = 2703 Score = 40.1 bits (20), Expect = 7.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 218 gatccgcaaaatatacatcttttc 241 ||||||||||||||| |||||||| Sbjct: 1982 gatccgcaaaatataaatcttttc 2005
>emb|AL391261.3|CNS06C85 Human chromosome 14 DNA sequence BAC C-2014B16 of library CalTech-D from chromosome 14 of Homo sapiens (Human), complete sequence Length = 162144 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 493 tgcccttttcatcaggagga 512 |||||||||||||||||||| Sbjct: 69463 tgcccttttcatcaggagga 69444 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,513,040 Number of Sequences: 3902068 Number of extensions: 4513040 Number of successful extensions: 76068 Number of sequences better than 10.0: 10 Number of HSP's better than 10.0 without gapping: 10 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 76038 Number of HSP's gapped (non-prelim): 30 length of query: 537 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 514 effective length of database: 17,143,297,704 effective search space: 8811655019856 effective search space used: 8811655019856 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)