Clone Name	rbart11c04
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AY543536.1| Triticum aestivum expansin EXPB1 mRNA, complete cds	375	e-101
2	gb|AY589579.1| Triticum aestivum beta-expansin TaEXPB2 mRNA, com...	373	e-100
3	gb|AY543538.1| Triticum aestivum expansin EXPB3 mRNA, complete cds	341	1e-90
4	emb|AJ295942.1|FPR295942 Festuca pratensis mRNA for beta expansi...	224	2e-55
5	gb|AY589580.1| Triticum aestivum beta-expansin TaEXPB3 mRNA, com...	214	2e-52
6	gb|AY543541.1| Triticum aestivum expansin EXPB7 mRNA, complete cds	214	2e-52
7	gb|AY543537.1| Triticum aestivum expansin EXPB2 mRNA, complete cds	194	2e-46
8	gb|AF332180.1|AF332180 Zea mays beta-expansin 7 (expB7) mRNA, co...	188	1e-44
9	ref|NM_197701.1| Oryza sativa (japonica cultivar-group) beta-exp...	178	1e-41
10	gb|AF261272.1| Oryza sativa beta-expansin (EXPB4) mRNA, complete...	178	1e-41
11	gb|AC069300.7| Oryza sativa chromosome 10 BAC OSJNBa0010C11 geno...	178	1e-41
12	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	178	1e-41
13	dbj|AK105981.1| Oryza sativa (japonica cultivar-group) cDNA clon...	178	1e-41
14	dbj|AK103929.1| Oryza sativa (japonica cultivar-group) cDNA clon...	178	1e-41
15	dbj|AK101806.1| Oryza sativa (japonica cultivar-group) cDNA clon...	178	1e-41
16	dbj|AK101357.1| Oryza sativa (japonica cultivar-group) cDNA clon...	178	1e-41
17	dbj|AK060096.1| Oryza sativa (japonica cultivar-group) cDNA clon...	178	1e-41
18	gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome...	178	1e-41
19	gb|BT017478.1| Zea mays clone EL01N0408G02.c mRNA sequence	165	2e-37
20	gb|AF332181.1|AF332181 Zea mays beta-expansin 8 (expB8) mRNA, co...	165	2e-37
21	gb|BT019137.1| Zea mays clone Contig781.F mRNA sequence	157	4e-35
22	emb|AJ295941.1|FPR295941 Festuca pratensis mRNA for beta expansi...	151	2e-33
23	ref|NM_197700.1| Oryza sativa (japonica cultivar-group) beta-exp...	149	9e-33
24	gb|AF261271.1| Oryza sativa beta-expansin (EXPB3) mRNA, complete...	149	9e-33
25	gb|AC037426.12| Oryza sativa chromosome 10 BAC OSJNBb0014I11 gen...	149	9e-33
26	dbj|AK105318.1| Oryza sativa (japonica cultivar-group) cDNA clon...	149	9e-33
27	dbj|AK100959.1| Oryza sativa (japonica cultivar-group) cDNA clon...	149	9e-33
28	ref|NM_197698.1| Oryza sativa (japonica cultivar-group) beta-exp...	147	4e-32
29	gb|AF261274.1| Oryza sativa beta-expansin (EXPB6) mRNA, complete...	147	4e-32
30	gb|AF332178.1|AF332178 Zea mays beta-expansin 5 (expB5) mRNA, pa...	147	4e-32
31	gb|AF332175.1|AF332175 Zea mays beta-expansin 2 (expB2) mRNA, pa...	147	4e-32
32	dbj|AK105799.1| Oryza sativa (japonica cultivar-group) cDNA clon...	147	4e-32
33	dbj|AK104197.1| Oryza sativa (japonica cultivar-group) cDNA clon...	147	4e-32
34	dbj|AK101728.1| Oryza sativa (japonica cultivar-group) cDNA clon...	147	4e-32
35	dbj|AK061498.1| Oryza sativa (japonica cultivar-group) cDNA clon...	147	4e-32
36	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	129	9e-27
37	gb|AC118673.2| Genomic sequence for Oryza sativa, Nipponbare str...	129	9e-27
38	gb|AC125411.1| Genomic sequence for Oryza sativa, Nipponbare str...	129	9e-27
39	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	129	9e-27
40	gb|AF485811.1| Oryza sativa BAC OSJNa0049F05, complete sequence	129	9e-27
41	dbj|AK061423.1| Oryza sativa (japonica cultivar-group) cDNA clon...	129	9e-27
42	gb|AY111405.1| Zea mays CL5426_1 mRNA sequence	127	3e-26
43	gb|AF261275.1| Oryza sativa beta-expansin (EXPB7) mRNA, complete...	125	1e-25
44	dbj|AK064012.1| Oryza sativa (japonica cultivar-group) cDNA clon...	125	1e-25
45	dbj|AK070972.1| Oryza sativa (japonica cultivar-group) cDNA clon...	109	8e-21
46	gb|AF261276.2| Oryza sativa beta-expansin (EXPB8) mRNA, partial cds	101	2e-18
47	gb|AF332176.1|AF332176 Zea mays beta-expansin 3 (expB3) mRNA, pa...	94	5e-16
48	gb|AF332179.1|AF332179 Zea mays beta-expansin 6 (expB6) mRNA, co...	92	2e-15
49	gb|AY104151.1| Zea mays PCO112411 mRNA sequence	92	2e-15
50	gb|AY543542.1| Triticum aestivum expansin EXPB8 mRNA, complete cds	92	2e-15
51	gb|AY589578.1| Triticum aestivum beta-expansin TaEXPB1 mRNA, com...	80	7e-12
52	gb|AY589581.1| Triticum aestivum beta-expansin TaEXPB4 mRNA, com...	76	1e-10
53	emb|AJ890019.1| Triticum aestivum mRNA for expansin EXPB11 prote...	70	7e-09
54	gb|AY112069.1| Zea mays CL35761_1 mRNA sequence	70	7e-09
55	gb|DQ428284.1| Sorghum propinquum locus PRC0324 genomic sequence	66	1e-07
56	gb|DQ428283.1| Sorghum bicolor voucher PI585454 locus PRC0324 ge...	66	1e-07
57	gb|DQ428282.1| Sorghum bicolor voucher PI267539 locus PRC0324 ge...	66	1e-07
58	gb|DQ428281.1| Sorghum bicolor voucher PI267408 locus PRC0324 ge...	66	1e-07
59	gb|DQ428280.1| Sorghum bicolor voucher PI221607 locus PRC0324 ge...	66	1e-07
60	gb|DQ428279.1| Sorghum bicolor voucher PI152702 locus PRC0324 ge...	66	1e-07
61	gb|DQ428278.1| Sorghum bicolor voucher NSL92371 locus PRC0324 ge...	66	1e-07
62	gb|DQ428277.1| Sorghum bicolor voucher NSL87902 locus PRC0324 ge...	66	1e-07
63	gb|DQ428276.1| Sorghum bicolor voucher NSL87666 locus PRC0324 ge...	66	1e-07
64	gb|DQ428275.1| Sorghum bicolor voucher NSL77217 locus PRC0324 ge...	66	1e-07
65	gb|DQ428274.1| Sorghum bicolor voucher NSL77034 locus PRC0324 ge...	66	1e-07
66	gb|DQ428273.1| Sorghum bicolor voucher NSL56174 locus PRC0324 ge...	66	1e-07
67	gb|DQ428272.1| Sorghum bicolor voucher NSL56003 locus PRC0324 ge...	66	1e-07
68	gb|DQ428271.1| Sorghum bicolor voucher NSL55243 locus PRC0324 ge...	66	1e-07
69	gb|DQ428270.1| Sorghum bicolor voucher NSL51365 locus PRC0324 ge...	66	1e-07
70	gb|DQ428269.1| Sorghum bicolor voucher NSL51030 locus PRC0324 ge...	66	1e-07
71	gb|DQ428268.1| Sorghum bicolor voucher NSL50875 locus PRC0324 ge...	66	1e-07
72	gb|DQ428267.1| Sorghum bicolor voucher BTx623 locus PRC0324 geno...	66	1e-07
73	gb|AY692478.1| Triticum aestivum beta-expansin EXPB6 mRNA, parti...	66	1e-07
74	ref|NM_197699.1| Oryza sativa (japonica cultivar-group) beta-exp...	60	7e-06
75	dbj|AK104128.1| Oryza sativa (japonica cultivar-group) cDNA clon...	60	7e-06
76	dbj|AK061068.1| Oryza sativa (japonica cultivar-group) cDNA clon...	60	7e-06
77	dbj|AK058895.1| Oryza sativa (japonica cultivar-group) cDNA clon...	60	7e-06
78	gb|AY589582.1| Triticum aestivum beta-expansin TaEXPB5 mRNA, com...	58	3e-05
79	gb|AY543544.1| Triticum aestivum expansin EXPB10 mRNA, complete cds	58	3e-05
80	gb|U95968.1|OSU95968 Oryza sativa beta-expansin (EXPB2) mRNA, co...	56	1e-04
81	gb|U91981.1|TAU91981 Triticum aestivum pollen allergen homolog m...	54	4e-04
82	gb|AF220610.1| Oryza sativa pollen allergen mRNA, complete cds	52	0.002
83	ref|NM_197637.1| Oryza sativa (japonica cultivar-group) beta-exp...	52	0.002
84	gb|AF261277.1| Oryza sativa beta-expansin (EXPB9) mRNA, complete...	52	0.002
85	gb|AY533104.1| Triticum aestivum beta-expansin 2 (EXPB2) gene, c...	52	0.002
86	gb|AY533102.1| Triticum aestivum beta-expansin 2 (EXPB2) mRNA, c...	52	0.002
87	gb|AC020666.8| Oryza sativa chromosome 10 BAC OSJNBa0082M15 geno...	52	0.002
88	dbj|AK099112.1| Oryza sativa (japonica cultivar-group) cDNA clon...	52	0.002
89	dbj|AK070187.1| Oryza sativa (japonica cultivar-group) cDNA clon...	52	0.002
90	gb|AY533103.1| Triticum aestivum beta-expansin 1 (EXPB1) gene, c...	50	0.007
91	gb|AY533101.1| Triticum aestivum beta-expansin 1 (EXPB1) mRNA, c...	50	0.007
92	gb|AY533100.1| Triticum aestivum beta-expansin 1 (EXPB1) mRNA, p...	50	0.007
93	gb|AY197353.1| Zea mays clone pJR9 beta-expansin 1 protein (EXPB...	50	0.007
94	gb|AF332174.1|AF332174 Zea mays beta-expansin 1 (expB1) mRNA, co...	50	0.007
95	gb|AY103636.1| Zea mays PCO124530 mRNA sequence	50	0.007
96	emb|BX294387.11| Zebrafish DNA sequence from clone DKEY-267L16 i...	44	0.40
97	dbj|AB041625.1| Brassica rapa BcSL10 gene for SLG-like 10, parti...	44	0.40
98	gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome	42	1.6
99	gb|DQ481669.1| Takifugu rubripes HoxDb gene cluster, complete se...	42	1.6
100	emb|AJ295940.1|FPR295940 Festuca pratensis mRNA for beta expansi...	42	1.6
101	gb|AY197352.1| Zea mays clone pJR11 beta-expansin 9 protein (EXP...	42	1.6
102	emb|BX842575.1| Mycobacterium tuberculosis H37Rv complete genome...	42	1.6
103	emb|BX248337.1| Mycobacterium bovis subsp. bovis AF2122/97 compl...	42	1.6
104	gb|AC016766.6| Homo sapiens BAC clone RP11-558I6 from 2, complet...	42	1.6
105	gb|AY543540.1| Triticum aestivum expansin EXPB5 mRNA, complete cds	42	1.6
106	gb|L14271.1|MZEPOLPI Zea mays Zea mI gene, complete cds	42	1.6
107	gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome	40	6.3
108	gb|AY172516.1| Rhizobium etli transcription repair coupling fact...	40	6.3
109	gb|CP000133.1| Rhizobium etli CFN 42, complete genome	40	6.3
110	gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome	40	6.3
111	gb|AC157813.6| Mus musculus chromosome 1, clone RP24-70I14, comp...	40	6.3
112	gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome	40	6.3
113	emb|BX649380.7| Zebrafish DNA sequence from clone CH211-87P6 in ...	40	6.3
114	gb|AC107766.14| Mus musculus chromosome 1, clone RP23-166L24, co...	40	6.3
115	gb|AF107020.1|AF107020 Actinomyces naeslundii strain LY7 type-1 ...	40	6.3
116	gb|AF107019.1|AF107019 Actinomyces naeslundii strain P-1-K type-...	40	6.3
117	gb|AF106035.1|AF106035 Actinomyces naeslundii strain B-1-K type-...	40	6.3
118	gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge...	40	6.3
119	gb|M32067.1|ACYFIMBA A.viscosus fimbrial structural protein type...	40	6.3

---

>gb|AY543536.1| Triticum aestivum expansin EXPB1 mRNA, complete cds
          Length = 810

 Score =  375 bits (189), Expect = e-101
 Identities = 195/197 (98%)
 Strand = Plus / Minus

                                                                       
Query: 269 cagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccggg 328
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 810 cagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccggg 751

                                                                       
Query: 329 atgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggc 388
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 750 atgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggc 691

                                                                       
Query: 389 gcctggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggc 448
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 690 gcctggaggcggtggccggagtccagccgccagatggatccccacgactcgcgcatcggc 631

                            
Query: 449 gtccacgtaccggagtt 465
           |||||||| ||||||||
Sbjct: 630 gtccacgtcccggagtt 614

---

>gb|AY589579.1| Triticum aestivum beta-expansin TaEXPB2 mRNA, complete cds
          Length = 897

 Score =  373 bits (188), Expect = e-100
 Identities = 240/257 (93%), Gaps = 9/257 (3%)
 Strand = Plus / Minus

                                                                       
Query: 216 gataccaaatctagccaatgtatgcatatgattccaaatgatga-------tgagttcag 268
           ||||||||||| |||||||| ||||||  |||||||||||||||       | |||||||
Sbjct: 895 gataccaaatcaagccaatgcatgcat--gattccaaatgatgagttcggttcagttcag 838

                                                                       
Query: 269 cagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccggg 328
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 837 cagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccggg 778

                                                                       
Query: 329 atgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggc 388
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 777 atgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggc 718

                                                                       
Query: 389 gcctggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggc 448
           ||||||||||||||||||||||| ||||||||||| || ||||| |||||||||||||||
Sbjct: 717 gcctggaggcggtggccggagtcgagccgccagatggagccccatgactcgcgcatcggc 658

                            
Query: 449 gtccacgtaccggagtt 465
           |||||||| ||||||||
Sbjct: 657 gtccacgtcccggagtt 641

---

>gb|AY543538.1| Triticum aestivum expansin EXPB3 mRNA, complete cds
          Length = 834

 Score =  341 bits (172), Expect = 1e-90
 Identities = 196/204 (96%)
 Strand = Plus / Minus

                                                                       
Query: 262 agttcagcagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagtt 321
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 823 agttcagcagcttcagctgtactggacgatggaacggtagaaggtgctgggcgcccagtt 764

                                                                       
Query: 322 ggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatgga 381
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 763 ggccgggatgaccttgtcggccaccagcgacttgccggactcgttggtgatgcgcatgga 704

                                                                       
Query: 382 gaagggcgcctggaggcggtggccggagtccagccgccagattgatccccacgactcgcg 441
           |||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||||||
Sbjct: 703 gaagggcgcctggaggcggtggccagagtcgagccgccagatggagccccatgactcgcg 644

                                   
Query: 442 catcggcgtccacgtaccggagtt 465
           ||||||||||||||| ||||||||
Sbjct: 643 catcggcgtccacgtcccggagtt 620

---

>emb|AJ295942.1|FPR295942 Festuca pratensis mRNA for beta expansin B3 (expB3 gene)
          Length = 1219

 Score =  224 bits (113), Expect = 2e-55
 Identities = 167/185 (90%)
 Strand = Plus / Minus

                                                                       
Query: 269 cagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccggg 328
           |||| ||||||| |||||||||||||||||||| ||| |||||| ||||| |||||||||
Sbjct: 911 cagcctcagctgaactggacgatggagcggtaggaggcgctgggggcccaattggccggg 852

                                                                       
Query: 329 atgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggc 388
           |||| ||||||||| || |||  |||||||||||||||||||||||||||||||||||||
Sbjct: 851 atgatcttgtcggcgacgagctgcttgccggactcgttggtgatgcgcatggagaagggc 792

                                                                       
Query: 389 gcctggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggc 448
           |||||||||||||||  ||||||||  |||||||| |||||||||||||| | |||||||
Sbjct: 791 gcctggaggcggtggttggagtccatgcgccagatggatccccacgactccctcatcggc 732

                
Query: 449 gtcca 453
           |||||
Sbjct: 731 gtcca 727



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 43/48 (89%), Gaps = 4/48 (8%)
 Strand = Plus / Minus

                                                            
Query: 109  tattcaagacacacatgca----cgacgacgcctacatgacacccgac 152
            |||| ||||||||||||||    |||||||||||||||||||||||||
Sbjct: 1072 tattgaagacacacatgcaggatcgacgacgcctacatgacacccgac 1025



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 5    acacacaaacagtaataacttatgat 30
            |||||||||| |||||||||||||||
Sbjct: 1186 acacacaaactgtaataacttatgat 1161

---

>gb|AY589580.1| Triticum aestivum beta-expansin TaEXPB3 mRNA, complete cds
          Length = 1013

 Score =  214 bits (108), Expect = 2e-52
 Identities = 171/192 (89%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgac 333
           ||||||| ||||||||| ||||||||||  |||| |||||  ||||||||||||||||||
Sbjct: 859 tcagctgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgac 800

                                                                       
Query: 334 cttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctg 393
            |||| |||||||||| |||||||||| ||| ||||||||||||||||||||||| ||||
Sbjct: 799 attgttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaagggcccctg 740

                                                                       
Query: 394 gaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtcca 453
           ||||||||||  |||||||| ||||||||| || ||||| ||||||||||||||||||||
Sbjct: 739 gaggcggtggttggagtccatccgccagatggagccccaggactcgcgcatcggcgtcca 680

                       
Query: 454 cgtaccggagtt 465
           ||  ||||||||
Sbjct: 679 cgacccggagtt 668

---

>gb|AY543541.1| Triticum aestivum expansin EXPB7 mRNA, complete cds
          Length = 1056

 Score =  214 bits (108), Expect = 2e-52
 Identities = 171/192 (89%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgac 333
           ||||||| ||||||||| ||||||||||  |||| |||||  ||||||||||||||||||
Sbjct: 891 tcagctgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgac 832

                                                                       
Query: 334 cttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctg 393
            |||| |||||||||| |||||||||| ||| ||||||||||||||||||||||| ||||
Sbjct: 831 attgttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaagggcccctg 772

                                                                       
Query: 394 gaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtcca 453
           ||||||||||  |||||||| ||||||||| || ||||| ||||||||||||||||||||
Sbjct: 771 gaggcggtggttggagtccatccgccagatggagccccaggactcgcgcatcggcgtcca 712

                       
Query: 454 cgtaccggagtt 465
           ||  ||||||||
Sbjct: 711 cgacccggagtt 700

---

>gb|AY543537.1| Triticum aestivum expansin EXPB2 mRNA, complete cds
          Length = 948

 Score =  194 bits (98), Expect = 2e-46
 Identities = 149/166 (89%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
           |||||||||||||||||| |||||||||||||||| |||||  |||||||||||||||||
Sbjct: 882 ttcagctgtactggacgaaggagcggtagaaggtgttgggcctccagttggccgggatga 823

                                                                       
Query: 333 ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           |||||| ||| || |||||||||||||||||||||  |||||| ||||||||||||||||
Sbjct: 822 ccttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggcgcct 763

                                                         
Query: 393 ggaggcggtggccggagtccagccgccagattgatccccacgactc 438
           |||||||||||  |||||| || |||||||  || |||||||||||
Sbjct: 762 ggaggcggtggttggagtcgaggcgccagacggagccccacgactc 717

---

>gb|AF332180.1|AF332180 Zea mays beta-expansin 7 (expB7) mRNA, complete cds
          Length = 1173

 Score =  188 bits (95), Expect = 1e-44
 Identities = 155/175 (88%)
 Strand = Plus / Minus

                                                                       
Query: 281 tactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcg 340
           ||||||||||| || |||||| ||||| ||||| |||||||||| |||||||| | ||| 
Sbjct: 867 tactggacgatagaacggtagtaggtgttgggcacccagttggcggggatgacatggtca 808

                                                                       
Query: 341 gccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcgg 400
           |||||||||||||||||||||||||| || ||||||| |||||| |||||   |||||||
Sbjct: 807 gccaccagcgtcttgccggactcgttcgtaatgcgcagggagaatggcgcggtgaggcgg 748

                                                                  
Query: 401 tggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccacg 455
           ||||||||||| |||| |||||| |||||||| ||||||||||||||||||||||
Sbjct: 747 tggccggagtcgagcctccagatggatccccaggactcgcgcatcggcgtccacg 693

---

>ref|NM_197701.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB4
           (OSJNBa0010C11.2), mRNA
          Length = 1340

 Score =  178 bits (90), Expect = 1e-41
 Identities = 159/182 (87%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
           |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 969 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 910

                                                                       
Query: 333 ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 909 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 850

                                                                       
Query: 393 ggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtcc 452
           |||| | ||||  || |||||||| |||||| || ||||||||||| | |||||||||||
Sbjct: 849 ggagcctgtggttggtgtccagcctccagatggagccccacgactccctcatcggcgtcc 790

             
Query: 453 ac 454
           ||
Sbjct: 789 ac 788

---

>gb|AF261272.1| Oryza sativa beta-expansin (EXPB4) mRNA, complete cds
          Length = 1249

 Score =  178 bits (90), Expect = 1e-41
 Identities = 159/182 (87%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
           |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 925 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 866

                                                                       
Query: 333 ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 865 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 806

                                                                       
Query: 393 ggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtcc 452
           |||| | ||||  || |||||||| |||||| || ||||||||||| | |||||||||||
Sbjct: 805 ggagcctgtggttggtgtccagcctccagatggagccccacgactccctcatcggcgtcc 746

             
Query: 453 ac 454
           ||
Sbjct: 745 ac 744

---

>gb|AC069300.7| Oryza sativa chromosome 10 BAC OSJNBa0010C11 genomic sequence, complete
             sequence
          Length = 147117

 Score =  178 bits (90), Expect = 1e-41
 Identities = 159/182 (87%)
 Strand = Plus / Minus

                                                                         
Query: 273   ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
             |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 16771 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 16712

                                                                         
Query: 333   ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
             | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 16711 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 16652

                                                                         
Query: 393   ggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtcc 452
             |||| | ||||  || |||||||| |||||| || ||||||||||| | |||||||||||
Sbjct: 16651 ggagcctgtggttggtgtccagcctccagatggagccccacgactccctcatcggcgtcc 16592

               
Query: 453   ac 454
             ||
Sbjct: 16591 ac 16590



 Score =  149 bits (75), Expect = 9e-33
 Identities = 153/179 (85%)
 Strand = Plus / Plus

                                                                        
Query: 277  gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 336
            ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 4068 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 4127

                                                                        
Query: 337  gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 396
            |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 4128 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 4187

                                                                       
Query: 397  gcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccacg 455
            |||||||  |||||| |||| |||||| || ||||||||||||||||||||||||||||
Sbjct: 4188 gcggtggttggagtcgagcctccagatggagccccacgactcgcgcatcggcgtccacg 4246

---

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  178 bits (90), Expect = 1e-41
 Identities = 159/182 (87%)
 Strand = Plus / Minus

                                                                            
Query: 273      ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
                |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 21341758 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 21341699

                                                                            
Query: 333      ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
                | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 21341698 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 21341639

                                                                            
Query: 393      ggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtcc 452
                |||| | ||||  || |||||||| |||||| || ||||||||||| | |||||||||||
Sbjct: 21341638 ggagcctgtggttggtgtccagcctccagatggagccccacgactccctcatcggcgtcc 21341579

                  
Query: 453      ac 454
                ||
Sbjct: 21341578 ac 21341577



 Score =  149 bits (75), Expect = 9e-33
 Identities = 153/179 (85%)
 Strand = Plus / Plus

                                                                            
Query: 277      gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 336
                ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 21329054 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 21329113

                                                                            
Query: 337      gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 396
                |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 21329114 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 21329173

                                                                           
Query: 397      gcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccacg 455
                |||||||  |||||| |||| |||||| || ||||||||||||||||||||||||||||
Sbjct: 21329174 gcggtggttggagtcgagcctccagatggagccccacgactcgcgcatcggcgtccacg 21329232



 Score =  147 bits (74), Expect = 4e-32
 Identities = 152/178 (85%)
 Strand = Plus / Plus

                                                                            
Query: 276      agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
                ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 21311303 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 21311362

                                                                            
Query: 336      tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
                ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 21311363 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 21311422

                                                                          
Query: 396      ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtcca 453
                ||||||||  |||||| || |||||||| || ||||||||||| | ||||||||||||
Sbjct: 21311423 ggcggtggttggagtcgaggcgccagatggagccccacgactccctcatcggcgtcca 21311480



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 111/138 (80%)
 Strand = Plus / Plus

                                                                            
Query: 316      ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 375
                |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 21317205 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 21317264

                                                                            
Query: 376      catggagaagggcgcctggaggcggtggccggagtccagccgccagattgatccccacga 435
                 | |||||||||  ||||||||||||||  || ||| || |||||||| |||||||| ||
Sbjct: 21317265 gagggagaaggggccctggaggcggtggttggcgtcgaggcgccagatggatccccagga 21317324

                                  
Query: 436      ctcgcgcatcggcgtcca 453
                   |||||| ||||||||
Sbjct: 21317325 gcggcgcatgggcgtcca 21317342



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                          
Query: 351      tcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
                |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 20947292 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 20947251

---

>dbj|AK105981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-F12, full
           insert sequence
          Length = 1290

 Score =  178 bits (90), Expect = 1e-41
 Identities = 159/182 (87%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
           |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 982 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 923

                                                                       
Query: 333 ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 922 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 863

                                                                       
Query: 393 ggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtcc 452
           |||| | ||||  || |||||||| |||||| || ||||||||||| | |||||||||||
Sbjct: 862 ggagcctgtggttggtgtccagcctccagatggagccccacgactccctcatcggcgtcc 803

             
Query: 453 ac 454
           ||
Sbjct: 802 ac 801

---

>dbj|AK103929.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D11, full
           insert sequence
          Length = 1266

 Score =  178 bits (90), Expect = 1e-41
 Identities = 159/182 (87%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
           |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 975 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 916

                                                                       
Query: 333 ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 915 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 856

                                                                       
Query: 393 ggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtcc 452
           |||| | ||||  || |||||||| |||||| || ||||||||||| | |||||||||||
Sbjct: 855 ggagcctgtggttggtgtccagcctccagatggagccccacgactccctcatcggcgtcc 796

             
Query: 453 ac 454
           ||
Sbjct: 795 ac 794

---

>dbj|AK101806.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033066K12, full
            insert sequence
          Length = 1883

 Score =  178 bits (90), Expect = 1e-41
 Identities = 159/182 (87%)
 Strand = Plus / Minus

                                                                        
Query: 273  ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
            |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 1559 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 1500

                                                                        
Query: 333  ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
            | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 1499 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 1440

                                                                        
Query: 393  ggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtcc 452
            |||| | ||||  || |||||||| |||||| || ||||||||||| | |||||||||||
Sbjct: 1439 ggagcctgtggttggtgtccagcctccagatggagccccacgactccctcatcggcgtcc 1380

              
Query: 453  ac 454
            ||
Sbjct: 1379 ac 1378

---

>dbj|AK101357.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033035B15, full
            insert sequence
          Length = 1475

 Score =  178 bits (90), Expect = 1e-41
 Identities = 159/182 (87%)
 Strand = Plus / Minus

                                                                        
Query: 273  ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
            |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 1163 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 1104

                                                                        
Query: 333  ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
            | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 1103 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 1044

                                                                        
Query: 393  ggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtcc 452
            |||| | ||||  || |||||||| |||||| || ||||||||||| | |||||||||||
Sbjct: 1043 ggagcctgtggttggtgtccagcctccagatggagccccacgactccctcatcggcgtcc 984

              
Query: 453  ac 454
            ||
Sbjct: 983  ac 982

---

>dbj|AK060096.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-G02, full
           insert sequence
          Length = 1293

 Score =  178 bits (90), Expect = 1e-41
 Identities = 159/182 (87%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
           |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 981 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 922

                                                                       
Query: 333 ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 921 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 862

                                                                       
Query: 393 ggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtcc 452
           |||| | ||||  || |||||||| |||||| || ||||||||||| | |||||||||||
Sbjct: 861 ggagcctgtggttggtgtccagcctccagatggagccccacgactccctcatcggcgtcc 802

             
Query: 453 ac 454
           ||
Sbjct: 801 ac 800

---

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  178 bits (90), Expect = 1e-41
 Identities = 159/182 (87%)
 Strand = Plus / Minus

                                                                            
Query: 273      ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
                |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 21353021 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 21352962

                                                                            
Query: 333      ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
                | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 21352961 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 21352902

                                                                            
Query: 393      ggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtcc 452
                |||| | ||||  || |||||||| |||||| || ||||||||||| | |||||||||||
Sbjct: 21352901 ggagcctgtggttggtgtccagcctccagatggagccccacgactccctcatcggcgtcc 21352842

                  
Query: 453      ac 454
                ||
Sbjct: 21352841 ac 21352840



 Score =  149 bits (75), Expect = 9e-33
 Identities = 153/179 (85%)
 Strand = Plus / Plus

                                                                            
Query: 277      gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 336
                ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 21340318 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 21340377

                                                                            
Query: 337      gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 396
                |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 21340378 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 21340437

                                                                           
Query: 397      gcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccacg 455
                |||||||  |||||| |||| |||||| || ||||||||||||||||||||||||||||
Sbjct: 21340438 gcggtggttggagtcgagcctccagatggagccccacgactcgcgcatcggcgtccacg 21340496



 Score =  147 bits (74), Expect = 4e-32
 Identities = 152/178 (85%)
 Strand = Plus / Plus

                                                                            
Query: 276      agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
                ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 21322567 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 21322626

                                                                            
Query: 336      tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
                ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 21322627 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 21322686

                                                                          
Query: 396      ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtcca 453
                ||||||||  |||||| || |||||||| || ||||||||||| | ||||||||||||
Sbjct: 21322687 ggcggtggttggagtcgaggcgccagatggagccccacgactccctcatcggcgtcca 21322744



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 111/138 (80%)
 Strand = Plus / Plus

                                                                            
Query: 316      ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 375
                |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 21328469 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 21328528

                                                                            
Query: 376      catggagaagggcgcctggaggcggtggccggagtccagccgccagattgatccccacga 435
                 | |||||||||  ||||||||||||||  || ||| || |||||||| |||||||| ||
Sbjct: 21328529 gagggagaaggggccctggaggcggtggttggcgtcgaggcgccagatggatccccagga 21328588

                                  
Query: 436      ctcgcgcatcggcgtcca 453
                   |||||| ||||||||
Sbjct: 21328589 gcggcgcatgggcgtcca 21328606



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                          
Query: 351      tcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
                |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 20958556 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 20958515

---

>gb|BT017478.1| Zea mays clone EL01N0408G02.c mRNA sequence
          Length = 832

 Score =  165 bits (83), Expect = 2e-37
 Identities = 155/179 (86%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
           ||||||||||||||| |||||||||||||||| ||||   |||||||||||||||||| |
Sbjct: 303 agctgtactggacgaaggagcggtagaaggtgttggggcgccagttggccgggatgacgt 244

                                                                       
Query: 336 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
           ||| ||| || |||||||||||||||||||||  |||||| ||||||||||||| ||| |
Sbjct: 243 tgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggcggctgca 184

                                                                      
Query: 396 ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccac 454
            |||||||  || |||||  |||||||  || ||||| |||||||||||||||||||||
Sbjct: 183 tgcggtggttggtgtccatgcgccagacggagccccaggactcgcgcatcggcgtccac 125

---

>gb|AF332181.1|AF332181 Zea mays beta-expansin 8 (expB8) mRNA, complete cds
          Length = 1479

 Score =  165 bits (83), Expect = 2e-37
 Identities = 155/179 (86%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
           ||||||||||||||| |||||||||||||||| ||||   |||||||||||||||||| |
Sbjct: 939 agctgtactggacgaaggagcggtagaaggtgttggggcgccagttggccgggatgacgt 880

                                                                       
Query: 336 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
           ||| ||| || |||||||||||||||||||||  |||||| ||||||||||||| ||| |
Sbjct: 879 tgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggcggctgca 820

                                                                      
Query: 396 ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccac 454
            |||||||  || |||||  |||||||  || ||||| |||||||||||||||||||||
Sbjct: 819 tgcggtggttggtgtccatgcgccagacggagccccaggactcgcgcatcggcgtccac 761

---

>gb|BT019137.1| Zea mays clone Contig781.F mRNA sequence
          Length = 1044

 Score =  157 bits (79), Expect = 4e-35
 Identities = 154/179 (86%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
           ||||||||||||||| |||||||||||||||| ||||   |||||||||||||||||| |
Sbjct: 564 agctgtactggacgaaggagcggtagaaggtgttggggcgccagttggccgggatgacgt 505

                                                                       
Query: 336 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
           ||| ||| || ||||||||| |||||||||||  |||||| ||||||||||||| ||| |
Sbjct: 504 tgttggcgacgagcgtcttggcggactcgttgcggatgcggatggagaagggcggctgca 445

                                                                      
Query: 396 ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccac 454
            |||||||  || |||||  |||||||  || ||||| |||||||||||||||||||||
Sbjct: 444 tgcggtggttggtgtccatgcgccagacggagccccaggactcgcgcatcggcgtccac 386

---

>emb|AJ295941.1|FPR295941 Festuca pratensis mRNA for beta expansin B2 (expB2 gene)
          Length = 1194

 Score =  151 bits (76), Expect = 2e-33
 Identities = 145/168 (86%)
 Strand = Plus / Minus

                                                                       
Query: 282 actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
           ||||||||| ||||||||||  |||| |||||  |||||||||||||||||  |||| ||
Sbjct: 884 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgatgttgttgg 825

                                                                       
Query: 342 ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggt 401
           | || |||  ||||||||| ||| ||||||||||||||||||| ||||||||||| ||||
Sbjct: 824 cgacgagctgcttgccggagtcgctggtgatgcgcatggagaatggcgcctggagacggt 765

                                                           
Query: 402 ggccggagtccagccgccagattgatccccacgactcgcgcatcggcg 449
           ||  |||||||| || |||||| ||||||||||||||| |||||||||
Sbjct: 764 ggttggagtccatcctccagatggatccccacgactcgtgcatcggcg 717

---

>ref|NM_197700.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB3
           (OSJNBb0014I11.1), mRNA
          Length = 904

 Score =  149 bits (75), Expect = 9e-33
 Identities = 153/179 (85%)
 Strand = Plus / Minus

                                                                       
Query: 277 gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 336
           ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 898 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 839

                                                                       
Query: 337 gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 396
           |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 838 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 779

                                                                      
Query: 397 gcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccacg 455
           |||||||  |||||| |||| |||||| || ||||||||||||||||||||||||||||
Sbjct: 778 gcggtggttggagtcgagcctccagatggagccccacgactcgcgcatcggcgtccacg 720

---

>gb|AF261271.1| Oryza sativa beta-expansin (EXPB3) mRNA, complete cds
          Length = 1319

 Score =  149 bits (75), Expect = 9e-33
 Identities = 153/179 (85%)
 Strand = Plus / Minus

                                                                       
Query: 277 gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 336
           ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 897 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 838

                                                                       
Query: 337 gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 396
           |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 837 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 778

                                                                      
Query: 397 gcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccacg 455
           |||||||  |||||| |||| |||||| || ||||||||||||||||||||||||||||
Sbjct: 777 gcggtggttggagtcgagcctccagatggagccccacgactcgcgcatcggcgtccacg 719

---

>gb|AC037426.12| Oryza sativa chromosome 10 BAC OSJNBb0014I11 genomic sequence,
            complete sequence
          Length = 135510

 Score =  149 bits (75), Expect = 9e-33
 Identities = 153/179 (85%)
 Strand = Plus / Minus

                                                                        
Query: 277  gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 336
            ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 5305 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 5246

                                                                        
Query: 337  gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 396
            |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 5245 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 5186

                                                                       
Query: 397  gcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccacg 455
            |||||||  |||||| |||| |||||| || ||||||||||||||||||||||||||||
Sbjct: 5185 gcggtggttggagtcgagcctccagatggagccccacgactcgcgcatcggcgtccacg 5127



 Score =  147 bits (74), Expect = 4e-32
 Identities = 152/178 (85%)
 Strand = Plus / Minus

                                                                         
Query: 276   agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
             ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 23056 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 22997

                                                                         
Query: 336   tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
             ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 22996 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 22937

                                                                       
Query: 396   ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtcca 453
             ||||||||  |||||| || |||||||| || ||||||||||| | ||||||||||||
Sbjct: 22936 ggcggtggttggagtcgaggcgccagatggagccccacgactccctcatcggcgtcca 22879



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 111/138 (80%)
 Strand = Plus / Minus

                                                                         
Query: 316   ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 375
             |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 17154 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 17095

                                                                         
Query: 376   catggagaagggcgcctggaggcggtggccggagtccagccgccagattgatccccacga 435
              | |||||||||  ||||||||||||||  || ||| || |||||||| |||||||| ||
Sbjct: 17094 gagggagaaggggccctggaggcggtggttggcgtcgaggcgccagatggatccccagga 17035

                               
Query: 436   ctcgcgcatcggcgtcca 453
                |||||| ||||||||
Sbjct: 17034 gcggcgcatgggcgtcca 17017

---

>dbj|AK105318.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-117-F11, full
           insert sequence
          Length = 1031

 Score =  149 bits (75), Expect = 9e-33
 Identities = 153/179 (85%)
 Strand = Plus / Minus

                                                                       
Query: 277 gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 336
           ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 653 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 594

                                                                       
Query: 337 gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 396
           |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 593 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 534

                                                                      
Query: 397 gcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccacg 455
           |||||||  |||||| |||| |||||| || ||||||||||||||||||||||||||||
Sbjct: 533 gcggtggttggagtcgagcctccagatggagccccacgactcgcgcatcggcgtccacg 475

---

>dbj|AK100959.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023140O05, full
           insert sequence
          Length = 1313

 Score =  149 bits (75), Expect = 9e-33
 Identities = 153/179 (85%)
 Strand = Plus / Minus

                                                                       
Query: 277 gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 336
           ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 909 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 850

                                                                       
Query: 337 gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 396
           |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 849 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 790

                                                                      
Query: 397 gcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccacg 455
           |||||||  |||||| |||| |||||| || ||||||||||||||||||||||||||||
Sbjct: 789 gcggtggttggagtcgagcctccagatggagccccacgactcgcgcatcggcgtccacg 731

---

>ref|NM_197698.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB6
           (OSJNBb0014I11.3), mRNA
          Length = 1240

 Score =  147 bits (74), Expect = 4e-32
 Identities = 152/178 (85%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 922 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 863

                                                                       
Query: 336 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
           ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 862 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 803

                                                                     
Query: 396 ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtcca 453
           ||||||||  |||||| || |||||||| || ||||||||||| | ||||||||||||
Sbjct: 802 ggcggtggttggagtcgaggcgccagatggagccccacgactccctcatcggcgtcca 745

---

>gb|AF261274.1| Oryza sativa beta-expansin (EXPB6) mRNA, complete cds
          Length = 1250

 Score =  147 bits (74), Expect = 4e-32
 Identities = 152/178 (85%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 915 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 856

                                                                       
Query: 336 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
           ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 855 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 796

                                                                     
Query: 396 ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtcca 453
           ||||||||  |||||| || |||||||| || ||||||||||| | ||||||||||||
Sbjct: 795 ggcggtggttggagtcgaggcgccagatggagccccacgactccctcatcggcgtcca 738

---

>gb|AF332178.1|AF332178 Zea mays beta-expansin 5 (expB5) mRNA, partial cds
          Length = 650

 Score =  147 bits (74), Expect = 4e-32
 Identities = 149/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 339
           |||||| | ||||||||||||| ||||| |||||||||||||||| |||||||||     
Sbjct: 529 gtactgaatgatggagcggtagtaggtgttgggcgcccagttggcagggatgacccgagt 470

                                                                       
Query: 340 ggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcg 399
           |||||||||| || |||||||||||||||||| |||||  |||||||||||||| || | 
Sbjct: 469 ggccaccagcttcctgccggactcgttggtgacgcgcagcgagaagggcgcctgtagcct 410

                                                                 
Query: 400 gtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtcca 453
           ||||  || |||||||| |||||| || ||||| ||||||||||||||||||||
Sbjct: 409 gtggttggcgtccagcctccagatggacccccaggactcgcgcatcggcgtcca 356

---

>gb|AF332175.1|AF332175 Zea mays beta-expansin 2 (expB2) mRNA, partial cds
          Length = 907

 Score =  147 bits (74), Expect = 4e-32
 Identities = 149/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
           ||||||||||||||| |||||||||||||||| |||||  |||||||||||||||||| |
Sbjct: 526 agctgtactggacgaaggagcggtagaaggtgttgggcctccagttggccgggatgacgt 467

                                                                       
Query: 336 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
           |   ||| || |||||||||||||||||||||  |||||| ||||||||||||| ||| |
Sbjct: 466 tcctggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggcggctgca 407

                                                                 
Query: 396 ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcg 449
            |||||||  || |||||  |||||||  || ||||| ||||||||||||||||
Sbjct: 406 tgcggtggttggtgtccatgcgccagacggagccccaggactcgcgcatcggcg 353

---

>dbj|AK105799.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-A09, full
           insert sequence
          Length = 1257

 Score =  147 bits (74), Expect = 4e-32
 Identities = 152/178 (85%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 935 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 876

                                                                       
Query: 336 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
           ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 875 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 816

                                                                     
Query: 396 ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtcca 453
           ||||||||  |||||| || |||||||| || ||||||||||| | ||||||||||||
Sbjct: 815 ggcggtggttggagtcgaggcgccagatggagccccacgactccctcatcggcgtcca 758

---

>dbj|AK104197.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-304-A02, full
           insert sequence
          Length = 1257

 Score =  147 bits (74), Expect = 4e-32
 Identities = 152/178 (85%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 935 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 876

                                                                       
Query: 336 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
           ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 875 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 816

                                                                     
Query: 396 ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtcca 453
           ||||||||  |||||| || |||||||| || ||||||||||| | ||||||||||||
Sbjct: 815 ggcggtggttggagtcgaggcgccagatggagccccacgactccctcatcggcgtcca 758

---

>dbj|AK101728.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033061F13, full
           insert sequence
          Length = 1263

 Score =  147 bits (74), Expect = 4e-32
 Identities = 152/178 (85%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 941 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 882

                                                                       
Query: 336 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
           ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 881 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 822

                                                                     
Query: 396 ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtcca 453
           ||||||||  |||||| || |||||||| || ||||||||||| | ||||||||||||
Sbjct: 821 ggcggtggttggagtcgaggcgccagatggagccccacgactccctcatcggcgtcca 764

---

>dbj|AK061498.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-D06, full
           insert sequence
          Length = 1259

 Score =  147 bits (74), Expect = 4e-32
 Identities = 152/178 (85%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 935 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 876

                                                                       
Query: 336 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
           ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 875 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 816

                                                                     
Query: 396 ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtcca 453
           ||||||||  |||||| || |||||||| || ||||||||||| | ||||||||||||
Sbjct: 815 ggcggtggttggagtcgaggcgccagatggagccccacgactccctcatcggcgtcca 758

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  129 bits (65), Expect = 9e-27
 Identities = 146/173 (84%)
 Strand = Plus / Minus

                                                                          
Query: 282    actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
              ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 169422 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 169363

                                                                          
Query: 342    ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggt 401
              | |  || |||||||||||||||||||||||||| | |||||||||| |||| ||  |||
Sbjct: 169362 cgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgggt 169303

                                                                   
Query: 402    ggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccac 454
              ||  || |||||||| ||| || |||||||||||||| | |||||||||||||
Sbjct: 169302 ggttggtgtccagcctccatatcgatccccacgactccctcatcggcgtccac 169250



 Score =  109 bits (55), Expect = 8e-21
 Identities = 145/175 (82%)
 Strand = Plus / Plus

                                                                          
Query: 280    gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 339
              ||||||||||| ||| |||||||||||| |||||| |||||||   |||||||| | |  
Sbjct: 157666 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 157725

                                                                          
Query: 340    ggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcg 399
               ||||||| |||||||||||| ||| |   |||||| |||||||| |||||| | |||||
Sbjct: 157726 tgccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcg 157785

                                                                     
Query: 400    gtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccac 454
              ||||  ||||||||||| ||| |  || ||||||||||| |||||||||||||||
Sbjct: 157786 gtggttggagtccagcctccacaccgacccccacgactcccgcatcggcgtccac 157840

---

>gb|AC118673.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone
            OSJNBb0080O10, from chromosome 3, complete sequence
          Length = 127917

 Score =  129 bits (65), Expect = 9e-27
 Identities = 146/173 (84%)
 Strand = Plus / Minus

                                                                        
Query: 282  actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
            ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 6489 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 6430

                                                                        
Query: 342  ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggt 401
            | |  || |||||||||||||||||||||||||| | |||||||||| |||| ||  |||
Sbjct: 6429 cgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgggt 6370

                                                                 
Query: 402  ggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccac 454
            ||  || |||||||| ||| || |||||||||||||| | |||||||||||||
Sbjct: 6369 ggttggtgtccagcctccatatcgatccccacgactccctcatcggcgtccac 6317

---

>gb|AC125411.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNAb0079B22, from chromosome 3, complete sequence
          Length = 156933

 Score =  129 bits (65), Expect = 9e-27
 Identities = 146/173 (84%)
 Strand = Plus / Minus

                                                                          
Query: 282    actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
              ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 103422 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 103363

                                                                          
Query: 342    ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggt 401
              | |  || |||||||||||||||||||||||||| | |||||||||| |||| ||  |||
Sbjct: 103362 cgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgggt 103303

                                                                   
Query: 402    ggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccac 454
              ||  || |||||||| ||| || |||||||||||||| | |||||||||||||
Sbjct: 103302 ggttggtgtccagcctccatatcgatccccacgactccctcatcggcgtccac 103250



 Score =  109 bits (55), Expect = 8e-21
 Identities = 145/175 (82%)
 Strand = Plus / Plus

                                                                         
Query: 280   gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 339
             ||||||||||| ||| |||||||||||| |||||| |||||||   |||||||| | |  
Sbjct: 91666 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 91725

                                                                         
Query: 340   ggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcg 399
              ||||||| |||||||||||| ||| |   |||||| |||||||| |||||| | |||||
Sbjct: 91726 tgccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcg 91785

                                                                    
Query: 400   gtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccac 454
             ||||  ||||||||||| ||| |  || ||||||||||| |||||||||||||||
Sbjct: 91786 gtggttggagtccagcctccacaccgacccccacgactcccgcatcggcgtccac 91840

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3,
              complete sequence
          Length = 36192742

 Score =  129 bits (65), Expect = 9e-27
 Identities = 146/173 (84%)
 Strand = Plus / Minus

                                                                          
Query: 282    actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
              ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 169422 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 169363

                                                                          
Query: 342    ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggt 401
              | |  || |||||||||||||||||||||||||| | |||||||||| |||| ||  |||
Sbjct: 169362 cgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgggt 169303

                                                                   
Query: 402    ggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccac 454
              ||  || |||||||| ||| || |||||||||||||| | |||||||||||||
Sbjct: 169302 ggttggtgtccagcctccatatcgatccccacgactccctcatcggcgtccac 169250



 Score =  109 bits (55), Expect = 8e-21
 Identities = 145/175 (82%)
 Strand = Plus / Plus

                                                                          
Query: 280    gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 339
              ||||||||||| ||| |||||||||||| |||||| |||||||   |||||||| | |  
Sbjct: 157666 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 157725

                                                                          
Query: 340    ggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcg 399
               ||||||| |||||||||||| ||| |   |||||| |||||||| |||||| | |||||
Sbjct: 157726 tgccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcg 157785

                                                                     
Query: 400    gtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccac 454
              ||||  ||||||||||| ||| |  || ||||||||||| |||||||||||||||
Sbjct: 157786 gtggttggagtccagcctccacaccgacccccacgactcccgcatcggcgtccac 157840

---

>gb|AF485811.1| Oryza sativa BAC OSJNa0049F05, complete sequence
          Length = 162241

 Score =  129 bits (65), Expect = 9e-27
 Identities = 146/173 (84%)
 Strand = Plus / Plus

                                                                         
Query: 282   actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
             ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 93244 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 93303

                                                                         
Query: 342   ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggt 401
             | |  || |||||||||||||||||||||||||| | |||||||||| |||| ||  |||
Sbjct: 93304 cgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgggt 93363

                                                                  
Query: 402   ggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccac 454
             ||  || |||||||| ||| || |||||||||||||| | |||||||||||||
Sbjct: 93364 ggttggtgtccagcctccatatcgatccccacgactccctcatcggcgtccac 93416



 Score =  109 bits (55), Expect = 8e-21
 Identities = 145/175 (82%)
 Strand = Plus / Minus

                                                                          
Query: 280    gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 339
              ||||||||||| ||| |||||||||||| |||||| |||||||   |||||||| | |  
Sbjct: 105000 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 104941

                                                                          
Query: 340    ggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcg 399
               ||||||| |||||||||||| ||| |   |||||| |||||||| |||||| | |||||
Sbjct: 104940 tgccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcg 104881

                                                                     
Query: 400    gtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccac 454
              ||||  ||||||||||| ||| |  || ||||||||||| |||||||||||||||
Sbjct: 104880 gtggttggagtccagcctccacaccgacccccacgactcccgcatcggcgtccac 104826

---

>dbj|AK061423.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-G02, full
           insert sequence
          Length = 1027

 Score =  129 bits (65), Expect = 9e-27
 Identities = 146/173 (84%)
 Strand = Plus / Minus

                                                                       
Query: 282 actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
           ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 834 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 775

                                                                       
Query: 342 ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggt 401
           | |  || |||||||||||||||||||||||||| | |||||||||| |||| ||  |||
Sbjct: 774 cgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgggt 715

                                                                
Query: 402 ggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccac 454
           ||  || |||||||| ||| || |||||||||||||| | |||||||||||||
Sbjct: 714 ggttggtgtccagcctccatatcgatccccacgactccctcatcggcgtccac 662

---

>gb|AY111405.1| Zea mays CL5426_1 mRNA sequence
          Length = 528

 Score =  127 bits (64), Expect = 3e-26
 Identities = 88/96 (91%)
 Strand = Plus / Plus

                                                                       
Query: 280 gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 339
           |||||||| |||||| |||||| ||||| ||||  ||||||||||||||||||||| || 
Sbjct: 263 gtactggatgatggaacggtagtaggtgttgggaacccagttggccgggatgacctggtt 322

                                               
Query: 340 ggccaccagcgtcttgccggactcgttggtgatgcg 375
           ||||||||||||||||||||||||||||||||||||
Sbjct: 323 ggccaccagcgtcttgccggactcgttggtgatgcg 358



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                    
Query: 409 gtccagccgccagattgatccccacgactcgcgcatcggcgtccacgtaccggagtt 465
           ||||||||||||||| ||     ||||||||||||||||||||||||  ||||||||
Sbjct: 392 gtccagccgccagatggannnnnacgactcgcgcatcggcgtccacgacccggagtt 448

---

>gb|AF261275.1| Oryza sativa beta-expansin (EXPB7) mRNA, complete cds
          Length = 1210

 Score =  125 bits (63), Expect = 1e-25
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                        
Query: 282  actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
            ||||||||||||||| ||| | |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 1026 actggacgatggagctgtaracggtgttgggctgccagtcggcggggatgacctgatcgg 967

                                                                        
Query: 342  ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggt 401
            | |  || |||||||||||||||||||||||||| | |||||||||| |||| ||  |||
Sbjct: 966  cgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgggt 907

                                                                 
Query: 402  ggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccac 454
            ||  || |||||||| ||| || |||||||||||||| | |||||||||||||
Sbjct: 906  ggttggtgtccagcctccatatcgatccccacgactccctcatcggcgtccac 854

---

>dbj|AK064012.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-124-H01, full
           insert sequence
          Length = 1794

 Score =  125 bits (63), Expect = 1e-25
 Identities = 120/139 (86%)
 Strand = Plus / Minus

                                                                       
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 375
           ||||| |||||||||||| |||| ||| || |||||||||||||||||||||  ||||||
Sbjct: 938 ccagtaggccgggatgacgttgttggcgacgagcgtcttgccggactcgttgcggatgcg 879

                                                                       
Query: 376 catggagaagggcgcctggaggcggtggccggagtccagccgccagattgatccccacga 435
            ||||||||||| |||||||| | ||||  || |||||||| |||||| || ||||||||
Sbjct: 878 gatggagaagggggcctggagcctgtggttggtgtccagcctccagatggagccccacga 819

                              
Query: 436 ctcgcgcatcggcgtccac 454
           ||| | |||||||||||||
Sbjct: 818 ctccctcatcggcgtccac 800

---

>dbj|AK070972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023069H18, full
           insert sequence
          Length = 1019

 Score =  109 bits (55), Expect = 8e-21
 Identities = 145/175 (82%)
 Strand = Plus / Minus

                                                                       
Query: 280 gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 339
           ||||||||||| ||| |||||||||||| |||||| |||||||   |||||||| | |  
Sbjct: 889 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 830

                                                                       
Query: 340 ggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcg 399
            ||||||| |||||||||||| ||| |   |||||| |||||||| |||||| | |||||
Sbjct: 829 tgccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcg 770

                                                                  
Query: 400 gtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccac 454
           ||||  ||||||||||| ||| |  || ||||||||||| |||||||||||||||
Sbjct: 769 gtggttggagtccagcctccacaccgacccccacgactcccgcatcggcgtccac 715

---

>gb|AF261276.2| Oryza sativa beta-expansin (EXPB8) mRNA, partial cds
          Length = 933

 Score =  101 bits (51), Expect = 2e-18
 Identities = 144/175 (82%)
 Strand = Plus / Minus

                                                                       
Query: 280 gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 339
           ||||||||||| ||| ||||| |||||| |||||| |||||||   |||||||| | |  
Sbjct: 807 gtactggacgaaggaacggtaaaaggtgttgggcgtccagttgagggggatgacgtcggg 748

                                                                       
Query: 340 ggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcg 399
            ||||||| |||||||||||| ||| |   |||||| |||||||| |||||| | |||||
Sbjct: 747 tgccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcg 688

                                                                  
Query: 400 gtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtccac 454
           ||||  ||||||||||| ||| |  || ||||||||||| |||||||||||||||
Sbjct: 687 gtggttggagtccagcctccacaccgacccccacgactcccgcatcggcgtccac 633

---

>gb|AF332176.1|AF332176 Zea mays beta-expansin 3 (expB3) mRNA, partial cds
          Length = 788

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 92/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 282 actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
           ||||||||||||||| ||||| | ||  ||||  |||||  ||||| ||||||| ||| |
Sbjct: 644 actggacgatggagctgtagacgttgtcgggctgccagtctgccggaatgacctggtccg 585

                                                          
Query: 342 ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggc 388
           |||||||||||||||||||||||||||||| |||||  |||||||||
Sbjct: 584 ccaccagcgtcttgccggactcgttggtgacgcgcagcgagaagggc 538

---

>gb|AF332179.1|AF332179 Zea mays beta-expansin 6 (expB6) mRNA, complete cds
          Length = 1142

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                       
Query: 318 agttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgca 377
           |||||||||||||||| || | ||||||||||  | ||||||||||||||||||||||||
Sbjct: 873 agttggccgggatgacgttcttggccaccagctgcctgccggactcgttggtgatgcgca 814

                     
Query: 378 tggagaaggg 387
           ||||||||||
Sbjct: 813 tggagaaggg 804

---

>gb|AY104151.1| Zea mays PCO112411 mRNA sequence
          Length = 1171

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                       
Query: 318 agttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgca 377
           |||||||||||||||| || | ||||||||||  | ||||||||||||||||||||||||
Sbjct: 882 agttggccgggatgacgttcttggccaccagctgcctgccggactcgttggtgatgcgca 823

                     
Query: 378 tggagaaggg 387
           ||||||||||
Sbjct: 822 tggagaaggg 813

---

>gb|AY543542.1| Triticum aestivum expansin EXPB8 mRNA, complete cds
          Length = 1078

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 94/110 (85%)
 Strand = Plus / Minus

                                                                       
Query: 323 gccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggag 382
           ||||||||||| |||| |||||| |||||||| ||||| ||| ||||||| |||||||||
Sbjct: 794 gccgggatgacattgttggccacaagcgtcttcccggagtcgctggtgatacgcatggag 735

                                                             
Query: 383 aagggcgcctggaggcggtggccggagtccagccgccagattgatcccca 432
           |||||| |||| ||  || ||| || ||||| ||||||||| ||||||||
Sbjct: 734 aagggcccctgcagcgggcggctggtgtccatccgccagatggatcccca 685

---

>gb|AY589578.1| Triticum aestivum beta-expansin TaEXPB1 mRNA, complete cds
          Length = 1034

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 109/132 (82%)
 Strand = Plus / Minus

                                                                       
Query: 322 ggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatgga 381
           |||||||||||||| |||||| || |||| | |||||||||||| ||||| |||||  ||
Sbjct: 904 ggccgggatgacctggtcggcgacgagcgacctgccggactcgtcggtgacgcgcagcga 845

                                                                       
Query: 382 gaagggcgcctggaggcggtggccggagtccagccgccagattgatccccacgactcgcg 441
           ||||||| |||| ||  || ||     |||||| |||||||| |||||||||||||| | 
Sbjct: 844 gaagggcccctgcagcgggcggagcctgtccaggcgccagatggatccccacgactccct 785

                       
Query: 442 catcggcgtcca 453
           ||||||||||||
Sbjct: 784 catcggcgtcca 773

---

>gb|AY589581.1| Triticum aestivum beta-expansin TaEXPB4 mRNA, complete cds
          Length = 898

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 113/138 (81%)
 Strand = Plus / Minus

                                                                       
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 375
           |||||||||||||||||| |  | ||||||||||||||||||||| ||| ||  ||||||
Sbjct: 810 ccagttggccgggatgacttgtttggccaccagcgtcttgccggattcgctgcggatgcg 751

                                                                       
Query: 376 catggagaagggcgcctggaggcggtggccggagtccagccgccagattgatccccacga 435
            |  ||||||||  |||| || ||| | | |||||||| ||||||||| |  ||||||||
Sbjct: 750 gagagagaaggggccctgcagccggcgcctggagtccatccgccagatggcgccccacga 691

                             
Query: 436 ctcgcgcatcggcgtcca 453
            | |||||||| ||||||
Sbjct: 690 gtggcgcatcgccgtcca 673

---

>emb|AJ890019.1| Triticum aestivum mRNA for expansin EXPB11 protein precursor
           (expb11 gene), cultivar Wyuna, from endosperm tissue
          Length = 1032

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                       
Query: 326 gggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaag 385
           ||||||||||  ||||| || || ||||||||||||||||||||||||||||  ||||| 
Sbjct: 773 gggatgacctgttcggcgacaagtgtcttgccggactcgttggtgatgcgcaacgagaat 714

                  
Query: 386 ggcgcct 392
           |||||||
Sbjct: 713 ggcgcct 707

---

>gb|AY112069.1| Zea mays CL35761_1 mRNA sequence
          Length = 631

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 347 agcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggtggccg 406
           |||||||||||||| ||| ||  | |||| ||||||||||| | ||| |||||||||  |
Sbjct: 167 agcgtcttgccggagtcggtgcgggtgcggatggagaagggtggctgcaggcggtggttg 226

                                                          
Query: 407 gagtccagccgccagattgatccccacgactcgcgcatcggcgtcca 453
           ||||| || |||||||| |||||||| |||| || ||| ||||||||
Sbjct: 227 gagtcgaggcgccagatggatccccatgactggctcatgggcgtcca 273

---

>gb|DQ428284.1| Sorghum propinquum locus PRC0324 genomic sequence
          Length = 477

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 428 ccccacgactcgcgcatcggcgtccac 454
           ||||||||| |||||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtccac 136

---

>gb|DQ428283.1| Sorghum bicolor voucher PI585454 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 428 ccccacgactcgcgcatcggcgtccac 454
           ||||||||| |||||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtccac 136

---

>gb|DQ428282.1| Sorghum bicolor voucher PI267539 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 428 ccccacgactcgcgcatcggcgtccac 454
           ||||||||| |||||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtccac 136

---

>gb|DQ428281.1| Sorghum bicolor voucher PI267408 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 428 ccccacgactcgcgcatcggcgtccac 454
           ||||||||| |||||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtccac 136

---

>gb|DQ428280.1| Sorghum bicolor voucher PI221607 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 428 ccccacgactcgcgcatcggcgtccac 454
           ||||||||| |||||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtccac 136

---

>gb|DQ428279.1| Sorghum bicolor voucher PI152702 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 428 ccccacgactcgcgcatcggcgtccac 454
           ||||||||| |||||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtccac 136

---

>gb|DQ428278.1| Sorghum bicolor voucher NSL92371 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 428 ccccacgactcgcgcatcggcgtccac 454
           ||||||||| |||||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtccac 136

---

>gb|DQ428277.1| Sorghum bicolor voucher NSL87902 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 428 ccccacgactcgcgcatcggcgtccac 454
           ||||||||| |||||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtccac 136

---

>gb|DQ428276.1| Sorghum bicolor voucher NSL87666 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 428 ccccacgactcgcgcatcggcgtccac 454
           ||||||||| |||||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtccac 136

---

>gb|DQ428275.1| Sorghum bicolor voucher NSL77217 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 428 ccccacgactcgcgcatcggcgtccac 454
           ||||||||| |||||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtccac 136

---

>gb|DQ428274.1| Sorghum bicolor voucher NSL77034 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 428 ccccacgactcgcgcatcggcgtccac 454
           ||||||||| |||||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtccac 136

---

>gb|DQ428273.1| Sorghum bicolor voucher NSL56174 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 428 ccccacgactcgcgcatcggcgtccac 454
           ||||||||| |||||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtccac 136

---

>gb|DQ428272.1| Sorghum bicolor voucher NSL56003 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 428 ccccacgactcgcgcatcggcgtccac 454
           ||||||||| |||||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtccac 136

---

>gb|DQ428271.1| Sorghum bicolor voucher NSL55243 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 428 ccccacgactcgcgcatcggcgtccac 454
           ||||||||| |||||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtccac 136

---

>gb|DQ428270.1| Sorghum bicolor voucher NSL51365 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 428 ccccacgactcgcgcatcggcgtccac 454
           ||||||||| |||||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtccac 136

---

>gb|DQ428269.1| Sorghum bicolor voucher NSL51030 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 428 ccccacgactcgcgcatcggcgtccac 454
           ||||||||| |||||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtccac 136

---

>gb|DQ428268.1| Sorghum bicolor voucher NSL50875 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 428 ccccacgactcgcgcatcggcgtccac 454
           ||||||||| |||||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtccac 136

---

>gb|DQ428267.1| Sorghum bicolor voucher BTx623 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 428 ccccacgactcgcgcatcggcgtccac 454
           ||||||||| |||||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtccac 136

---

>gb|AY692478.1| Triticum aestivum beta-expansin EXPB6 mRNA, partial cds
          Length = 671

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 315 cccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgc 374
           |||||| ||| ||||||||||  |||||  | ||||||||||||||||||||||| ||||
Sbjct: 327 cccagtcggcggggatgacctgttcggcggcgagcgtcttgccggactcgttggtkatgc 268

                        
Query: 375 gcatggagaaggg 387
            ||  ||||||||
Sbjct: 267 scagcgagaaggg 255

---

>ref|NM_197699.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB2
           (OSJNBb0014I11.2), mRNA
          Length = 1262

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 111/138 (80%)
 Strand = Plus / Minus

                                                                       
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 375
           |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 813 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 754

                                                                       
Query: 376 catggagaagggcgcctggaggcggtggccggagtccagccgccagattgatccccacga 435
            | |||||||||  ||||||||||||||  || ||| || |||||||| |||||||| ||
Sbjct: 753 gagggagaaggggccctggaggcggtggttggcgtcgaggcgccagatggatccccagga 694

                             
Query: 436 ctcgcgcatcggcgtcca 453
              |||||| ||||||||
Sbjct: 693 gcggcgcatgggcgtcca 676

---

>dbj|AK104128.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-F04, full
           insert sequence
          Length = 1043

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 111/138 (80%)
 Strand = Plus / Minus

                                                                       
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 375
           |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 812 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 753

                                                                       
Query: 376 catggagaagggcgcctggaggcggtggccggagtccagccgccagattgatccccacga 435
            | |||||||||  ||||||||||||||  || ||| || |||||||| |||||||| ||
Sbjct: 752 gagggagaaggggccctggaggcggtggttggcgtcgaggcgccagatggatccccagga 693

                             
Query: 436 ctcgcgcatcggcgtcca 453
              |||||| ||||||||
Sbjct: 692 gcggcgcatgggcgtcca 675

---

>dbj|AK061068.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-206-C01, full
           insert sequence
          Length = 1259

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 111/138 (80%)
 Strand = Plus / Minus

                                                                       
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 375
           |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 810 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 751

                                                                       
Query: 376 catggagaagggcgcctggaggcggtggccggagtccagccgccagattgatccccacga 435
            | |||||||||  ||||||||||||||  || ||| || |||||||| |||||||| ||
Sbjct: 750 gagggagaaggggccctggaggcggtggttggcgtcgaggcgccagatggatccccagga 691

                             
Query: 436 ctcgcgcatcggcgtcca 453
              |||||| ||||||||
Sbjct: 690 gcggcgcatgggcgtcca 673

---

>dbj|AK058895.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-F11, full
           insert sequence
          Length = 1026

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 111/138 (80%)
 Strand = Plus / Minus

                                                                       
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 375
           |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 803 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 744

                                                                       
Query: 376 catggagaagggcgcctggaggcggtggccggagtccagccgccagattgatccccacga 435
            | |||||||||  ||||||||||||||  || ||| || |||||||| |||||||| ||
Sbjct: 743 gagggagaaggggccctggaggcggtggttggcgtcgaggcgccagatggatccccagga 684

                             
Query: 436 ctcgcgcatcggcgtcca 453
              |||||| ||||||||
Sbjct: 683 gcggcgcatgggcgtcca 666

---

>gb|AY589582.1| Triticum aestivum beta-expansin TaEXPB5 mRNA, complete cds
          Length = 939

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 92/113 (81%)
 Strand = Plus / Minus

                                                                       
Query: 323 gccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggag 382
           ||||||||| | |||| ||||||||||||||| ||||  ||| |||||||||| |||| |
Sbjct: 811 gccgggatggcattgttggccaccagcgtctttccggtatcgctggtgatgcggatggcg 752

                                                                
Query: 383 aagggcgcctggaggcggtggccggagtccagccgccagattgatccccacga 435
           || ||| |||| ||  || ||  || ||||| ||||||||| || ||||||||
Sbjct: 751 aatggcccctgcagcgggcggttggtgtccatccgccagatggagccccacga 699

---

>gb|AY543544.1| Triticum aestivum expansin EXPB10 mRNA, complete cds
          Length = 1132

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 92/113 (81%)
 Strand = Plus / Minus

                                                                       
Query: 323 gccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggag 382
           ||||||||| | |||| ||||||||||||||| ||||  ||| |||||||||| |||| |
Sbjct: 786 gccgggatggcattgttggccaccagcgtctttccggtatcgctggtgatgcggatggcg 727

                                                                
Query: 383 aagggcgcctggaggcggtggccggagtccagccgccagattgatccccacga 435
           || ||| |||| ||  || ||  || ||||| ||||||||| || ||||||||
Sbjct: 726 aatggcccctgcagcgggcggttggtgtccatccgccagatggagccccacga 674

---

>gb|U95968.1|OSU95968 Oryza sativa beta-expansin (EXPB2) mRNA, complete cds
          Length = 999

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 110/138 (79%)
 Strand = Plus / Minus

                                                                       
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 375
           |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 813 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 754

                                                                       
Query: 376 catggagaagggcgcctggaggcggtggccggagtccagccgccagattgatccccacga 435
            | ||| |||||  ||||||||||||||  || ||| || |||||||| |||||||| ||
Sbjct: 753 gagggakaaggggccctggaggcggtggttggcgtcgaggcgccagatggatccccagga 694

                             
Query: 436 ctcgcgcatcggcgtcca 453
              |||||| ||||||||
Sbjct: 693 gcggcgcatgggcgtcca 676

---

>gb|U91981.1|TAU91981 Triticum aestivum pollen allergen homolog mRNA, complete cds
          Length = 1232

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 323 gccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggag 382
           ||||||||| | |||| ||| ||||||||||| ||||  ||| |||||||||| ||||||
Sbjct: 816 gccgggatggcattgttggcgaccagcgtctttccggtatcgctggtgatgcggatggag 757

                      
Query: 383 aagggcgcctg 393
           || ||| ||||
Sbjct: 756 aatggcccctg 746

---

>gb|AF220610.1| Oryza sativa pollen allergen mRNA, complete cds
          Length = 1106

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 351 tcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 769 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 728

---

>ref|NM_197637.1| Oryza sativa (japonica cultivar-group) beta-expansin
           (OSJNBa0082M15.4), mRNA
          Length = 1148

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 351 tcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 784 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 743

---

>gb|AF261277.1| Oryza sativa beta-expansin (EXPB9) mRNA, complete cds
          Length = 1117

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 351 tcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 784 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 743

---

>gb|AY533104.1| Triticum aestivum beta-expansin 2 (EXPB2) gene, complete cds
          Length = 1216

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 351 tcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 982 tcttgccggactcgctggtgacgcggatggagaagggggcct 941

---

>gb|AY533102.1| Triticum aestivum beta-expansin 2 (EXPB2) mRNA, complete cds
          Length = 1068

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 351 tcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 747 tcttgccggactcgctggtgacgcggatggagaagggggcct 706

---

>gb|AC020666.8| Oryza sativa chromosome 10 BAC OSJNBa0082M15 genomic sequence, complete
              sequence
          Length = 158550

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                        
Query: 351    tcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
              |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 117099 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 117140

---

>dbj|AK099112.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023033P05, full
           insert sequence
          Length = 1071

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 351 tcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 800 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 759

---

>dbj|AK070187.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023043G12, full
           insert sequence
          Length = 1121

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 351 tcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 800 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 759

---

>gb|AY533103.1| Triticum aestivum beta-expansin 1 (EXPB1) gene, complete cds
          Length = 1149

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 351  tcttgccggactcgttggtgatgcgcatggagaaggg 387
            |||||||||||||| |||||| ||| |||||||||||
Sbjct: 1061 tcttgccggactcgctggtgacgcggatggagaaggg 1025

---

>gb|AY533101.1| Triticum aestivum beta-expansin 1 (EXPB1) mRNA, complete cds
          Length = 1111

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 351 tcttgccggactcgttggtgatgcgcatggagaaggg 387
           |||||||||||||| |||||| ||| |||||||||||
Sbjct: 777 tcttgccggactcgctggtgacgcggatggagaaggg 741

---

>gb|AY533100.1| Triticum aestivum beta-expansin 1 (EXPB1) mRNA, partial cds
          Length = 496

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 351 tcttgccggactcgttggtgatgcgcatggagaaggg 387
           |||||||||||||| |||||| ||| |||||||||||
Sbjct: 237 tcttgccggactcgctggtgacgcggatggagaaggg 201

---

>gb|AY197353.1| Zea mays clone pJR9 beta-expansin 1 protein (EXPB1) mRNA, complete
           cds
          Length = 1066

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 351 tcttgccggactcgttggtgatgcgcatggagaaggg 387
           |||||||||||||| |||||| ||| |||||||||||
Sbjct: 764 tcttgccggactcgctggtgaggcggatggagaaggg 728

---

>gb|AF332174.1|AF332174 Zea mays beta-expansin 1 (expB1) mRNA, complete cds
          Length = 1080

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 351 tcttgccggactcgttggtgatgcgcatggagaaggg 387
           |||||||||||||| |||||| ||| |||||||||||
Sbjct: 764 tcttgccggactcgctggtgaggcggatggagaaggg 728

---

>gb|AY103636.1| Zea mays PCO124530 mRNA sequence
          Length = 1085

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 351 tcttgccggactcgttggtgatgcgcatggagaaggg 387
           |||||||||||||| |||||| ||| |||||||||||
Sbjct: 776 tcttgccggactcgctggtgaggcggatggagaaggg 740

---

>emb|BX294387.11| Zebrafish DNA sequence from clone DKEY-267L16 in linkage group 9,
              complete sequence
          Length = 167582

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 408    agtccagccgccagattgatcc 429
              ||||||||||||||||||||||
Sbjct: 159224 agtccagccgccagattgatcc 159203

---

>dbj|AB041625.1| Brassica rapa BcSL10 gene for SLG-like 10, partial cds
          Length = 3511

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 240 catatgattccaaatgatgatg 261
           ||||||||||||||||||||||
Sbjct: 108 catatgattccaaatgatgatg 129

---

>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 339     cggccaccagcgtcttgccgg 359
               |||||||||||||||||||||
Sbjct: 1260020 cggccaccagcgtcttgccgg 1260040

---

>gb|DQ481669.1| Takifugu rubripes HoxDb gene cluster, complete sequence
          Length = 398525

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 253    atgatgatgagttcagcagcttcag 277
              ||||||||||||| |||||||||||
Sbjct: 345505 atgatgatgagttaagcagcttcag 345481

---

>emb|AJ295940.1|FPR295940 Festuca pratensis mRNA for beta expansin B1 (expB1 gene)
          Length = 1224

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 351 tcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggtggccggagt 410
           |||||||||| ||| |||||||||||| ||| || ||| ||| |||  ||| ||||||||
Sbjct: 780 tcttgccggaatcgctggtgatgcgcaaggacaatggccccttgagcgggttgccggagt 721

            
Query: 411 c 411
           |
Sbjct: 720 c 720

---

>gb|AY197352.1| Zea mays clone pJR11 beta-expansin 9 protein (EXPB9) mRNA, complete
           cds
          Length = 1088

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 351 tcttgccggactcgttggtgatgcgcatggagaaggg 387
           |||||||||||||| |||||| ||| || ||||||||
Sbjct: 738 tcttgccggactcgctggtgaggcggatagagaaggg 702

---

>emb|BX842575.1| Mycobacterium tuberculosis H37Rv complete genome; segment 4/13
          Length = 349306

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 339    cggccaccagcgtcttgccgg 359
              |||||||||||||||||||||
Sbjct: 226686 cggccaccagcgtcttgccgg 226706

---

>emb|BX248337.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 4/14
          Length = 327650

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 339    cggccaccagcgtcttgccgg 359
              |||||||||||||||||||||
Sbjct: 274844 cggccaccagcgtcttgccgg 274864

---

>gb|AC016766.6| Homo sapiens BAC clone RP11-558I6 from 2, complete sequence
          Length = 194374

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 244    tgattccaaatgatgatgagt 264
              |||||||||||||||||||||
Sbjct: 177950 tgattccaaatgatgatgagt 177930

---

>gb|AY543540.1| Triticum aestivum expansin EXPB5 mRNA, complete cds
          Length = 960

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 351 tcttgccggactcgttggtgatgcgcatggagaaggg 387
           ||||||||| |||| |||||| ||| |||||||||||
Sbjct: 730 tcttgccgggctcgctggtgacgcggatggagaaggg 694

---

>gb|L14271.1|MZEPOLPI Zea mays Zea mI gene, complete cds
          Length = 827

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 351 tcttgccggactcgttggtgatgcgcatggagaaggg 387
           |||||||||||||| |||||| ||| || ||||||||
Sbjct: 499 tcttgccggactcgctggtgaggcggatagagaaggg 463

---

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 340     ggccaccagcgtcttgccgg 359
               ||||||||||||||||||||
Sbjct: 2016483 ggccaccagcgtcttgccgg 2016464

---

>gb|AY172516.1| Rhizobium etli transcription repair coupling factor (mfd) gene,
            partial cds; recombination and repair protein (recG)
            gene, complete cds; and unknown gene
          Length = 6176

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 341  gccaccagcgtcttgccgga 360
            ||||||||||||||||||||
Sbjct: 4669 gccaccagcgtcttgccgga 4650

---

>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 341     gccaccagcgtcttgccgga 360
               ||||||||||||||||||||
Sbjct: 2190610 gccaccagcgtcttgccgga 2190629

---

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 302     aaggtgctgggcgcccagttggcc 325
               |||||||||| |||||||||||||
Sbjct: 2061004 aaggtgctggtcgcccagttggcc 2060981

---

>gb|AC157813.6| Mus musculus chromosome 1, clone RP24-70I14, complete sequence
          Length = 177317

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      gcacacacaaacagtaataa 22
              ||||||||||||||||||||
Sbjct: 120092 gcacacacaaacagtaataa 120073

---

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 337     gtcggccaccagcgtcttgc 356
               ||||||||||||||||||||
Sbjct: 4141074 gtcggccaccagcgtcttgc 4141055

---

>emb|BX649380.7| Zebrafish DNA sequence from clone CH211-87P6 in linkage group 4, complete
              sequence
          Length = 172167

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 240    catatgattccaaatgatgatgagttca 267
              |||||||||| ||||| |||||||||||
Sbjct: 166340 catatgattctaaatggtgatgagttca 166367

---

>gb|AC107766.14| Mus musculus chromosome 1, clone RP23-166L24, complete sequence
          Length = 182865

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 3    gcacacacaaacagtaataa 22
            ||||||||||||||||||||
Sbjct: 7061 gcacacacaaacagtaataa 7080

---

>gb|AF107020.1|AF107020 Actinomyces naeslundii strain LY7 type-1 fimbrial major subunit
           precursor (fimP) gene, complete cds
          Length = 1622

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 322 ggccgggatgaccttgtcgg 341
           ||||||||||||||||||||
Sbjct: 485 ggccgggatgaccttgtcgg 466

---

>gb|AF107019.1|AF107019 Actinomyces naeslundii strain P-1-K type-1 fimbrial major subunit
           precursor (fimP) gene, complete cds
          Length = 1622

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 322 ggccgggatgaccttgtcgg 341
           ||||||||||||||||||||
Sbjct: 485 ggccgggatgaccttgtcgg 466

---

>gb|AF106035.1|AF106035 Actinomyces naeslundii strain B-1-K type-1 fimbrial major subunit
           precursor (fimP) gene, complete cds
          Length = 1622

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 322 ggccgggatgaccttgtcgg 341
           ||||||||||||||||||||
Sbjct: 485 ggccgggatgaccttgtcgg 466

---

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 307    gctgggcgcccagttggccgggat 330
              ||||||||||||||| ||||||||
Sbjct: 594398 gctgggcgcccagtttgccgggat 594375

---

>gb|M32067.1|ACYFIMBA A.viscosus fimbrial structural protein type 1 subunit gene,
           complete cds
          Length = 1850

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 322 ggccgggatgaccttgtcgg 341
           ||||||||||||||||||||
Sbjct: 588 ggccgggatgaccttgtcgg 569


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,602,162
Number of Sequences: 3902068
Number of extensions: 3602162
Number of successful extensions: 69090
Number of sequences better than 10.0: 119
Number of HSP's better than 10.0 without gapping: 119
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68401
Number of HSP's gapped (non-prelim): 654
length of query: 465
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 443
effective length of database: 17,147,199,772
effective search space: 7596209498996
effective search space used: 7596209498996
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---