ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbart10h05 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X84056.1|HVPAF93 H.vulgare paf93 gene Length = 1154 Score = 924 bits (466), Expect = 0.0 Identities = 475/478 (99%) Strand = Plus / Minus Query: 1 aataagcaaataaacttaaacaacatccaggacctgactctggaccaaactgaagcccgt 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1089 aataagcaaataaacttaaacaacatccaggacctgactctggaccaaactgaagcccgt 1030 Query: 61 atacccaaactgaacacaagcatccgtcacctaacgggcttcacagaccggaccttcaaa 120 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 1029 atacccaaactgaacacaagcatccgtcacctaacggacttcacagaccggaccttcaaa 970 Query: 121 gacgatcaatccctccatcttgacacggacttaaacttaaagcaaacacgacacacgcca 180 ||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| Sbjct: 969 gacgatcaatccctccatcttgacacggacttagacgtaaagcaaacacgacacacgcca 910 Query: 181 acaatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggct 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 909 acaatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggct 850 Query: 241 tgtgctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggca 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 849 tgtgctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggca 790 Query: 301 gcttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacct 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 789 gcttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacct 730 Query: 361 cctcggcggccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccg 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 729 cctcggcggccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccg 670 Query: 421 cggcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaa 478 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 669 cggcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaa 612 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttga 468 |||||||||||||||||||| Sbjct: 449 gccgggcagcttctccttga 430
>gb|AF043093.1|AF043093 Hordeum vulgare dehydrin 8 (dhn8) gene, complete cds Length = 2254 Score = 704 bits (355), Expect = 0.0 Identities = 355/355 (100%) Strand = Plus / Minus Query: 124 gatcaatccctccatcttgacacggacttaaacttaaagcaaacacgacacacgccaaca 183 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2246 gatcaatccctccatcttgacacggacttaaacttaaagcaaacacgacacacgccaaca 2187 Query: 184 atttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgt 243 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2186 atttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgt 2127 Query: 244 gctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagct 303 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2126 gctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagct 2067 Query: 304 tgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcct 363 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2066 tgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcct 2007 Query: 364 cggcggccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgcgg 423 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2006 cggcggccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgcgg 1947 Query: 424 cagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaa 478 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1946 cagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaa 1892 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttga 468 |||||||||||||||||||| Sbjct: 1729 gccgggcagcttctccttga 1710
>gb|U73211.1|TAU73211 Triticum aestivum cold acclimation protein WCOR410c (Wcor410c) mRNA, complete cds Length = 1242 Score = 563 bits (284), Expect = e-157 Identities = 387/416 (93%), Gaps = 4/416 (0%) Strand = Plus / Minus Query: 65 ccaaactgaa-cacaagcatccgtcacctaacgggcttcacagaccggaccttcaaagac 123 |||||||||| |||||||||||||||| |||||||||||| ||||| |||||||||||| Sbjct: 1037 ccaaactgaaacacaagcatccgtcactgaacgggcttcacggaccgaaccttcaaagac 978 Query: 124 gatcaatccctcc-atcttgacacggacttaaacttaaagcaaacacgacacacgccaac 182 |||||| |||||| | |||||||| |||||| | |||||||||||| |||||||||||| Sbjct: 977 gatcaacccctcccaccttgacaccaacttaa-cgtaaagcaaacacaacacacgccaac 919 Query: 183 aatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttg 242 |||| ||| |||||||||| | |||||||||| ||||||||||||||||| ||||||||| Sbjct: 918 aattcaatcgaggtccggtcacgagtctcggg-cacggcggcgatcaagcgctgggcttg 860 Query: 243 tgctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagc 302 |||||||||| || ||||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 859 tgctcgcctgcagcggcggcggccttgtcctcctcccctgtcttgtggtaaccaggcagc 800 Query: 303 ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcc 362 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 799 ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtcagggctgctcacctcc 740 Query: 363 tcggcggccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgcg 422 |||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||| Sbjct: 739 tcggcggctggcgccggcgcgtgcactggtgctggagcagcgtgcgtgacgggcaccgga 680 Query: 423 gcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaa 478 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 679 gcagcgtcctccggtttcttgtggccgccgggcagcttctccttgatcttttccaa 624 Score = 67.9 bits (34), Expect = 3e-08 Identities = 50/54 (92%), Gaps = 1/54 (1%) Strand = Plus / Minus Query: 1 aataagcaaataaacttaaacaacatccaggacctgactctggaccaaactgaa 54 |||||| ||| |||||||| |||||||||||||||||||||| ||||||||||| Sbjct: 1080 aataagtaaacaaacttaa-caacatccaggacctgactctgaaccaaactgaa 1028 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttga 468 |||||||||||||||||||| Sbjct: 461 gccgggcagcttctccttga 442
>gb|L29152.1|WHTWCOR Triticum aestivum cold acclimation protein (WCOR410) mRNA, complete cds Length = 1136 Score = 555 bits (280), Expect = e-155 Identities = 385/416 (92%), Gaps = 3/416 (0%) Strand = Plus / Minus Query: 65 ccaaactgaa-cacaagcatccgtcacctaacgggcttcacagaccggaccttcaaagac 123 |||||||||| || ||||| ||||||| |||||||||||| |||||||||||||||||| Sbjct: 1038 ccaaactgaaacagaagcacccgtcactgaacgggcttcacggaccggaccttcaaagac 979 Query: 124 gatcaatccctcc-atcttgacacggacttaaacttaaagcaaacacgacacacgccaac 182 |||||| |||||| | |||||||| ||||| || |||||||||||| |||||||||||| Sbjct: 978 gatcaacccctcccaccttgacaccaacttagacgtaaagcaaacacaacacacgccaac 919 Query: 183 aatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttg 242 |||| ||| |||||||||| | | |||||||| ||||||||||||||||| ||||||||| Sbjct: 918 aattcaatcgaggtccggtcacgggtctcggg-cacggcggcgatcaagcgctgggcttg 860 Query: 243 tgctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagc 302 |||||||||| || ||||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 859 tgctcgcctgtagcggcggcggccttgtcctcctcccctgtcttgtggtaaccaggcagc 800 Query: 303 ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcc 362 |||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| Sbjct: 799 ttgtccatgatcttgcccagcaggcccttcttctccttcgcgtcagggctgctcacctcc 740 Query: 363 tcggcggccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgcg 422 |||| ||||||| | |||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 739 tcgggggccggcaccggcgcgtgcactggtgctggagcagcgtgcgtgacgggcaccgca 680 Query: 423 gcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaa 478 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 679 gcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaa 624 Score = 61.9 bits (31), Expect = 2e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 20 acaacatccaggacctgactctggaccaaactgaa 54 ||||||||||||||||||||||| ||||||||||| Sbjct: 1063 acaacatccaggacctgactctgaaccaaactgaa 1029
>gb|AF181458.1|AF181458 Hordeum vulgare dehydrin (Dhn8) mRNA, complete cds Length = 808 Score = 551 bits (278), Expect = e-154 Identities = 287/290 (98%) Strand = Plus / Minus Query: 189 atggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgtgctcg 248 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 808 atggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgtgctcg 749 Query: 249 cctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagcttgtcc 308 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 748 cctgaaggggcggcggccttgtcctcctcctctgtcttgtggtaaccgggcagcttgtcc 689 Query: 309 atgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcctcggcg 368 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 688 atgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcctcggcg 629 Query: 369 gccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgcggcagcg 428 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 628 gccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtggcgggcaccgcggcagcg 569 Query: 429 tcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaa 478 ||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 568 tcctccggcttcttgtggccgccgggcagcttctccttgattttttccaa 519 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttga 468 |||||||||||||||||||| Sbjct: 356 gccgggcagcttctccttga 337
>gb|L19419.1|LHPESI Lophopyrum elongatum ES135 mRNA sequence Length = 1130 Score = 492 bits (248), Expect = e-136 Identities = 377/415 (90%), Gaps = 10/415 (2%) Strand = Plus / Minus Query: 65 ccaaactgaa-cacaagcatccgtcacctaacgggcttcacagaccggaccttcaaagac 123 |||||||||| ||||| |||||||||| ||||||||||||||||||||||||||| ||| Sbjct: 1009 ccaaactgaaacacaaacatccgtcactgaacgggcttcacagaccggaccttcaa-gac 951 Query: 124 gatcaatccctcc-atcttgacacggacttaaacttaaagcaaacacgacacacgccaac 182 |||||| |||||| | |||||||| ||||| || |||||||||||| |||||||||||| Sbjct: 950 gatcaacccctcccaccttgacaccaacttagacgtaaagcaaacacaacacacgccaac 891 Query: 183 aatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttg 242 |||| ||| ||| |||||| | |||||||||| |||||||||||| |||| ||||||||| Sbjct: 890 aattcaatcgagctccggtcacgagtctcggg-cacggcggcgattaagcgctgggcttg 832 Query: 243 tgctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagc 302 |||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 831 tgctcgcctgcaggggcggcggccttgtcctcctcccctgtcttgtggtaaccaggcagc 772 Query: 303 ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcc 362 |||||||||||||||||||| | ||||||||||||||||||||| ||||||||||| ||| Sbjct: 771 ttgtccatgatcttgcccagcaagcccttcttctccttcgcgtcagggctgctcacttcc 712 Query: 363 tcggcggccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgcg 422 ||||||||| ||||||||||| || ||||| ||||||||||||||||||||||| Sbjct: 711 tcggcggcc------ggcgcgtgcaccggtgctggggcagcgtgcgtgacgggcaccgca 658 Query: 423 gcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttcca 477 ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 657 gcaacgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttcca 603 Score = 65.9 bits (33), Expect = 1e-07 Identities = 49/53 (92%), Gaps = 1/53 (1%) Strand = Plus / Minus Query: 2 ataagcaaataaacttaaacaacatccaggacctgactctggaccaaactgaa 54 ||||| ||| |||||||| |||||||||||||||||||||| ||||||||||| Sbjct: 1051 ataagtaaacaaacttaa-caacatccaggacctgactctgaaccaaactgaa 1000 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttga 468 |||||||||||||||||||| Sbjct: 439 gccgggcagcttctccttga 420
>emb|AJ890140.1| Triticum turgidum subsp. durum mRNA for dehydrin (dhn11 gene) Length = 1127 Score = 478 bits (241), Expect = e-132 Identities = 378/417 (90%), Gaps = 5/417 (1%) Strand = Plus / Minus Query: 65 ccaaactgaa-cacaagcatccgtcacctaacgggcttcacagaccggaccttcaaagac 123 |||||||||| |||||||||||||||| |||||||||||| ||||| |||||||||||| Sbjct: 1035 ccaaactgaaacacaagcatccgtcactgaacgggcttcacggaccgaaccttcaaagac 976 Query: 124 gatcaatccctcc-atcttgacacggacttaaacttaaagcaaacacgacacacgccaac 182 |||||| |||||| | |||||||| |||||| | |||||||||||| |||||||||||| Sbjct: 975 gatcaacccctcccaccttgacaccaacttaa-cgtaaagcaaacacaacacacgccaac 917 Query: 183 aatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttg 242 |||| ||| | |||||||| | |||||||||| |||||||||| |||||| |||| ||| Sbjct: 916 aattcaatcggggtccggtcacgagtctcggg-cacggcggcgttcaagcgttgggattg 858 Query: 243 tgctcgcc-tgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcag 301 |||||||| || || |||||||| |||||||||||||||||||||||||||||| ||||| Sbjct: 857 tgctcgccctgcagcggcggcggacttgtcctcctcccctgtcttgtggtaaccaggcag 798 Query: 302 cttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctc 361 ||||||||||||||||||||||||||||||||||||||||| ||| ||| || ||||||| Sbjct: 797 cttgtccatgatcttgcccagtaggcccttcttctccttcgggtcagggatggtcacctc 738 Query: 362 ctcggcggccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgc 421 |||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||| Sbjct: 737 ctcggcggatggcgccggcgcgtgcactggtgctggagcagcgtgcgtgacgggcaccgg 678 Query: 422 ggcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaa 478 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 677 agcagcgtcctccggtttcttgtggccgccgggcagcttctccttgatcttttccaa 621 Score = 67.9 bits (34), Expect = 3e-08 Identities = 50/54 (92%), Gaps = 1/54 (1%) Strand = Plus / Minus Query: 1 aataagcaaataaacttaaacaacatccaggacctgactctggaccaaactgaa 54 |||||| ||| |||||||| |||||||||||||||||||||| ||||||||||| Sbjct: 1078 aataagtaaacaaacttaa-caacatccaggacctgactctgaaccaaactgaa 1026
>gb|U73210.1|TAU73210 Triticum aestivum cold acclimation protein WCOR410b (Wcor410b) mRNA, complete cds Length = 1181 Score = 448 bits (226), Expect = e-123 Identities = 327/358 (91%), Gaps = 2/358 (0%) Strand = Plus / Minus Query: 73 aacacaagcatccgtcacctaacgggcttcacagaccggaccttcaaagacgatcaatcc 132 |||| ||||| ||||||| |||||||||||| |||||||||||||||||||||||| || Sbjct: 1038 aacagaagcacccgtcactcaacgggcttcacggaccggaccttcaaagacgatcaaccc 979 Query: 133 ctcc-atcttgacacggacttaaacttaaagcaaacacgacacacgccaacaatttaatg 191 |||| | |||||||| ||||| || |||||||||||| |||||||||||||||| ||| Sbjct: 978 ctcccaccttgacaccaacttagacgtaaagcaaacacaacacacgccaacaattcaatc 919 Query: 192 gaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgtgctcgcct 251 |||||||||| | | |||||||| ||||||||||||||||| |||||||||||||||||| Sbjct: 918 gaggtccggtcacgggtctcggg-cacggcggcgatcaagcgctgggcttgtgctcgcct 860 Query: 252 gaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagcttgtccatg 311 | || ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 859 gtagcggcggcggccttgtcctcctcccctgtcttgtggtaaccaggcagcttgtccatg 800 Query: 312 atcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcctcggcggcc 371 ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct: 799 atcttgcccagcaggcccttcttctccttcgcgtcagggctgctcacctcctcggcggcc 740 Query: 372 ggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgcggcagcgt 429 ||||| ||||||||||| || |||||||||||||||||||||||| ||| ||||||| Sbjct: 739 ggcgccggcgcgtgcaccggtgctggagcagcgtgcgtgacgggcgccggagcagcgt 682 Score = 161 bits (81), Expect = 3e-36 Identities = 87/89 (97%) Strand = Plus / Minus Query: 390 ggcgctggagcagcgtgcgtgacgggcaccgcggcagcgtcctccggcttcttgtggccg 449 ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 697 ggcgccggagcagcgtgcgtgacgggcaccgcagcagcgtcctccggcttcttgtggccg 638 Query: 450 ccgggcagcttctccttgatcttttccaa 478 ||||||||||||||||||||||||||||| Sbjct: 637 ccgggcagcttctccttgatcttttccaa 609
>gb|AY574032.1| Triticum aestivum dehydrin-like gene, partial sequence Length = 391 Score = 272 bits (137), Expect = 1e-69 Identities = 168/177 (94%), Gaps = 1/177 (0%) Strand = Plus / Minus Query: 303 ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcc 362 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 390 ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtcagggctgctcacctcc 331 Query: 363 tcggcggccggcgcaggcgcgtgc-actggcgctggagcagcgtgcgtgacgggcaccgc 421 |||||||| ||||| ||||||||| ||||| |||||||||||||||||||||||| ||| Sbjct: 330 tcggcggctggcgccggcgcgtgctactggtgctggagcagcgtgcgtgacgggcgccgg 271 Query: 422 ggcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaa 478 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 270 agcagcgtcctccggtttcttgtggccgccgggcagcttctccttgatcttttccaa 214
>gb|AY587109.1| Oryza sativa (japonica cultivar-group) dehydration-stress inducible protein 1 mRNA, complete cds Length = 1315 Score = 105 bits (53), Expect = 1e-19 Identities = 74/81 (91%) Strand = Plus / Minus Query: 284 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 343 |||||||||||||||||| || ||||||||||||||||||| ||||||||||||||| | Sbjct: 918 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 859 Query: 344 gtccgggctgctcacctcctc 364 |||||||||||||| ||||| Sbjct: 858 atccgggctgctcacttcctc 838 Score = 85.7 bits (43), Expect = 1e-13 Identities = 46/47 (97%) Strand = Plus / Minus Query: 426 gcgtcctccggcttcttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 758 gcgtcttccggcttcttgtggccgccgggcagcttctccttgatctt 712 Score = 48.1 bits (24), Expect = 0.026 Identities = 24/24 (100%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttgatctt 472 |||||||||||||||||||||||| Sbjct: 474 gccgggcagcttctccttgatctt 451 Score = 44.1 bits (22), Expect = 0.41 Identities = 40/46 (86%) Strand = Plus / Minus Query: 294 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 339 ||||||||||| ||| |||||||| | || | |||||||||||||| Sbjct: 734 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 689
>gb|AY786415.1| Oryza sativa (japonica cultivar-group) SK3-type dehydrin 1 (Dhn1) mRNA, complete cds Length = 1117 Score = 105 bits (53), Expect = 1e-19 Identities = 74/81 (91%) Strand = Plus / Minus Query: 284 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 343 |||||||||||||||||| || ||||||||||||||||||| ||||||||||||||| | Sbjct: 908 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 849 Query: 344 gtccgggctgctcacctcctc 364 |||||||||||||| ||||| Sbjct: 848 atccgggctgctcacttcctc 828 Score = 85.7 bits (43), Expect = 1e-13 Identities = 46/47 (97%) Strand = Plus / Minus Query: 426 gcgtcctccggcttcttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 748 gcgtcttccggcttcttgtggccgccgggcagcttctccttgatctt 702 Score = 48.1 bits (24), Expect = 0.026 Identities = 24/24 (100%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttgatctt 472 |||||||||||||||||||||||| Sbjct: 464 gccgggcagcttctccttgatctt 441 Score = 44.1 bits (22), Expect = 0.41 Identities = 40/46 (86%) Strand = Plus / Minus Query: 294 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 339 ||||||||||| ||| |||||||| | || | |||||||||||||| Sbjct: 724 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 679
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 105 bits (53), Expect = 1e-19 Identities = 74/81 (91%) Strand = Plus / Plus Query: 284 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 343 |||||||||||||||||| || ||||||||||||||||||| ||||||||||||||| | Sbjct: 27184369 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 27184428 Query: 344 gtccgggctgctcacctcctc 364 |||||||||||||| ||||| Sbjct: 27184429 atccgggctgctcacttcctc 27184449 Score = 85.7 bits (43), Expect = 1e-13 Identities = 46/47 (97%) Strand = Plus / Plus Query: 426 gcgtcctccggcttcttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 27184529 gcgtcttccggcttcttgtggccgccgggcagcttctccttgatctt 27184575 Score = 48.1 bits (24), Expect = 0.026 Identities = 24/24 (100%) Strand = Plus / Plus Query: 449 gccgggcagcttctccttgatctt 472 |||||||||||||||||||||||| Sbjct: 27184813 gccgggcagcttctccttgatctt 27184836 Score = 44.1 bits (22), Expect = 0.41 Identities = 40/46 (86%) Strand = Plus / Plus Query: 294 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 339 ||||||||||| ||| |||||||| | || | |||||||||||||| Sbjct: 27184553 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 27184598
>dbj|AP004858.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1725_H08 Length = 155431 Score = 105 bits (53), Expect = 1e-19 Identities = 74/81 (91%) Strand = Plus / Plus Query: 284 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 343 |||||||||||||||||| || ||||||||||||||||||| ||||||||||||||| | Sbjct: 80818 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 80877 Query: 344 gtccgggctgctcacctcctc 364 |||||||||||||| ||||| Sbjct: 80878 atccgggctgctcacttcctc 80898 Score = 85.7 bits (43), Expect = 1e-13 Identities = 46/47 (97%) Strand = Plus / Plus Query: 426 gcgtcctccggcttcttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 80978 gcgtcttccggcttcttgtggccgccgggcagcttctccttgatctt 81024 Score = 48.1 bits (24), Expect = 0.026 Identities = 24/24 (100%) Strand = Plus / Plus Query: 449 gccgggcagcttctccttgatctt 472 |||||||||||||||||||||||| Sbjct: 81262 gccgggcagcttctccttgatctt 81285 Score = 44.1 bits (22), Expect = 0.41 Identities = 40/46 (86%) Strand = Plus / Plus Query: 294 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 339 ||||||||||| ||| |||||||| | || | |||||||||||||| Sbjct: 81002 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 81047
>dbj|AP005055.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0684A08 Length = 137841 Score = 105 bits (53), Expect = 1e-19 Identities = 74/81 (91%) Strand = Plus / Plus Query: 284 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 343 |||||||||||||||||| || ||||||||||||||||||| ||||||||||||||| | Sbjct: 35040 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 35099 Query: 344 gtccgggctgctcacctcctc 364 |||||||||||||| ||||| Sbjct: 35100 atccgggctgctcacttcctc 35120 Score = 85.7 bits (43), Expect = 1e-13 Identities = 46/47 (97%) Strand = Plus / Plus Query: 426 gcgtcctccggcttcttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 35200 gcgtcttccggcttcttgtggccgccgggcagcttctccttgatctt 35246 Score = 48.1 bits (24), Expect = 0.026 Identities = 24/24 (100%) Strand = Plus / Plus Query: 449 gccgggcagcttctccttgatctt 472 |||||||||||||||||||||||| Sbjct: 35484 gccgggcagcttctccttgatctt 35507 Score = 44.1 bits (22), Expect = 0.41 Identities = 40/46 (86%) Strand = Plus / Plus Query: 294 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 339 ||||||||||| ||| |||||||| | || | |||||||||||||| Sbjct: 35224 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 35269
>dbj|AK070197.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023042N13, full insert sequence Length = 1292 Score = 105 bits (53), Expect = 1e-19 Identities = 74/81 (91%) Strand = Plus / Minus Query: 284 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 343 |||||||||||||||||| || ||||||||||||||||||| ||||||||||||||| | Sbjct: 930 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 871 Query: 344 gtccgggctgctcacctcctc 364 |||||||||||||| ||||| Sbjct: 870 atccgggctgctcacttcctc 850 Score = 85.7 bits (43), Expect = 1e-13 Identities = 46/47 (97%) Strand = Plus / Minus Query: 426 gcgtcctccggcttcttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 770 gcgtcttccggcttcttgtggccgccgggcagcttctccttgatctt 724 Score = 48.1 bits (24), Expect = 0.026 Identities = 24/24 (100%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttgatctt 472 |||||||||||||||||||||||| Sbjct: 486 gccgggcagcttctccttgatctt 463 Score = 44.1 bits (22), Expect = 0.41 Identities = 40/46 (86%) Strand = Plus / Minus Query: 294 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 339 ||||||||||| ||| |||||||| | || | |||||||||||||| Sbjct: 746 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 701
>dbj|AB011367.1| Oryza sativa mRNA for LIP9, partial cds Length = 680 Score = 105 bits (53), Expect = 1e-19 Identities = 74/81 (91%) Strand = Plus / Minus Query: 284 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 343 |||||||||||||||||| || ||||||||||||||||||| ||||||||||||||| | Sbjct: 351 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 292 Query: 344 gtccgggctgctcacctcctc 364 |||||||||||||| ||||| Sbjct: 291 atccgggctgctcacttcctc 271 Score = 85.7 bits (43), Expect = 1e-13 Identities = 46/47 (97%) Strand = Plus / Minus Query: 426 gcgtcctccggcttcttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 191 gcgtcttccggcttcttgtggccgccgggcagcttctccttgatctt 145 Score = 44.1 bits (22), Expect = 0.41 Identities = 40/46 (86%) Strand = Plus / Minus Query: 294 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 339 ||||||||||| ||| |||||||| | || | |||||||||||||| Sbjct: 167 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 122
>gb|AY105067.1| Zea mays PCO081051 mRNA sequence Length = 1398 Score = 87.7 bits (44), Expect = 3e-14 Identities = 68/76 (89%) Strand = Plus / Minus Query: 283 tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcg 342 |||||||||| ||||| | ||||||||||||||||||||| | ||||||||||||||| Sbjct: 928 tcttgtggtagccgggtatcttgtccatgatcttgcccagcaagcccttcttctccttgc 869 Query: 343 cgtccgggctgctcac 358 | |||||||||||||| Sbjct: 868 catccgggctgctcac 853 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 441 ttgtggccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||| ||||||||||||||||| |||| Sbjct: 773 ttgtggccaccggggagcttctccttgatcttgtcca 737
>gb|BT019045.1| Zea mays clone Contig566.F mRNA sequence Length = 722 Score = 77.8 bits (39), Expect = 3e-11 Identities = 51/55 (92%) Strand = Plus / Minus Query: 423 gcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| ||||| ||||||||||||||||| |||| Sbjct: 219 gcagcgtcttccggcttcttgtggccaccgggtagcttctccttgatcttgtcca 165 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 283 tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttctt 334 |||||||||| ||||| | ||||||||||||||||||||| | ||||||||| Sbjct: 353 tcttgtggtagccgggtatcttgtccatgatcttgcccagcaagcccttctt 302
>gb|L35913.1|MZELIPASE Zea mays dehydrin (dhn-2) mRNA, complete cds Length = 1277 Score = 77.8 bits (39), Expect = 3e-11 Identities = 51/55 (92%) Strand = Plus / Minus Query: 423 gcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| ||||| ||||||||||||||||| |||| Sbjct: 730 gcagcgtcttccggcttcttgtggccaccgggtagcttctccttgatcttgtcca 676 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 283 tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttctt 334 |||||||||| ||||| | ||||||||||||||||||||| | ||||||||| Sbjct: 864 tcttgtggtagccgggtatcttgtccatgatcttgcccagcaagcccttctt 813
>gb|AY111114.1| Zea mays CL2452_1 mRNA sequence Length = 1256 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 432 tccggcttcttgtggccgccgggcagcttctccttgatcttttcca 477 ||||||||||||||||| ||||| ||||||||||||||||| |||| Sbjct: 700 tccggcttcttgtggccaccgggtagcttctccttgatcttgtcca 655 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 283 tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttctt 334 |||||||||| ||||| | ||||||||||||||||||||| | ||||||||| Sbjct: 843 tcttgtggtagccgggtatcttgtccatgatcttgcccagcaagcccttctt 792
>gb|DQ160121.1| Taraxacum officinale TO101-3 (To101-3) mRNA, partial cds Length = 322 Score = 60.0 bits (30), Expect = 7e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatcttttcca 477 ||||||||||||||| ||||||||||||||||| |||| Sbjct: 222 cttgtggccgccgggaagcttctccttgatcttctcca 185
>emb|AJ439990.1|OSA439990 Oryza sativa partial mRNA for putative cold acclimation protein (cap-L gene) Length = 504 Score = 60.0 bits (30), Expect = 7e-06 Identities = 38/41 (92%) Strand = Plus / Minus Query: 284 cttgtggtaaccgggcagcttgtccatgatcttgcccagta 324 |||||||||||||||||| || | ||||||||||||||||| Sbjct: 123 cttgtggtaaccgggcagtttctncatgatcttgcccagta 83
>gb|AY177889.1| Sorghum bicolor clone BAC IS_21O3 ABA-induced RAB17-like gene, partial sequence Length = 4636 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||| ||||||||||||||||||||||| Sbjct: 1361 cttgtggcctccgggcagcttctccttgatctt 1329 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgatcttttcca 477 ||||||||||||||||||||||| |||| Sbjct: 1501 ccgggcagcttctccttgatcttgtcca 1474
>gb|AC145325.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0034E03 map near 50283S, complete sequence Length = 134074 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||||||||||||||||||||| Sbjct: 66878 cttgttgccgccgggcagcttctccttgatctt 66846 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||| ||||||||||||||||| Sbjct: 82721 cttgttgccgccggggagcttctccttgatctt 82689 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||| ||||||||||||||||| Sbjct: 75315 cttgttgccgccggggagcttctccttgatctt 75283 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||||||||||||||||||||| |||| Sbjct: 67046 gccgggcagcttctccttgatcttgtcca 67018 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||||||||||||||||||||| |||| Sbjct: 60505 gccgggcagcttctccttgatcttgtcca 60477 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||| ||||||||||||||||| Sbjct: 60343 cttgttgccgccggggagcttctccttgatctt 60311 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||| ||||||||||||||||| |||| Sbjct: 82901 gccggggagcttctccttgatcttgtcca 82873 Score = 40.1 bits (20), Expect = 6.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 294 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 60504 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 60461
>gb|AY349271.1| Hordeum vulgare subsp. spontaneum NPGS PI 559559 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 821 cttgtggccgccggggagcttctccttgatctt 789 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 976 ggcagcttctccttgatcttgtcca 952
>gb|AY349270.1| Hordeum vulgare subsp. spontaneum NPGS PI 559556 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 823 cttgtggccgccggggagcttctccttgatctt 791 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 978 ggcagcttctccttgatcttgtcca 954
>gb|AY349269.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 972 ggcagcttctccttgatcttgtcca 948
>gb|AY349268.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 821 cttgtggccgccggggagcttctccttgatctt 789 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 976 ggcagcttctccttgatcttgtcca 952
>gb|AY349267.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 821 cttgtggccgccggggagcttctccttgatctt 789 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 976 ggcagcttctccttgatcttgtcca 952
>gb|AY349266.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 dehydrin 9 (Dhn9) gene, complete cds Length = 992 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 808 cttgtggccgccggggagcttctccttgatctt 776 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 963 ggcagcttctccttgatcttgtcca 939
>gb|AY349265.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 dehydrin 9 (Dhn9) gene, complete cds Length = 994 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 810 cttgtggccgccggggagcttctccttgatctt 778 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 965 ggcagcttctccttgatcttgtcca 941
>gb|AY349264.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 972 ggcagcttctccttgatcttgtcca 948
>gb|AY349263.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 821 cttgtggccgccggggagcttctccttgatctt 789 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 976 ggcagcttctccttgatcttgtcca 952
>gb|AY349262.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 dehydrin 9 (Dhn9) gene, complete cds Length = 1000 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 816 cttgtggccgccggggagcttctccttgatctt 784 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 971 ggcagcttctccttgatcttgtcca 947
>gb|AY349261.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 821 cttgtggccgccggggagcttctccttgatctt 789 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 976 ggcagcttctccttgatcttgtcca 952
>gb|AY349260.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 972 ggcagcttctccttgatcttgtcca 948
>gb|AY349259.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 823 cttgtggccgccggggagcttctccttgatctt 791 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 978 ggcagcttctccttgatcttgtcca 954
>gb|AY349258.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 972 ggcagcttctccttgatcttgtcca 948
>gb|AY349257.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 823 cttgtggccgccggggagcttctccttgatctt 791 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 978 ggcagcttctccttgatcttgtcca 954
>gb|AY349256.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 972 ggcagcttctccttgatcttgtcca 948
>gb|AY349255.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 972 ggcagcttctccttgatcttgtcca 948
>gb|AY349254.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 972 ggcagcttctccttgatcttgtcca 948
>gb|AY349253.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 972 ggcagcttctccttgatcttgtcca 948
>gb|AY349252.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 972 ggcagcttctccttgatcttgtcca 948
>gb|AY349251.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 dehydrin 9 (Dhn9) gene, complete cds Length = 1004 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 820 cttgtggccgccggggagcttctccttgatctt 788 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 975 ggcagcttctccttgatcttgtcca 951
>gb|AY349250.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 972 ggcagcttctccttgatcttgtcca 948
>gb|AY349249.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 823 cttgtggccgccggggagcttctccttgatctt 791 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 978 ggcagcttctccttgatcttgtcca 954
>gb|AY349248.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 972 ggcagcttctccttgatcttgtcca 948
>gb|AY349247.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 823 cttgtggccgccggggagcttctccttgatctt 791 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 978 ggcagcttctccttgatcttgtcca 954
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||||||||||||||||||||| Sbjct: 14760182 cttgttgccgccgggcagcttctccttgatctt 14760214 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||| ||||||||||||||||| Sbjct: 14766717 cttgttgccgccggggagcttctccttgatctt 14766749 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||||||||||||||||||||| |||| Sbjct: 14766555 gccgggcagcttctccttgatcttgtcca 14766583 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||||||||||||||||||||| |||| Sbjct: 14760014 gccgggcagcttctccttgatcttgtcca 14760042 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||| ||||||||||||||||| Sbjct: 14751745 cttgttgccgccggggagcttctccttgatctt 14751777 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||| ||||||||||||||||| Sbjct: 14744339 cttgttgccgccggggagcttctccttgatctt 14744371 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||| ||||||||||||||||| Sbjct: 14645822 cttgttgccgccggggagcttctccttgatctt 14645854 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||| ||||||||||||||||| |||| Sbjct: 14744159 gccggggagcttctccttgatcttgtcca 14744187 Score = 40.1 bits (20), Expect = 6.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 294 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 14766556 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 14766599 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Plus Query: 450 ccgggcagcttctccttgatcttttcca 477 ||||| ||||||||||||||||| |||| Sbjct: 14645646 ccggggagcttctccttgatcttctcca 14645673
>emb|X78431.1|TDDEH27 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd27e Length = 751 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 325 cttgtggccgccggggagcttctccttgatctt 293
>emb|X15290.1|HVDHN3 Zea mays mRNA for dehydrin (dhn1 gene) Length = 852 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||| ||||||||||||||||||||||| Sbjct: 422 cttgtggcctccgggcagcttctccttgatctt 390 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgatcttttcca 477 |||||||||||||| |||||||| |||| Sbjct: 589 ccgggcagcttctctttgatcttgtcca 562
>emb|X52422.1|OSRAB16B O.sativa DNA for rab 16B gene Length = 2890 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||||||||||||||||||||| Sbjct: 1808 cttgttgccgccgggcagcttctccttgatctt 1776 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||||||||||||||||||||| |||| Sbjct: 1976 gccgggcagcttctccttgatcttgtcca 1948
>gb|AF181459.1|AF181459 Hordeum vulgare dehydrin (Dhn9) gene, complete cds Length = 1791 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 988 cttgtggccgccggggagcttctccttgatctt 956 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 1143 ggcagcttctccttgatcttgtcca 1119
>dbj|AK063517.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-116-H03, full insert sequence Length = 872 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||||||||||||||||||||| Sbjct: 453 cttgttgccgccgggcagcttctccttgatctt 421 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||||||||||||||||||||| |||| Sbjct: 621 gccgggcagcttctccttgatcttgtcca 593
>gb|AF043094.1|AF043094 Hordeum vulgare dehydrin 9 (dhn9) gene, complete cds Length = 1630 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||||||||| ||||||||||||||||| Sbjct: 1048 cttgtggccgccggggagcttctccttgatctt 1016 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 1203 ggcagcttctccttgatcttgtcca 1179
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||||||||||||||||||||| Sbjct: 14840619 cttgttgccgccgggcagcttctccttgatctt 14840651 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||| ||||||||||||||||| Sbjct: 14847154 cttgttgccgccggggagcttctccttgatctt 14847186 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||||||||||||||||||||| |||| Sbjct: 14846992 gccgggcagcttctccttgatcttgtcca 14847020 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||||||||||||||||||||| |||| Sbjct: 14840451 gccgggcagcttctccttgatcttgtcca 14840479 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||| ||||||||||||||||| Sbjct: 14832182 cttgttgccgccggggagcttctccttgatctt 14832214 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||| ||||||||||||||||| Sbjct: 14824776 cttgttgccgccggggagcttctccttgatctt 14824808 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||| ||||||||||||||||| Sbjct: 14727823 cttgttgccgccggggagcttctccttgatctt 14727855 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||| ||||||||||||||||| |||| Sbjct: 14824596 gccggggagcttctccttgatcttgtcca 14824624 Score = 40.1 bits (20), Expect = 6.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 294 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 14846993 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 14847036 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Plus Query: 450 ccgggcagcttctccttgatcttttcca 477 ||||| ||||||||||||||||| |||| Sbjct: 14727647 ccggggagcttctccttgatcttctcca 14727674
>gb|U63831.1|SBU63831 Sorghum bicolor dehydrin (DHN2) mRNA, partial cds Length = 549 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||| ||||||||||||||||||||||| Sbjct: 175 cttgtggcctccgggcagcttctccttgatctt 143 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgatcttttcca 477 ||||||||||||||||||||||| |||| Sbjct: 312 ccgggcagcttctccttgatcttgtcca 285
>gb|U11696.1|SBU11696 Sorghum bicolor dehydrin (DHN1) mRNA, complete cds Length = 748 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatcttttc 475 ||||||| | |||||||||||||||||||||||||| Sbjct: 353 cttgtgggctccgggcagcttctccttgatcttttc 318 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgatcttttcca 477 ||||||||||||||||||||||| |||| Sbjct: 490 ccgggcagcttctccttgatcttgtcca 463
>gb|M93342.2|WHTCOAC Triticum aestivum cold acclimation protein WCS120 (WCS120) mRNA, complete cds Length = 1504 Score = 54.0 bits (27), Expect = 4e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||||||||| ||||||||||||||||| |||| Sbjct: 100 gtggccgccggggagcttctccttgatcttctcca 66
>gb|AF031247.1|AF031247 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-2) mRNA, complete cds Length = 1518 Score = 54.0 bits (27), Expect = 4e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||||||||| ||||||||||||||||| |||| Sbjct: 131 gtggccgccggggagcttctccttgatcttctcca 97 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgatcttttcca 477 ||||||| ||||| |||||||||||||| ||||||| Sbjct: 1083 tgtggccaccggggagcttctccttgatgttttcca 1048 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 1282 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 1242
>gb|AF181456.1|AF181456 Hordeum vulgare dehydrin (Dhn6) mRNA, complete cds Length = 1637 Score = 54.0 bits (27), Expect = 4e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||||||||| ||||||||||||||||| |||| Sbjct: 1474 gtggccgccggggagcttctccttgatcttctcca 1440 Score = 48.1 bits (24), Expect = 0.026 Identities = 36/40 (90%) Strand = Plus / Minus Query: 438 ttcttgtggccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||| || ||||||||||||||||| |||| Sbjct: 1302 ttcttgtgcccgccagggagcttctccttgatcttctcca 1263 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatctt 472 |||||||| ||||||||||||||||| Sbjct: 1149 ccgccggggagcttctccttgatctt 1124
>gb|AF181455.1|AF181455 Hordeum vulgare dehydrin (Dhn5) gene, complete cds Length = 3447 Score = 54.0 bits (27), Expect = 4e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||||||||| ||||||||||||||||| |||| Sbjct: 676 gtggccgccggggagcttctccttgatcttctcca 642 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| ||||| |||||||||||||| ||||||| Sbjct: 1921 gtggccaccggggagcttctccttgatgttttcca 1887 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 2313 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 2273 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 2114 tgtggccaccggggagcttctccttgat 2087
>gb|AF043091.1|AF043091 Hordeum vulgare dehydrin 6 (dhn6) gene, complete cds Length = 3086 Score = 54.0 bits (27), Expect = 4e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||||||||| ||||||||||||||||| |||| Sbjct: 2389 gtggccgccggggagcttctccttgatcttctcca 2355 Score = 44.1 bits (22), Expect = 0.41 Identities = 34/38 (89%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatcttttcca 477 |||||| ||||| || ||||||||||||||||| |||| Sbjct: 2215 cttgtgcccgccagggagcttctccttgatcttctcca 2178 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatctt 472 |||||||| ||||||||||||||||| Sbjct: 2064 ccgccggggagcttctccttgatctt 2039
>gb|AF058794.1|AF058794 Triticum aestivum COR39 (cor39) mRNA, complete cds Length = 1243 Score = 54.0 bits (27), Expect = 4e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||||||||| ||||||||||||||||| |||| Sbjct: 128 gtggccgccggggagcttctccttgatcttctcca 94 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 1213 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 1173
>gb|M95810.1|BLYDHN5 Hordeum vulgare dehydrin DHN5 (Dhn5) gene, complete cds Length = 2432 Score = 54.0 bits (27), Expect = 4e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||||||||| ||||||||||||||||| |||| Sbjct: 669 gtggccgccggggagcttctccttgatcttctcca 635 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| ||||| |||||||||||||| ||||||| Sbjct: 1914 gtggccaccggggagcttctccttgatgttttcca 1880 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 2306 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 2266 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 2107 tgtggccaccggggagcttctccttgat 2080
>gb|L27516.1|WHTWCS66X Triticum aestivum (Wcs66) gene, complete cds Length = 1629 Score = 54.0 bits (27), Expect = 4e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||||||||| ||||||||||||||||| |||| Sbjct: 154 gtggccgccggggagcttctccttgatcttctcca 120
>gb|AC146946.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0037B06 map near 50283S, complete sequence Length = 149398 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||| ||||||||||||||||| Sbjct: 88894 cttgttgccgccggggagcttctccttgatctt 88862 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgatcttttcca 477 ||||| ||||||||||||||||| |||| Sbjct: 89070 ccggggagcttctccttgatcttctcca 89043
>dbj|AK121952.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107K14, full insert sequence Length = 709 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||||||||||||||||||||| |||| Sbjct: 602 gccgggcagcttctccttgatcttgtcca 574 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||| ||||||||||||||||| Sbjct: 440 cttgttgccgccggggagcttctccttgatctt 408
>emb|Y00842.1|OSRAB21 Rice rab21 gene for water-stress inducible protein RAB21 Length = 2537 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||||||||||||||||||||| |||| Sbjct: 2164 gccgggcagcttctccttgatcttgtcca 2136 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||| ||||||||||||||||| Sbjct: 1972 cttgttgccgccggggagcttctccttgatctt 1940 Score = 40.1 bits (20), Expect = 6.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 294 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 2163 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 2120
>emb|X15994.1|ZMRAB17G Maize RAB-17 gene Length = 1986 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||| |||||||||||||| |||||||| Sbjct: 1120 cttgtggcctccgggcagcttctctttgatctt 1088 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgatcttttcca 477 ||||||||||||||||||||||| |||| Sbjct: 1287 ccgggcagcttctccttgatcttgtcca 1260
>emb|X52424.1|OSRAB16D O.sativa DNA for rab 16D gene Length = 2459 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||| ||||||||||||||||| Sbjct: 1338 cttgttgccgccggggagcttctccttgatctt 1306 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||| ||||||||||||||||| |||| Sbjct: 1518 gccggggagcttctccttgatcttgtcca 1490
>emb|X52423.1|OSRAB16C O.sativa DNA for rab 16C gene Length = 2493 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||| ||||||||||||||||| Sbjct: 1873 cttgttgccgccggggagcttctccttgatctt 1841
>emb|X59133.1|TARAB T.aestivum L. mRNA for an ABA responsive gene, rab Length = 781 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||| ||||| ||||||||||||||||| Sbjct: 294 cttgtggccaccggggagcttctccttgatctt 262 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 461 ggcagcttctccttgatcttgtcca 437
>gb|U60097.2|OSU60097 Oryza sativa dehydrin mRNA, complete cds Length = 864 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||||||||||||||||||||| |||| Sbjct: 573 gccgggcagcttctccttgatcttgtcca 545 Score = 40.1 bits (20), Expect = 6.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 294 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 572 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 529
>dbj|AK071366.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096D05, full insert sequence Length = 795 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||||||||| ||||||||||||||||| Sbjct: 390 cttgttgccgccggggagcttctccttgatctt 358
>gb|AY104757.1| Zea mays PCO142314 mRNA sequence Length = 899 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||||||| |||||||||||||| |||||||| Sbjct: 419 cttgtggcctccgggcagcttctctttgatctt 387 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgatcttttcca 477 |||||||||||||| |||||||| |||| Sbjct: 586 ccgggcagcttctctttgatcttgtcca 559
>gb|AY389583.1| Hyacinthus orientalis dehydrin mRNA, partial cds Length = 729 Score = 48.1 bits (24), Expect = 0.026 Identities = 30/32 (93%) Strand = Plus / Minus Query: 438 ttcttgtggccgccgggcagcttctccttgat 469 ||||||||||| || ||||||||||||||||| Sbjct: 427 ttcttgtggccacccggcagcttctccttgat 396
>gb|DQ487112.1| Panax ginseng dehydrin 7 (Dhn7) mRNA, complete cds Length = 1057 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgatcttttcca 477 ||||||||||||||||| |||||||||| Sbjct: 677 ccgggcagcttctccttaatcttttcca 650
>gb|DQ487110.1| Panax ginseng dehydrin 5 (Dhn5) mRNA, complete cds Length = 853 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgatcttttcca 477 ||||||||||||||||||||||| |||| Sbjct: 536 ccgggcagcttctccttgatcttctcca 509
>gb|DQ487106.1| Panax ginseng dehydrin 1 (Dhn1) mRNA, complete cds Length = 1028 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgatcttttcca 477 ||||||||||||||||| |||||||||| Sbjct: 690 ccgggcagcttctccttaatcttttcca 663
>gb|AY243045.1| Boea crassifolia dehydrin-like protein Dh2 mRNA, complete cds Length = 697 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 441 ttgtggccgccgggcagcttctccttga 468 |||||||||||||| ||||||||||||| Sbjct: 362 ttgtggccgccgggtagcttctccttga 335
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 355 tcacctcctcggcggccggcgcaggcgc 382 |||||||||||||||||||||| ||||| Sbjct: 18517274 tcacctcctcggcggccggcgccggcgc 18517247
>gb|AF031248.1|AF031248 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-3) mRNA, complete cds Length = 793 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgatcttttcca 477 ||||||||||||||||||||||| |||| Sbjct: 473 ccgggcagcttctccttgatcttgtcca 446 Score = 40.1 bits (20), Expect = 6.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 294 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 473 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 430
>emb|X78429.1|TDDEH16 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd16 Length = 814 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgatcttttcca 477 ||||||||||||||||||||||| |||| Sbjct: 505 ccgggcagcttctccttgatcttgtcca 478 Score = 40.1 bits (20), Expect = 6.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 294 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 505 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 462
>emb|X15287.1|HVDHN18 Barley mRNA for dehydrin (dhn18) Length = 1049 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgatcttttcca 477 ||||||||||||||||||||||| |||| Sbjct: 742 ccgggcagcttctccttgatcttgtcca 715 Score = 40.1 bits (20), Expect = 6.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 294 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 742 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 699
>emb|X15286.1|HVDHN17 Barley mRNA for dehydrin (dhn17) Length = 812 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgatcttttcca 477 ||||||||||||||||||||||| |||| Sbjct: 535 ccgggcagcttctccttgatcttgtcca 508 Score = 44.1 bits (22), Expect = 0.41 Identities = 28/30 (93%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatctt 472 |||||| ||||| ||||||||||||||||| Sbjct: 332 gtggccaccggggagcttctccttgatctt 303 Score = 40.1 bits (20), Expect = 6.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 294 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 535 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 492
>dbj|AK073885.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033073G16, full insert sequence Length = 976 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 355 tcacctcctcggcggccggcgcaggcgc 382 |||||||||||||||||||||| ||||| Sbjct: 526 tcacctcctcggcggccggcgccggcgc 499
>gb|AF181453.1|AF181453 Hordeum vulgare dehydrin (Dhn3) gene, complete cds Length = 1575 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgatcttttcca 477 ||||||||||||||||||||||| |||| Sbjct: 1350 ccgggcagcttctccttgatcttgtcca 1323 Score = 44.1 bits (22), Expect = 0.41 Identities = 28/30 (93%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatctt 472 |||||| ||||| ||||||||||||||||| Sbjct: 1147 gtggccaccggggagcttctccttgatctt 1118 Score = 40.1 bits (20), Expect = 6.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 294 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 1350 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 1307
>gb|AF155129.1|AF155129 Hordeum vulgare dehydrin 12 (Dhn12) gene, complete cds Length = 2890 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgatcttttcca 477 ||||||||||||||||||||||| |||| Sbjct: 1885 ccgggcagcttctccttgatcttgtcca 1858
>gb|AF043089.1|AF043089 Hordeum vulgare dehydrin 3 (dhn3) gene, complete cds Length = 1560 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgatcttttcca 477 ||||||||||||||||||||||| |||| Sbjct: 1313 ccgggcagcttctccttgatcttgtcca 1286 Score = 44.1 bits (22), Expect = 0.41 Identities = 28/30 (93%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatctt 472 |||||| ||||| ||||||||||||||||| Sbjct: 1110 gtggccaccggggagcttctccttgatctt 1081 Score = 40.1 bits (20), Expect = 6.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 294 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 1313 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 1270
>emb|AL808127.4| Mouse DNA sequence from clone RP23-263L18 on chromosome 2, complete sequence Length = 205838 Score = 48.1 bits (24), Expect = 0.026 Identities = 24/24 (100%) Strand = Plus / Plus Query: 34 ctgactctggaccaaactgaagcc 57 |||||||||||||||||||||||| Sbjct: 138293 ctgactctggaccaaactgaagcc 138316
>gb|AY706990.1| Vitis vinifera dehydrin 1b (DHN1b) gene, complete cds, alternatively spliced Length = 1296 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| || |||||||||||||||||||| |||| Sbjct: 610 gtggcccccaggcagcttctccttgatcttctcca 576
>gb|AY706989.1| Vitis vinifera dehydrin 1a (DHN1a) gene, complete cds, alternatively spliced Length = 845 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| || |||||||||||||||||||| |||| Sbjct: 624 gtggcccccaggcagcttctccttgatcttctcca 590
>gb|AY706988.1| Vitis riparia dehydrin 1b (DHN1b) gene, partial sequence Length = 1296 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| || |||||||||||||||||||| |||| Sbjct: 610 gtggcccccaggcagcttctccttgatcttctcca 576
>gb|AY349246.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| ||||| |||||||||||||| ||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttcca 565 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349244.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| ||||| |||||||||||||| ||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttcca 565 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349243.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| ||||| |||||||||||||| ||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttcca 565 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349241.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| ||||| |||||||||||||| ||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttcca 565 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349239.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| ||||| |||||||||||||| ||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttcca 565 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349238.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| ||||| |||||||||||||| ||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttcca 565 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349234.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| ||||| |||||||||||||| ||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttcca 565 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349233.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| ||||| |||||||||||||| ||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttcca 565 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349232.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| ||||| |||||||||||||| ||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttcca 565 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349231.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| ||||| |||||||||||||| ||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttcca 565 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349229.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| ||||| |||||||||||||| ||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttcca 565 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349228.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| ||||| |||||||||||||| ||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttcca 565 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349227.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| ||||| |||||||||||||| ||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttcca 565 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349224.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| ||||| |||||||||||||| ||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttcca 565 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349222.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| ||||| |||||||||||||| ||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttcca 565 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349221.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| ||||| |||||||||||||| ||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttcca 565 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY634281.1| Vitis vinifera dehydrin mRNA, complete cds Length = 876 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| || |||||||||||||||||||| |||| Sbjct: 456 gtggcccccaggcagcttctccttgatcttctcca 422
>gb|AF190474.2|AF190474 Boea crassifolia bdn1 (bdn1) mRNA, partial cds Length = 756 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 446 gccgccgggcagcttctccttgatctt 472 ||||||||| ||||||||||||||||| Sbjct: 570 gccgccgggtagcttctccttgatctt 544
>emb|X71362.1|HVDHN7 H.vulgare gene for dehydrin 7 Length = 2138 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 1510 ccgccgggaagcttctccttgatcttgtcca 1480
>emb|X15289.1|HVDHN9 Barley mRNA for dehydrin (dhn9) Length = 683 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 477 ccgccgggaagcttctccttgatcttgtcca 447
>emb|X15288.1|HVDHN8 Barley mRNA for dehydrin (dhn8) Length = 683 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 483 ccgccgggaagcttctccttgatcttgtcca 453
>emb|X98326.1|HVDEHYDRN H.vulgare mRNA for dehydrin Length = 671 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 472 ccgccgggaagcttctccttgatcttgtcca 442
>gb|AF181452.1|AF181452 Hordeum vulgare dehydrin (Dhn2) gene, complete cds Length = 1294 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 1170 ccgccgggaagcttctccttgatcttgtcca 1140
>gb|AF181451.1|AF181451 Hordeum vulgare dehydrin (Dhn1) mRNA, complete cds Length = 512 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 437 ccgccgggaagcttctccttgatcttgtcca 407
>gb|AY895879.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 1 (Dhn1) gene, partial cds Length = 1446 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtcca 461
>gb|AY895878.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin 1 (Dhn1) gene, partial cds Length = 1268 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtcca 461
>gb|AY895877.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 1 (Dhn1) gene, partial cds Length = 1268 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtcca 461
>gb|AY895876.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 1 (Dhn1) gene, partial cds Length = 1291 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtcca 461
>gb|AY895875.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 1 (Dhn1) gene, partial cds Length = 1268 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtcca 461
>gb|AY895874.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 1 (Dhn1) gene, partial cds Length = 1249 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtcca 461
>gb|AY895873.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420913 dehydrin 1 (Dhn1) gene, partial cds Length = 1202 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtcca 461
>gb|AY895872.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 1 (Dhn1) gene, partial cds Length = 1268 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtcca 461
>gb|AY895871.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 406276 dehydrin 1 (Dhn1) gene, partial cds Length = 1330 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 485 ccgccgggaagcttctccttgatcttgtcca 455
>gb|AY895870.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401371 dehydrin 1 (Dhn1) gene, partial cds Length = 1428 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtcca 461
>gb|AY895869.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtcca 461
>gb|AY895868.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 366446 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtcca 461
>gb|AY895867.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 296926 dehydrin 1 (Dhn1) gene, partial cds Length = 1417 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 485 ccgccgggaagcttctccttgatcttgtcca 455
>gb|AY895866.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 dehydrin 1 (Dhn1) gene, partial cds Length = 1428 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtcca 461
>gb|AY895865.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293409 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 485 ccgccgggaagcttctccttgatcttgtcca 455
>gb|AY895864.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 dehydrin 1 (Dhn1) gene, partial cds Length = 1230 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtcca 461
>gb|AY895863.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtcca 461
>gb|AY895862.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 254894 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtcca 461
>gb|AY895861.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 253933 dehydrin 1 (Dhn1) gene, partial cds Length = 1243 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 495 ccgccgggaagcttctccttgatcttgtcca 465
>gb|AY895860.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 dehydrin 1 (Dhn1) gene, partial cds Length = 1249 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtcca 461
>gb|AY895859.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 219796 dehydrin 1 (Dhn1) gene, partial cds Length = 1243 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 495 ccgccgggaagcttctccttgatcttgtcca 465
>gb|AY895858.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtcca 461
>gb|AY895857.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212305 dehydrin 1 (Dhn1) gene, partial cds Length = 1249 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtcca 461
>gb|AF043096.1|AF043096 Hordeum vulgare dehydrin 5 (dhn5) gene, complete cds Length = 2814 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||| ||||| |||||||||||||| ||||||| Sbjct: 1919 gtggccaccggggagcttctccttgatgttttcca 1885 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatcttttcca 477 |||||||||||| || |||||||||||||| |||| Sbjct: 674 gtggccgccggggagtttctccttgatcttctcca 640 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 2311 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 2271 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 2112 tgtggccaccggggagcttctccttgat 2085
>gb|AF043088.1|AF043088 Hordeum vulgare dehydrin 2 (dhn2) gene, complete cds Length = 1849 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 1178 ccgccgggaagcttctccttgatcttgtcca 1148
>gb|AF043087.1|AF043087 Hordeum vulgare dehydrin 1 (dhn1) gene, complete cds Length = 2717 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 |||||||| ||||||||||||||||| |||| Sbjct: 1767 ccgccgggaagcttctccttgatcttgtcca 1737
>dbj|AB010898.1| Daucus carota mRNA for ecpp44, complete cds Length = 925 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatcttttcca 477 ||||| |||||||||||||||||||| |||| Sbjct: 544 ccgcctggcagcttctccttgatcttctcca 514
>gb|AY737725.1| Salvia miltiorrhiza dehydrin mRNA, partial cds Length = 864 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttccaa 478 |||||||||||||||||||| ||||| Sbjct: 673 ggcagcttctccttgatcttatccaa 648
>gb|AY695932.1| Salvia miltiorrhiza dehydration protein (bdn1) mRNA, complete cds Length = 969 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttccaa 478 |||||||||||||||||||| ||||| Sbjct: 660 ggcagcttctccttgatcttatccaa 635
>gb|AY619566.1| Triticum turgidum subsp. durum dehydrin mRNA, complete cds Length = 1124 Score = 44.1 bits (22), Expect = 0.41 Identities = 28/30 (93%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatctt 472 |||||| ||||| ||||||||||||||||| Sbjct: 366 gtggccaccggggagcttctccttgatctt 337
>emb|X74067.1|CPCDET619 Craterostigma plantagineum CDeT6-19 gene for dessication-related protein Length = 1742 Score = 44.1 bits (22), Expect = 0.41 Identities = 31/34 (91%) Strand = Plus / Minus Query: 444 tggccgccgggcagcttctccttgatcttttcca 477 ||||||||||| |||||||| |||||||| |||| Sbjct: 1529 tggccgccgggaagcttctctttgatcttgtcca 1496 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 444 tggccgccgggcagcttctccttgatctt 472 ||||||||||| ||||||||||| ||||| Sbjct: 1415 tggccgccgggaagcttctccttcatctt 1387
>gb|M62988.1|CRTDESRSB Craterostigma plantagineum dessication-related protein mRNA, complete cds Length = 741 Score = 44.1 bits (22), Expect = 0.41 Identities = 31/34 (91%) Strand = Plus / Minus Query: 444 tggccgccgggcagcttctccttgatcttttcca 477 ||||||||||| |||||||| |||||||| |||| Sbjct: 528 tggccgccgggaagcttctctttgatcttgtcca 495 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 444 tggccgccgggcagcttctccttgatctt 472 ||||||||||| ||||||||||| ||||| Sbjct: 414 tggccgccgggaagcttctccttcatctt 386
>gb|AF236067.1|AF236067 Elaeis guineensis clone pKT5 dehydrin-like protein mRNA, complete cds Length = 775 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 456 agcttctccttgatcttttcca 477 |||||||||||||||||||||| Sbjct: 462 agcttctccttgatcttttcca 441
>emb|X62476.1|TARAB15B T.aestivum rab15B mRNA Length = 1068 Score = 44.1 bits (22), Expect = 0.41 Identities = 28/30 (93%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatctt 472 |||||| ||||| ||||||||||||||||| Sbjct: 351 gtggccaccggggagcttctccttgatctt 322
>gb|AY895927.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 7 (Dhn7) gene, complete cds Length = 1357 Score = 44.1 bits (22), Expect = 0.41 Identities = 28/30 (93%) Strand = Plus / Minus Query: 443 gtggccgccgggcagcttctccttgatctt 472 |||||| ||||| ||||||||||||||||| Sbjct: 583 gtggccaccggggagcttctccttgatctt 554 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 828 ccgggcagcttctccttgat 809
>dbj|AB090885.1| Aster tripolium mRNA for dehydrin, complete cds Length = 979 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 447 ccgccgggcagcttctccttgatctt 472 |||||||| ||||||||||||||||| Sbjct: 507 ccgccgggtagcttctccttgatctt 482
>gb|AY823548.1| Pennisetum glaucum putative RAB protein mRNA, complete cds Length = 616 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| ||| ||||| ||||||||||||||||| Sbjct: 348 cttgttgcctccggggagcttctccttgatctt 316 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgatcttttcca 477 ||||| ||||||||||||||||| |||| Sbjct: 491 ccgggaagcttctccttgatcttgtcca 464
>gb|AY465376.1| Prunus persica dehydrin 2 mRNA, complete cds Length = 829 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 544 ggcagcttctccttgatcttgtcca 520
>ref|NM_192219.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 687 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||| ||||||||||||||||| |||| Sbjct: 672 gccggggagcttctccttgatcttctcca 644 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 |||||||| |||||| ||||||||||| ||||| Sbjct: 543 cttgtggctgccgggaagcttctcctttatctt 511
>ref|NM_192777.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1419 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 358 cctcctcggcggccggcgcaggcgc 382 |||||||||||||||||| |||||| Sbjct: 349 cctcctcggcggccggcgaaggcgc 325
>gb|AC102686.7| Mus musculus chromosome 1, clone RP24-467J24, complete sequence Length = 156547 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 acccaaactgaacacaagcat 83 ||||||||||||||||||||| Sbjct: 134241 acccaaactgaacacaagcat 134261
>gb|AY706987.1| Vitis riparia dehydrin 1a (DHN1a) gene, complete cds, alternatively spliced Length = 1324 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 614 ggcagcttctccttgatcttctcca 590
>gb|AF172263.1| Prunus dulcis abscisic acid response protein (rab21) mRNA, complete cds Length = 897 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 538 ggcagcttctccttgatcttgtcca 514
>gb|AY349245.1| Hordeum vulgare subsp. spontaneum NPGS PI 560556 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349242.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccgggaagcttctccttgat 765
>gb|AY349240.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349237.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccgggaagcttctccttgat 765
>gb|AY349236.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 5 (Dhn5) gene, partial cds Length = 446 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 388 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 348 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 183 tgtggccaccgggaagcttctccttgat 156
>gb|AY349235.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 5 (Dhn5) gene, partial cds Length = 446 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 388 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 348 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 183 tgtggccaccgggaagcttctccttgat 156
>gb|AY349230.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 dehydrin 5 (Dhn5) gene, partial cds Length = 1061 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 1003 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 963 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccgggaagcttctccttgat 765
>gb|AY349226.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 5 (Dhn5) gene, partial cds Length = 446 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 388 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 348 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 183 tgtggccaccgggaagcttctccttgat 156
>gb|AY349225.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 5 (Dhn5) gene, partial cds Length = 446 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 388 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 348 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 183 tgtggccaccgggaagcttctccttgat 156
>gb|AY349223.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccgggaagcttctccttgat 765
>gb|AY349220.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 297 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 337 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 442 tgtggccgccgggcagcttctccttgat 469 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccgggaagcttctccttgat 765
>gb|AY333185.1| Oryza sativa (japonica cultivar-group) drought-resistant protein mRNA, complete cds Length = 1021 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||| ||||||||||||||||| |||| Sbjct: 761 gccggggagcttctccttgatcttctcca 733 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 |||||||| |||||| ||||||||||| ||||| Sbjct: 632 cttgtggctgccgggaagcttctcctttatctt 600
>emb|AL138725.19| Human DNA sequence from clone RP11-528A10 on chromosome 6 Contains an IMPDH1 (IMP (inosine monophosphate) dehydrogenase 1) pseudogene, an RNA helicase pseudogene and part of a novel gene similar to KIAA0161, complete sequence Length = 165653 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 315 ttgcccagtaggcccttcttc 335 ||||||||||||||||||||| Sbjct: 48697 ttgcccagtaggcccttcttc 48717
>gb|AC036101.6| Homo sapiens chromosome 10 clone RP11-71J2, complete sequence Length = 175492 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 457 gcttctccttgatcttttcca 477 ||||||||||||||||||||| Sbjct: 115635 gcttctccttgatcttttcca 115615
>gb|M62987.1|CRTDESRSA Craterostigma plantagineum dessication-related protein mRNA, complete cds Length = 634 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||| ||||||||||||||||| |||| Sbjct: 406 gccggggagcttctccttgatcttctcca 378
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||| ||||||||||||||||| |||| Sbjct: 29117639 gccggggagcttctccttgatcttctcca 29117611 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 |||||||| |||||| ||||||||||| ||||| Sbjct: 29117510 cttgtggctgccgggaagcttctcctttatctt 29117478 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 358 cctcctcggcggccggcgcaggcgc 382 |||||||||||||||||| |||||| Sbjct: 24360655 cctcctcggcggccggcgaaggcgc 24360631 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 307 ccatgatcttgcccagtagg 326 |||||||||||||||||||| Sbjct: 42400771 ccatgatcttgcccagtagg 42400752
>gb|DQ015701.1| Ovis aries endothelial nitric oxide synthase mRNA, complete cds Length = 4097 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 256 gggcggcggccttgtcctcctcccc 280 |||||||||||||| |||||||||| Sbjct: 2195 gggcggcggccttggcctcctcccc 2171
>dbj|AP003245.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0421H07 Length = 158126 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||| ||||||||||||||||| |||| Sbjct: 78005 gccggggagcttctccttgatcttctcca 77977 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 |||||||| |||||| ||||||||||| ||||| Sbjct: 77876 cttgtggctgccgggaagcttctcctttatctt 77844
>dbj|AB058947.1| Streptomyces albulus plasmid pNO33 DNA, complete sequence Length = 36955 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 429 tcctccggcttcttgtggccgccgg 453 |||||||||||||||| |||||||| Sbjct: 11860 tcctccggcttcttgtcgccgccgg 11836
>dbj|AP002866.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0410E01 Length = 166753 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 358 cctcctcggcggccggcgcaggcgc 382 |||||||||||||||||| |||||| Sbjct: 106559 cctcctcggcggccggcgaaggcgc 106535
>gb|AF220407.1|AF220407 Vitis riparia dehydrin-like protein (Dhn) mRNA, complete cds Length = 761 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcca 477 |||||||||||||||||||| |||| Sbjct: 468 ggcagcttctccttgatcttctcca 444
>emb|X57327.1|OSRAB25 Rice rab25 mRNA Length = 920 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||| ||||||||||||||||| |||| Sbjct: 732 gccggggagcttctccttgatcttctcca 704 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 |||||||| |||||| ||||||||||| ||||| Sbjct: 603 cttgtggctgccgggaagcttctcctttatctt 571
>dbj|AK109096.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-155-A09, full insert sequence Length = 852 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||| ||||||||||||||||| |||| Sbjct: 552 gccggggagcttctccttgatcttgtcca 524 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 ||||| |||||| || ||||||||||||||||| Sbjct: 372 cttgttgccgcctgggagcttctccttgatctt 340
>dbj|AK105551.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-128-A11, full insert sequence Length = 1509 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 358 cctcctcggcggccggcgcaggcgc 382 |||||||||||||||||| |||||| Sbjct: 399 cctcctcggcggccggcgaaggcgc 375
>dbj|AK063691.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-F09, full insert sequence Length = 761 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 449 gccgggcagcttctccttgatcttttcca 477 |||||| ||||||||||||||||| |||| Sbjct: 553 gccggggagcttctccttgatcttctcca 525 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 440 cttgtggccgccgggcagcttctccttgatctt 472 |||||||| |||||| ||||||||||| ||||| Sbjct: 424 cttgtggctgccgggaagcttctcctttatctt 392
>gb|AY105409.1| Zea mays PCO095801 mRNA sequence Length = 741 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 355 tcacctcctcggcggccggcg 375 ||||||||||||||||||||| Sbjct: 215 tcacctcctcggcggccggcg 235
>gb|M99057.1|BOVNIOXSY Bovine nitric oxide synthase mRNA, complete cds Length = 4096 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 256 gggcggcggccttgtcctcctcccc 280 |||||||||||||| |||||||||| Sbjct: 2196 gggcggcggccttggcctcctcccc 2172
>gb|M89952.1|BOVECNOS Bos taurus endothelial nitric oxide synthase mRNA, complete cds Length = 3738 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 256 gggcggcggccttgtcctcctcccc 280 |||||||||||||| |||||||||| Sbjct: 2186 gggcggcggccttggcctcctcccc 2162
>ref|NM_197772.1| Oryza sativa (japonica cultivar-group) putative nucleic acid binding protein (OSJNBa0027P10.5), mRNA Length = 1377 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 358 cctcctcggcggccggcgcaggcg 381 ||||||||||||||||||| |||| Sbjct: 79 cctcctcggcggccggcgcgggcg 56
>gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, complete sequence Length = 574126 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 cggcggccttgtcctcctcc 278 |||||||||||||||||||| Sbjct: 72754 cggcggccttgtcctcctcc 72735
>gb|AC164098.4| Mus musculus BAC clone RP23-341D24 from chromosome 1, complete sequence Length = 221754 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 1 aataagcaaataaacttaaa 20 |||||||||||||||||||| Sbjct: 153660 aataagcaaataaacttaaa 153679
>ref|XM_760938.1| Theileria parva strain Muguga chromosome 1 hypothetical protein (TP01_0511) partial mRNA Length = 5448 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 8 aaataaacttaaacaacatc 27 |||||||||||||||||||| Sbjct: 4865 aaataaacttaaacaacatc 4884
>gb|AE005809.1| Caulobacter crescentus CB15 section 135 of 359 of the complete genome Length = 10696 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 364 cggcggccggcgcaggcgcg 383 |||||||||||||||||||| Sbjct: 6577 cggcggccggcgcaggcgcg 6596
>gb|CP000282.1| Saccharophagus degradans 2-40, complete genome Length = 5057531 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 375 gcaggcgcgtgcactggcgc 394 |||||||||||||||||||| Sbjct: 3181618 gcaggcgcgtgcactggcgc 3181599
>gb|AE012230.1| Xanthomonas campestris pv. campestris str. ATCC 33913, section 138 of 460 of the complete genome Length = 10813 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 380 cgcgtgcactggcgctggag 399 |||||||||||||||||||| Sbjct: 10209 cgcgtgcactggcgctggag 10190
>gb|AF453444.1|AF453444 Triticum aestivum dehydrin WZY1-1 mRNA, complete cds Length = 483 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgatcttttcca 477 ||||||||||| ||||||||||| |||| Sbjct: 473 ccgggcagcttttccttgatcttgtcca 446
>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome Length = 3561584 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 446 gccgccgggcagcttctcct 465 |||||||||||||||||||| Sbjct: 1109219 gccgccgggcagcttctcct 1109200
>gb|AC084763.4| Oryza sativa chromosome 10 BAC OSJNBa0027P10 genomic sequence, complete sequence Length = 141307 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 358 cctcctcggcggccggcgcaggcg 381 ||||||||||||||||||| |||| Sbjct: 69746 cctcctcggcggccggcgcgggcg 69723
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome Length = 5148708 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 380 cgcgtgcactggcgctggag 399 |||||||||||||||||||| Sbjct: 3509653 cgcgtgcactggcgctggag 3509672
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 358 cctcctcggcggccggcgcaggcg 381 ||||||||||||||||||| |||| Sbjct: 21755063 cctcctcggcggccggcgcgggcg 21755040
>dbj|AP003263.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0483G10 Length = 190721 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 307 ccatgatcttgcccagtagg 326 |||||||||||||||||||| Sbjct: 60109 ccatgatcttgcccagtagg 60090
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 350 gctgctcacctcctcggcgg 369 |||||||||||||||||||| Sbjct: 7122494 gctgctcacctcctcggcgg 7122475
>dbj|AB105039.1| Daucus carota CAISE1 mRNA for dehydrin protein, complete cds Length = 771 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 293 accgggcagcttgtccatgatctt 316 |||||||||||||||| ||||||| Sbjct: 506 accgggcagcttgtccttgatctt 483 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgatcttttcca 477 ||||||||||| ||||||||||| |||| Sbjct: 505 ccgggcagcttgtccttgatcttatcca 478
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 329 cttcttctccttcgcgtccgggct 352 |||||||||||||||| ||||||| Sbjct: 4529751 cttcttctccttcgcggccgggct 4529728
>dbj|BS000095.1| Pan troglodytes chromosome 22 clone:RP43-177D07, map 22, complete sequences Length = 181678 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 28 caggacctgactctggaccaaactgaag 55 |||||| ||||||||||||| ||||||| Sbjct: 3276 caggacttgactctggaccagactgaag 3249
>dbj|BS000094.1| Pan troglodytes chromosome 22 clone:PTB-240N13, map 22, complete sequences Length = 155513 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 28 caggacctgactctggaccaaactgaag 55 |||||| ||||||||||||| ||||||| Sbjct: 131204 caggacttgactctggaccagactgaag 131177
>dbj|AB126059.1| Codonopsis lanceolata mRNA for dehydrin 1, complete cds Length = 813 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 453 ggcagcttctccttgatcttttcc 476 ||||||||||||||||| |||||| Sbjct: 422 ggcagcttctccttgattttttcc 399
>gb|AF181457.1|AF181457 Hordeum vulgare dehydrin (Dhn7) mRNA, complete cds Length = 654 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 577 ccgggcagcttctccttgat 558
>gb|AC140483.3| Mus musculus BAC clone RP24-145A22 from 1, complete sequence Length = 176649 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 aataagcaaataaacttaaa 20 |||||||||||||||||||| Sbjct: 121495 aataagcaaataaacttaaa 121476
>gb|AY895931.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 560559 dehydrin 7 (Dhn7) gene, complete cds Length = 1371 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 844 ccgggcagcttctccttgat 825
>gb|AY895930.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 7 (Dhn7) gene, complete cds Length = 1370 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 841 ccgggcagcttctccttgat 822
>gb|AY895929.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin 7 (Dhn7) gene, complete cds Length = 1370 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 841 ccgggcagcttctccttgat 822
>gb|AY895928.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 7 (Dhn7) gene, complete cds Length = 1332 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 803 ccgggcagcttctccttgat 784
>gb|AY895926.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 7 (Dhn7) gene, complete cds Length = 1370 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 841 ccgggcagcttctccttgat 822
>gb|AY895925.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 7 (Dhn7) gene, complete cds Length = 1373 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 844 ccgggcagcttctccttgat 825
>gb|AY895924.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420913 dehydrin 7 (Dhn7) gene, complete cds Length = 1375 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 846 ccgggcagcttctccttgat 827
>gb|AY895923.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 7 (Dhn7) gene, complete cds Length = 1364 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 837 ccgggcagcttctccttgat 818
>gb|AY895922.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 7 (Dhn7) gene, complete cds Length = 1364 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 837 ccgggcagcttctccttgat 818
>gb|AY895921.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 406276 dehydrin 7 (Dhn7) gene, complete cds Length = 1373 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 844 ccgggcagcttctccttgat 825
>gb|AY895920.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401371 dehydrin 7 (Dhn7) gene, complete cds Length = 1363 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 834 ccgggcagcttctccttgat 815
>gb|AY895919.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 dehydrin 7 (Dhn7) gene, complete cds Length = 1366 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 837 ccgggcagcttctccttgat 818
>gb|AY895918.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 366446 dehydrin 7 (Dhn7) gene, complete cds Length = 1343 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 814 ccgggcagcttctccttgat 795
>gb|AY895917.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 296926 dehydrin 7 (Dhn7) gene, complete cds Length = 1370 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 841 ccgggcagcttctccttgat 822
>gb|AY895916.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 dehydrin 7 (Dhn7) gene, complete cds Length = 1343 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 814 ccgggcagcttctccttgat 795
>gb|AY895915.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293409 dehydrin 7 (Dhn7) gene, complete cds Length = 1366 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 837 ccgggcagcttctccttgat 818
>gb|AY895914.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 dehydrin 7 (Dhn7) gene, complete cds Length = 1366 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 837 ccgggcagcttctccttgat 818
>gb|AY895913.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 7 (Dhn7) gene, complete cds Length = 1344 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 815 ccgggcagcttctccttgat 796
>gb|AY895912.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 7 (Dhn7) gene, complete cds Length = 1343 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 814 ccgggcagcttctccttgat 795
>gb|AY895911.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 254894 dehydrin 7 (Dhn7) gene, complete cds Length = 1343 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 814 ccgggcagcttctccttgat 795
>gb|AY895910.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 253933 dehydrin 7 (Dhn7) gene, complete cds Length = 1363 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 834 ccgggcagcttctccttgat 815
>gb|AY895909.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 236388 dehydrin 7 (Dhn7) gene, complete cds Length = 1369 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 840 ccgggcagcttctccttgat 821
>gb|AY895908.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 dehydrin 7 (Dhn7) gene, complete cds Length = 1337 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 810 ccgggcagcttctccttgat 791
>gb|AY895907.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 219796 dehydrin 7 (Dhn7) gene, complete cds Length = 1343 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 814 ccgggcagcttctccttgat 795
>gb|AY895906.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 dehydrin 7 (Dhn7) gene, complete cds Length = 1342 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 814 ccgggcagcttctccttgat 795
>gb|AY895905.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212305 dehydrin 7 (Dhn7) gene, complete cds Length = 1363 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 834 ccgggcagcttctccttgat 815
>gb|AF043092.1|AF043092 Hordeum vulgare dehydrin 7 (dhn7) gene, complete cds Length = 2127 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 ccgggcagcttctccttgat 469 |||||||||||||||||||| Sbjct: 1170 ccgggcagcttctccttgat 1151
>dbj|AP001690.1| Homo sapiens genomic DNA, chromosome 21q, section 34/105 Length = 340000 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 28 caggacctgactctggaccaaactgaag 55 |||||| ||||||||||||| ||||||| Sbjct: 80688 caggacttgactctggaccagactgaag 80661
>dbj|AP000469.3| Homo sapiens genomic DNA, chromosome 21q, clone:RP11-132H24, complete sequence Length = 136804 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 28 caggacctgactctggaccaaactgaag 55 |||||| ||||||||||||| ||||||| Sbjct: 102805 caggacttgactctggaccagactgaag 102778
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 358 cctcctcggcggccggcgcaggcg 381 ||||||||||||||||||| |||| Sbjct: 21766726 cctcctcggcggccggcgcgggcg 21766703 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,993,582 Number of Sequences: 3902068 Number of extensions: 3993582 Number of successful extensions: 93072 Number of sequences better than 10.0: 241 Number of HSP's better than 10.0 without gapping: 243 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 91603 Number of HSP's gapped (non-prelim): 1448 length of query: 478 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 456 effective length of database: 17,147,199,772 effective search space: 7819123096032 effective search space used: 7819123096032 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
