>gb|AC108773.9| Mus musculus chromosome 5, clone RP23-118L1, complete sequence
          Length = 222706

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   cctcactatcttattcagtt 193
             ||||||||||||||||||||
Sbjct: 36122 cctcactatcttattcagtt 36103

>emb|AL596132.7| Human DNA sequence from clone RP11-30A1 on chromosome 9 Contains part
             of the NTRK2 gene for Neurotrophic tyrosine kinase,
             receptor, type 2 (TRKB), complete sequence
          Length = 124156

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 264   cacctaggccttggccccaa 283
             ||||||||||||||||||||
Sbjct: 23969 cacctaggccttggccccaa 23950

>gb|AC126471.4| Homo sapiens 12 BAC RP11-629O19 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 199945

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 26     aatcaacttttttgtacaaaagca 49
              ||||||| ||||||||||||||||
Sbjct: 100071 aatcaacctttttgtacaaaagca 100094

>gb|AF074095.1|AF074095 Salvelinus namaycush clone A1 intergenic spacer region, partial
            sequence
          Length = 3114

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 180  tatcttattcagttccggcc 199
            ||||||||||||||||||||
Sbjct: 1853 tatcttattcagttccggcc 1872


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,946,174
Number of Sequences: 3902068
Number of extensions: 2946174
Number of successful extensions: 58642
Number of sequences better than 10.0: 4
Number of HSP's better than 10.0 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 58637
Number of HSP's gapped (non-prelim): 5
length of query: 473
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 451
effective length of database: 17,147,199,772
effective search space: 7733387097172
effective search space used: 7733387097172
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)