ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart10c08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_195060.1| Oryza sativa (japonica cultivar-group) putative... 129 1e-26
2dbj|AK067281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-26
3gb|AC090488.3| Genomic sequence for Oryza sativa, Nipponbare str... 68 3e-08
4dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 68 3e-08
5gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 68 3e-08
6emb|AL161533.2|ATCHRIV33 Arabidopsis thaliana DNA chromosome 4, ... 56 1e-04
7emb|AL080318.1|ATT4C9 Arabidopsis thaliana DNA chromosome 4, BAC... 56 1e-04
8ref|NM_117293.1| Arabidopsis thaliana catalytic AT4G12230 mRNA, ... 54 5e-04
9emb|BX826824.1|CNS0A3BR Arabidopsis thaliana Full-length cDNA Co... 54 5e-04
10gb|AY084996.1| Arabidopsis thaliana clone 123951 mRNA, complete ... 54 5e-04
11gb|AC129215.3| Mus musculus BAC clone RP24-435H23 from chromosom... 48 0.030
12gb|AC155316.6| Mus musculus BAC clone RP23-181P9 from chromosome... 48 0.030
13gb|AY496818.1| Polyommatus thersites MAT-99-Q947 cytochrome oxid... 46 0.12
14gb|AY496814.1| Polyommatus amandus NK-00-P596 cytochrome oxidase... 46 0.12
15gb|AY496811.1| Neolysandra alexander AD-00-P092 cytochrome oxida... 46 0.12
16gb|AY496810.1| Meleageria daphnis NK-00-P108 cytochrome oxidase ... 46 0.12
17gb|U08511.1|ELU08511 Eueides lybia cytochrome oxidase I gene, pa... 46 0.12
18gb|AC027033.3|AC027033 Arabidopsis thaliana chromosome 1 BAC F21... 46 0.12
19dbj|AP002060.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 46 0.12
20gb|AF150927.1|AF150927 Paraclemensia acerifoliella cytochrome ox... 46 0.12
21gb|AY748090.1| Eueides lybia isolate STRI-B-8595 cytochrome oxid... 46 0.12
22emb|AL805925.6| Mouse DNA sequence from clone RP23-210E20 on chr... 46 0.12
23gb|AY675448.1| Maculinea arion voucher ZD99S305 cytochrome oxida... 44 0.46
24gb|AY675447.1| Maculinea arion voucher ZD99S303 cytochrome oxida... 44 0.46
25gb|AY675446.1| Maculinea nausithous voucher ZD99S301 cytochrome ... 44 0.46
26gb|AY675445.1| Maculinea arion voucher ZD99S297 cytochrome oxida... 44 0.46
27gb|AY675444.1| Maculinea arionides voucher YJ02Q703 cytochrome o... 44 0.46
28gb|AY675441.1| Scolitantides orion voucher VL02L518 cytochrome o... 44 0.46
29gb|AY675440.1| Maculinea teleius voucher UK99W809 cytochrome oxi... 44 0.46
30gb|AY675439.1| Maculinea arionides voucher UK99W805 cytochrome o... 44 0.46
31gb|AY675438.1| Maculinea arionides voucher UK99W804 cytochrome o... 44 0.46
32gb|AY675437.1| Maculinea teleius voucher UK99W801 cytochrome oxi... 44 0.46
33gb|AY675436.1| Maculinea alcon voucher TDA99Q996 cytochrome oxid... 44 0.46
34gb|AY675435.1| Maculinea rebeli voucher TDA99Q995 cytochrome oxi... 44 0.46
35gb|AY675434.1| Maculinea rebeli voucher TDA99Q990 cytochrome oxi... 44 0.46
36gb|AY675433.1| Maculinea arion voucher TDA99Q989 cytochrome oxid... 44 0.46
37gb|AY675432.1| Maculinea arion voucher TDA99Q986 cytochrome oxid... 44 0.46
38gb|AY675431.1| Maculinea alcon voucher TDA99Q985 cytochrome oxid... 44 0.46
39gb|AY675430.1| Maculinea alcon voucher TDA99Q980 cytochrome oxid... 44 0.46
40gb|AY675429.1| Maculinea teleius voucher TDA99Q976 cytochrome ox... 44 0.46
41gb|AY675428.1| Maculinea teleius voucher TDA99Q975 cytochrome ox... 44 0.46
42gb|AY675425.1| Phengaris daitozanus voucher SY03A503 cytochrome ... 44 0.46
43gb|AY675422.1| Maculinea arion voucher RV03N585 cytochrome oxida... 44 0.46
44gb|AY675421.1| Pseudophilotes vicrama voucher NK00P753 cytochrom... 44 0.46
45gb|AY675420.1| Maculinea alcon voucher NK00P662 cytochrome oxida... 44 0.46
46gb|AY675419.1| Maculinea arion voucher NK00P589 cytochrome oxida... 44 0.46
47gb|AY675418.1| Maculinea teleius voucher MG02N009 cytochrome oxi... 44 0.46
48gb|AY675417.1| Maculinea alcon voucher MG02N001 cytochrome oxida... 44 0.46
49gb|AY675416.1| Pseudophilotes baton voucher MAT99Q829 cytochrome... 44 0.46
50gb|AY675415.1| Maculinea rebeli voucher MAT99Q829 cytochrome oxi... 44 0.46
51gb|AY675412.1| Euphilotes battoides voucher AS92Z166 cytochrome ... 44 0.46
52gb|AY675410.1| Euphilotes enoptes voucher AS92Z024 cytochrome ox... 44 0.46
53gb|AY675409.1| Maculinea cyanecula voucher AD03B078 cytochrome o... 44 0.46
54gb|AY675408.1| Maculinea arionides voucher AD02A161 cytochrome o... 44 0.46
55gb|AY675407.1| Maculinea arion voucher AD00Q102 cytochrome oxida... 44 0.46
56gb|AY675406.1| Maculinea alcon voucher AD00P203 cytochrome oxida... 44 0.46
57gb|AY675405.1| Pseudophilotes bavius voucher AD00P155 cytochrome... 44 0.46
58gb|AY675404.1| Maculinea alcon voucher AD00P146 cytochrome oxida... 44 0.46
59gb|AY675402.1| Maculinea arion voucher AD00P055 cytochrome oxida... 44 0.46
60gb|AY004305.1| Tegeticula maculata cytochrome oxidase subunit I ... 44 0.46
61gb|AC044804.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 44 0.46
62gb|AY527043.1| Agonopterix n. sp. TLH-2004 cytochrome oxidase su... 44 0.46
63gb|AY527039.1| Agonopterix nigrinotella cytochrome oxidase subun... 44 0.46
64gb|AC122847.4| Mus musculus BAC clone RP23-163F2 from 6, complet... 44 0.46
65gb|AY334328.1| Percus politus tRNA-Leu gene, partial sequence; c... 44 0.46
66gb|AY334327.1| Percus patruelis tRNA-Leu gene, partial sequence;... 44 0.46
67gb|AF537150.1| Percus cylindricus tRNA-Leu gene, partial sequenc... 44 0.46
68gb|AF537144.1| Percus strictus oberleitneri tRNA-Leu gene, parti... 44 0.46
69gb|AF537143.1| Percus strictus oberleitneri tRNA-Leu gene, parti... 44 0.46
70gb|AF537142.1| Percus strictus oberleitneri tRNA-Leu gene, parti... 44 0.46
71gb|AF537141.1| Percus strictus oberleitneri tRNA-Leu gene, parti... 44 0.46
72gb|AF537140.1| Percus strictus oberleitneri tRNA-Leu gene, parti... 44 0.46
73gb|AF537139.1| Percus strictus strictus tRNA-Leu gene, partial s... 44 0.46
74gb|AF537138.1| Percus strictus strictus tRNA-Leu gene, partial s... 44 0.46
75gb|AF537137.1| Percus strictus strictus tRNA-Leu gene, partial s... 44 0.46
76gb|AF537136.1| Percus strictus lacertosus tRNA-Leu gene, partial... 44 0.46
77gb|AY919287.1| Delias eichhorni cytochrome oxidase subunit I (CO... 44 0.46
78gb|AY040167.1| Houlbertia wardii cytochrome oxidase subunit II (... 44 0.46
79gb|AF337460.1|AF337460 Notagonum submetallicum clone JK39 cytoch... 44 0.46
80gb|AC159299.2| Mus musculus BAC clone RP23-241K11 from chromosom... 44 0.46
81gb|AF413704.1| Eueides lybia isolate STRI-B-556 cytochrome oxida... 44 0.46
82emb|AJ505069.1|CAR505069 Celastrina argiolus partial mitochondri... 44 0.46
83emb|AJ505067.1|MAR505067 Maculinea arion partial mitochondrial t... 44 0.46
84emb|AJ505066.1|MAR505066 Maculinea arion partial mitochondrial t... 44 0.46
85emb|AJ505065.1|MTE505065 Maculinea teleius partial mitochondrial... 44 0.46
86emb|AJ505064.1|MTE505064 Maculinea teleius partial mitochondrial... 44 0.46
87emb|AJ505061.1|MAL505061 Maculinea alcon taranis partial mitocho... 44 0.46
88emb|AJ505060.1|MAL505060 Maculinea alcon rebeli partial mitochon... 44 0.46
89emb|AJ505059.1|MAL505059 Maculinea alcon rebeli partial mitochon... 44 0.46
90emb|AJ505058.1|MAL505058 Maculinea alcon rebeli partial mitochon... 44 0.46
91emb|AJ505057.1|MAL505057 Maculinea alcon rebeli partial mitochon... 44 0.46
92emb|AJ505056.1|MAL505056 Maculinea alcon rebeli partial mitochon... 44 0.46
93emb|AJ505055.1|MAL505055 Maculinea alcon rebeli partial mitochon... 44 0.46
94emb|AJ505054.1|MAL505054 Maculinea alcon alcon partial mitochond... 44 0.46
95emb|AJ505053.1|MAL505053 Maculinea alcon alcon partial mitochond... 44 0.46
96emb|AJ505052.1|MAL505052 Maculinea alcon alcon partial mitochond... 44 0.46
97gb|AF150924.1|AF150924 Parategeticula sp. country Mexico cytochr... 44 0.46
98gb|AF150923.1|AF150923 Parategeticula sp. country Mexico cytochr... 44 0.46
99gb|U04887.1|TMU04887 Tegeticula maculata mitochondrion tRNA-Leu ... 44 0.46
100gb|U94220.1|SAU94220 Scaptomyza albovittata cytochrome oxidase s... 44 0.46
101gb|U49024.1|TMU49024 Tegeticula maculata maculata cytochrome oxi... 44 0.46
102gb|AC095247.5| Rattus norvegicus 4 BAC CH230-10C6 (Children's Ho... 42 1.8
103gb|AC150210.1| Pan troglodytes chromosome X clone RP43-051H11 ma... 42 1.8
104gb|AC087112.2| Rattus norvegicus strain Brown Norway clone RP31-... 42 1.8
105gb|AC129328.4| Mus musculus BAC clone RP23-15O6 from chromosome ... 42 1.8
106gb|AC121216.4| Rattus norvegicus 4 CH230-220A21 (Children's Hosp... 42 1.8
107emb|AL359532.26| Human DNA sequence from clone RP11-330O11 on ch... 42 1.8
108emb|AL031466.2|HS653H13 Human DNA sequence from clone RP4-653H13... 42 1.8
109gb|AC117220.4| Mus musculus BAC clone RP23-344H17 from chromosom... 42 1.8
110gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome 42 1.8
111gb|DP000027.1| Rattus norvegicus target 1 genomic scaffold 42 1.8
112gb|AC129948.3| Branchiostoma floridae, clone -33B4, complete seq... 42 1.8
113gb|AC097721.3| Homo sapiens BAC clone RP11-36O6 from 2, complete... 42 1.8
114dbj|AB011476.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 42 1.8
115gb|AC164105.4| Mus musculus BAC clone RP23-433B2 from chromosome... 40 7.2
116gb|AC159627.2| Mus musculus BAC clone RP24-202P24 from chromosom... 40 7.2
117gb|AY496797.1| Agrodiaetus turcicolus VL-01-L352 cytochrome oxid... 40 7.2
118gb|AY496796.1| Agrodiaetus turcicolus VL-01-L348 cytochrome oxid... 40 7.2
119gb|AY496795.1| Agrodiaetus turcicolus VL-01-L228 cytochrome oxid... 40 7.2
120gb|AY496793.1| Agrodiaetus surakovi sekercioglu VL-01-L196 cytoc... 40 7.2
121gb|AY496792.1| Agrodiaetus surakovi surakovi AD-00-P006 cytochro... 40 7.2
122gb|AY496791.1| Agrodiaetus sp. VL-01-B210 cytochrome oxidase sub... 40 7.2
123gb|AY496778.1| Agrodiaetus putnami VL-01-L416 cytochrome oxidase... 40 7.2
124gb|AY496777.1| Agrodiaetus pseudactis AD-00-P263 cytochrome oxid... 40 7.2
125gb|AY496775.1| Agrodiaetus poseidon VL-01-L108 cytochrome oxidas... 40 7.2
126gb|AY496773.1| Agrodiaetus pierceae VL-01-L365 cytochrome oxidas... 40 7.2
127gb|AY496768.1| Agrodiaetus ninae firuze VL-01-L169 cytochrome ox... 40 7.2
128gb|AY496767.1| Agrodiaetus ninae AD-00-P345 cytochrome oxidase s... 40 7.2
129gb|AY496766.1| Agrodiaetus ninae AD-00-P004 cytochrome oxidase s... 40 7.2
130gb|AY496764.1| Agrodiaetus merhaba VL-01-L458 cytochrome oxidase... 40 7.2
131gb|AY496762.1| Agrodiaetus kurdistanicus VL-01-L190 cytochrome o... 40 7.2
132gb|AY496761.1| Agrodiaetus kendevani VL-01-B209 cytochrome oxida... 40 7.2
133gb|AY496754.1| Agrodiaetus huberti VL-01-L315 cytochrome oxidase... 40 7.2
134gb|AY496753.1| Agrodiaetus huberti VL-01-L123 cytochrome oxidase... 40 7.2
135gb|AY496752.1| Agrodiaetus huberti huberti AD-00-P260 cytochrome... 40 7.2
136gb|AY496745.1| Agrodiaetus firdussii VL-01-B199 cytochrome oxida... 40 7.2
137gb|AY496741.1| Agrodiaetus elbursicus zapvadi VL-01-L195 cytochr... 40 7.2
138gb|AY496723.1| Agrodiaetus carmon munzuricus VL-01-Q129 cytochro... 40 7.2
139gb|AY496722.1| Agrodiaetus carmon carmon VL-01-L262 cytochrome o... 40 7.2
140gb|AY496721.1| Agrodiaetus bilgini VL-01-Q140 cytochrome oxidase... 40 7.2
141gb|AY496719.1| Agrodiaetus aserbeidschanus VL-01-B033 cytochrome... 40 7.2
142gb|AY496718.1| Agrodiaetus arasbarani neglectus AD-00-P325 cytoc... 40 7.2
143gb|AY496717.1| Agrodiaetus antidolus VL-01-L270 cytochrome oxida... 40 7.2
144ref|NM_177945.3| Bos taurus peroxisome proliferator activated re... 40 7.2
145emb|CR847924.7| Zebrafish DNA sequence from clone CH211-261H11 i... 40 7.2
146gb|AC083946.5| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 7.2
147gb|AC148481.9| Medicago truncatula clone mth2-36d21, complete se... 40 7.2
148gb|AC148291.22| Medicago truncatula clone mth2-14n3, complete se... 40 7.2
149gb|AE017245.1| Mycoplasma synoviae 53, complete genome 40 7.2
150emb|CR352210.11| Zebrafish DNA sequence from clone DKEY-166N8 in... 40 7.2
151emb|AL590311.5| Human DNA sequence from clone RP11-20F16 on chro... 40 7.2
152emb|AL359376.22| Human DNA sequence from clone RP11-366K17 on ch... 40 7.2
153emb|AL359178.10| Human DNA sequence from clone RP11-481K24 on ch... 40 7.2
154emb|CR354401.17| Zebrafish DNA sequence from clone CH211-101C7 i... 40 7.2
155emb|CR380957.1| Candida glabrata strain CBS138 chromosome K comp... 40 7.2
156emb|CR378677.1| Photobacterium profundum SS9 chromosome 2; segme... 40 7.2
157emb|AL589701.9| Mouse DNA sequence from clone RP23-202F3 on chro... 40 7.2
158emb|AL138640.1|ATT12K4 Arabidopsis thaliana DNA chromosome 3, BA... 40 7.2
159emb|CR293518.13| Zebrafish DNA sequence from clone CH211-129L10 ... 40 7.2
160gb|AY954021.1| Agrodiaetus lukhtanovi cytochrome oxidase subunit... 40 7.2
161gb|AY954006.1| Agrodiaetus rjabovi ssp. NPK-2005 cytochrome oxid... 40 7.2
162gb|AY953999.1| Agrodiaetus elbursicus cytochrome oxidase subunit... 40 7.2
163gb|AY953997.1| Agrodiaetus firdussii cytochrome oxidase subunit ... 40 7.2
164gb|AY953994.1| Agrodiaetus zarathustra cytochrome oxidase subuni... 40 7.2
165gb|AY953988.1| Agrodiaetus iphidamon cytochrome oxidase subunit ... 40 7.2
166gb|AY953986.1| Agrodiaetus elbursicus cytochrome oxidase subunit... 40 7.2
167emb|BX511029.9| Zebrafish DNA sequence from clone DKEY-18H21 in ... 40 7.2
168gb|AC114913.4| Homo sapiens BAC clone RP11-588P8 from 4, complet... 40 7.2
169gb|AC105245.4| Homo sapiens chromosome 18, clone CTD-2515C13, co... 40 7.2
170gb|AC090349.7| Homo sapiens chromosome 18, clone RP11-844N22, co... 40 7.2
171gb|AY321517.1| Bos taurus peroxisome proliferator activated rece... 40 7.2
172dbj|AK032149.1| Mus musculus adult male olfactory brain cDNA, RI... 40 7.2
173dbj|AK082685.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 40 7.2
174dbj|AK043827.1| Mus musculus 10 days neonate cortex cDNA, RIKEN ... 40 7.2
175dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.2
176gb|AC012307.8| Homo sapiens BAC clone RP11-574O17 from 2, comple... 40 7.2
177gb|AC062039.3| Homo sapiens BAC clone RP11-814A15 from 2, comple... 40 7.2
178gb|AC005034.2| Homo sapiens BAC clone RP11-342K6 from 2, complet... 40 7.2
179gb|AC013401.10| Homo sapiens BAC clone RP11-98N11 from 2, comple... 40 7.2
180dbj|AP005863.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.2
181dbj|AP005811.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.2
182gb|AF026395.1|AF026395 Saccharomyces servazzii Oxa1p (OXA1) and ... 40 7.2
183emb|BX004853.7| Zebrafish DNA sequence from clone DKEY-13O11, co... 40 7.2
184gb|AC172989.2| Mus musculus BAC clone RP24-556J6 from chromosome... 40 7.2
185emb|AL591977.1| Listeria monocytogenes strain EGD, complete geno... 40 7.2
186emb|AL928607.8| Mouse DNA sequence from clone RP23-326J18 on chr... 40 7.2
187gb|AC167818.4| Mus musculus BAC clone RP23-120O24 from chromosom... 40 7.2
188gb|AC116763.11| Mus musculus chromosome 5, clone RP23-385G21, co... 40 7.2
189emb|AL451009.3| Human DNA sequence from clone RP11-440G22 on chr... 40 7.2
190dbj|AP002358.3| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 7.2 
>ref|NM_195060.1| Oryza sativa (japonica cultivar-group) putative acid cluster
           protein 33 (OSJNBb0081F12.21), mRNA
          Length = 936

 Score =  129 bits (65), Expect = 1e-26
 Identities = 101/113 (89%)
 Strand = Plus / Minus

                                                                       
Query: 420 cgtgtgaaaccctggactagatccggtcttggttctactccaactcgccttaagtgtagc 479
           ||||||||||| ||||| ||||| ||||| ||||||||||||||||| || || ||||||
Sbjct: 701 cgtgtgaaaccttggaccagatctggtctaggttctactccaactcgtctcaaatgtagc 642

                                                                
Query: 480 tgaaggtacagattgacctcatctggacgtgacaggaagggaaaatccccacc 532
           |||||||||| ||| |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 641 tgaaggtacaaattaacctcatcaggacgtgacaggaaggggaaatcaccacc 589
to top
>dbj|AK067281.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013100H18, full
           insert sequence
          Length = 1521

 Score =  129 bits (65), Expect = 1e-26
 Identities = 101/113 (89%)
 Strand = Plus / Minus

                                                                       
Query: 420 cgtgtgaaaccctggactagatccggtcttggttctactccaactcgccttaagtgtagc 479
           ||||||||||| ||||| ||||| ||||| ||||||||||||||||| || || ||||||
Sbjct: 938 cgtgtgaaaccttggaccagatctggtctaggttctactccaactcgtctcaaatgtagc 879

                                                                
Query: 480 tgaaggtacagattgacctcatctggacgtgacaggaagggaaaatccccacc 532
           |||||||||| ||| |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 878 tgaaggtacaaattaacctcatcaggacgtgacaggaaggggaaatcaccacc 826
to top
>gb|AC090488.3| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBb0081F12
              from chromosome 10, complete sequence
          Length = 128388

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                          
Query: 420    cgtgtgaaaccctggactagatccggtcttggttctactccaactcgccttaagtgtagc 479
              ||||||||||| ||||| ||||| ||||| ||||||||||||||||| || || ||||||
Sbjct: 100415 cgtgtgaaaccttggaccagatctggtctaggttctactccaactcgtctcaaatgtagc 100356

                
Query: 480    tg 481
              ||
Sbjct: 100355 tg 100354



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                    
Query: 479    ctgaaggtacagattgacctcatctggacgtgacaggaagggaaaatccccacc 532
              ||||||||||| ||| |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 100282 ctgaaggtacaaattaacctcatcaggacgtgacaggaaggggaaatcaccacc 100229
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                           
Query: 420     cgtgtgaaaccctggactagatccggtcttggttctactccaactcgccttaagtgtagc 479
               ||||||||||| ||||| ||||| ||||| ||||||||||||||||| || || ||||||
Sbjct: 4438807 cgtgtgaaaccttggaccagatctggtctaggttctactccaactcgtctcaaatgtagc 4438748

                 
Query: 480     tg 481
               ||
Sbjct: 4438747 tg 4438746



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                     
Query: 479     ctgaaggtacagattgacctcatctggacgtgacaggaagggaaaatccccacc 532
               ||||||||||| ||| |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 4438674 ctgaaggtacaaattaacctcatcaggacgtgacaggaaggggaaatcaccacc 4438621
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                           
Query: 420     cgtgtgaaaccctggactagatccggtcttggttctactccaactcgccttaagtgtagc 479
               ||||||||||| ||||| ||||| ||||| ||||||||||||||||| || || ||||||
Sbjct: 4439628 cgtgtgaaaccttggaccagatctggtctaggttctactccaactcgtctcaaatgtagc 4439569

                 
Query: 480     tg 481
               ||
Sbjct: 4439568 tg 4439567



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                     
Query: 479     ctgaaggtacagattgacctcatctggacgtgacaggaagggaaaatccccacc 532
               ||||||||||| ||| |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 4439495 ctgaaggtacaaattaacctcatcaggacgtgacaggaaggggaaatcaccacc 4439442
to top
>emb|AL161533.2|ATCHRIV33 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 33
          Length = 190026

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                      
Query: 444    ggtcttggttctactccaactcgccttaagtgtagctgaa 483
              |||| |||||||||||| || |||||||||||||||||||
Sbjct: 144151 ggtcgtggttctactcctacccgccttaagtgtagctgaa 144112
to top
>emb|AL080318.1|ATT4C9 Arabidopsis thaliana DNA chromosome 4, BAC clone T4C9 (ESSA project)
          Length = 85356

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                     
Query: 444   ggtcttggttctactccaactcgccttaagtgtagctgaa 483
             |||| |||||||||||| || |||||||||||||||||||
Sbjct: 21096 ggtcgtggttctactcctacccgccttaagtgtagctgaa 21057
to top
>ref|NM_117293.1| Arabidopsis thaliana catalytic AT4G12230 mRNA, complete cds
          Length = 1499

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 444 ggtcttggttctactccaactcgccttaagtgtagctgaaggtacagattgacctcatct 503
           |||| |||||||||||| || ||||||||||||||||| || | || |||||| || || 
Sbjct: 959 ggtcgtggttctactcctacccgccttaagtgtagctgtagatgcaaattgacttcgtcg 900

                                  
Query: 504 ggacgtgacaggaagggaaaatc 526
           || ||||| ||||| || |||||
Sbjct: 899 ggccgtgataggaatgggaaatc 877
to top
>emb|BX826824.1|CNS0A3BR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB66ZC03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1378

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 444 ggtcttggttctactccaactcgccttaagtgtagctgaaggtacagattgacctcatct 503
           |||| |||||||||||| || ||||||||||||||||| || | || |||||| || || 
Sbjct: 901 ggtcgtggttctactcctacccgccttaagtgtagctgtagatgcaaattgacttcgtcg 842

                                  
Query: 504 ggacgtgacaggaagggaaaatc 526
           || ||||| ||||| || |||||
Sbjct: 841 ggccgtgataggaatgggaaatc 819
to top
>gb|AY084996.1| Arabidopsis thaliana clone 123951 mRNA, complete sequence
          Length = 1499

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 444 ggtcttggttctactccaactcgccttaagtgtagctgaaggtacagattgacctcatct 503
           |||| |||||||||||| || ||||||||||||||||| || | || |||||| || || 
Sbjct: 959 ggtcgtggttctactcctacccgccttaagtgtagctgtagatgcaaattgacttcgtcg 900

                                  
Query: 504 ggacgtgacaggaagggaaaatc 526
           || ||||| ||||| || |||||
Sbjct: 899 ggccgtgataggaatgggaaatc 877
to top
>gb|AC129215.3| Mus musculus BAC clone RP24-435H23 from chromosome 5, complete sequence
          Length = 140936

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 119   acctacaaacacaaaataaagaag 142
             ||||||||||||||||||||||||
Sbjct: 66238 acctacaaacacaaaataaagaag 66261
to top
>gb|AC155316.6| Mus musculus BAC clone RP23-181P9 from chromosome 5, complete sequence
          Length = 204809

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 119   acctacaaacacaaaataaagaag 142
             ||||||||||||||||||||||||
Sbjct: 23276 acctacaaacacaaaataaagaag 23299
to top
>gb|AY496818.1| Polyommatus thersites MAT-99-Q947 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 1999

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 164  catgaatgaattccatcagttgctgtg 190
            |||||||||||| ||||||||||||||
Sbjct: 1804 catgaatgaattacatcagttgctgtg 1778
to top
>gb|AY496814.1| Polyommatus amandus NK-00-P596 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 1988

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 164  catgaatgaattccatcagttgctgtg 190
            |||||||||||| ||||||||||||||
Sbjct: 1806 catgaatgaattacatcagttgctgtg 1780
to top
>gb|AY496811.1| Neolysandra alexander AD-00-P092 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 1999

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 164  catgaatgaattccatcagttgctgtg 190
            |||||||||||| ||||||||||||||
Sbjct: 1805 catgaatgaattacatcagttgctgtg 1779
to top
>gb|AY496810.1| Meleageria daphnis NK-00-P108 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 2000

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 164  catgaatgaattccatcagttgctgtg 190
            |||||||||||| ||||||||||||||
Sbjct: 1806 catgaatgaattacatcagttgctgtg 1780
to top
>gb|U08511.1|ELU08511 Eueides lybia cytochrome oxidase I gene, partial cds; tRNA-Leu
           gene, complete sequence; and cytochrome oxidase II gene,
           partial cds; mitochondrial genes for mitochondrial
           products
          Length = 953

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 164 catgaatgaattccatcagttgctgtg 190
           |||||||||||| ||||||||||||||
Sbjct: 761 catgaatgaattacatcagttgctgtg 735
to top
>gb|AC027033.3|AC027033 Arabidopsis thaliana chromosome 1 BAC F21N10 genomic sequence, complete
             sequence
          Length = 98017

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 116   caaacctacaaacacaaaataaa 138
             |||||||||||||||||||||||
Sbjct: 79708 caaacctacaaacacaaaataaa 79730
to top
>dbj|AP002060.1| Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone: T20F20
          Length = 56287

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 116   caaacctacaaacacaaaataaa 138
             |||||||||||||||||||||||
Sbjct: 11240 caaacctacaaacacaaaataaa 11262
to top
>gb|AF150927.1|AF150927 Paraclemensia acerifoliella cytochrome oxidase subunit I (COI) gene,
            partial cds; tRNA-Leu gene, complete sequence; and
            cytochrome oxidase subunit II (COII) gene, partial cds;
            mitochondrial genes for mitochondrial products
          Length = 2104

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 164  catgaatgaattccatcagttgctgtg 190
            |||||||||||| ||||||||||||||
Sbjct: 2070 catgaatgaattacatcagttgctgtg 2044
to top
>gb|AY748090.1| Eueides lybia isolate STRI-B-8595 cytochrome oxidase subunit 1 (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit 2 (COII) gene,
            complete cds; mitochondrial
          Length = 1590

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 164  catgaatgaattccatcagttgctgtg 190
            |||||||||||| ||||||||||||||
Sbjct: 1364 catgaatgaattacatcagttgctgtg 1338
to top
>emb|AL805925.6| Mouse DNA sequence from clone RP23-210E20 on chromosome X, complete
             sequence
          Length = 104244

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 125   aaacacaaaataaagaagaaatt 147
             |||||||||||||||||||||||
Sbjct: 97565 aaacacaaaataaagaagaaatt 97543
to top
>gb|AY675448.1| Maculinea arion voucher ZD99S305 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1806 catgaatgaattacatcagttgctgt 1781
to top
>gb|AY675447.1| Maculinea arion voucher ZD99S303 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 1968

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1796 catgaatgaattacatcagttgctgt 1771
to top
>gb|AY675446.1| Maculinea nausithous voucher ZD99S301 cytochrome oxidase subunit I
            (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 1979

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1806 catgaatgaattacatcagttgctgt 1781
to top
>gb|AY675445.1| Maculinea arion voucher ZD99S297 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1806 catgaatgaattacatcagttgctgt 1781
to top
>gb|AY675444.1| Maculinea arionides voucher YJ02Q703 cytochrome oxidase subunit I
            (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1806 catgaatgaattacatcagttgctgt 1781
to top
>gb|AY675441.1| Scolitantides orion voucher VL02L518 cytochrome oxidase subunit I
            (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 1993

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1798 catgaatgaattacatcagttgctgt 1773
to top
>gb|AY675440.1| Maculinea teleius voucher UK99W809 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 1985

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1790 catgaatgaattacatcagttgctgt 1765
to top
>gb|AY675439.1| Maculinea arionides voucher UK99W805 cytochrome oxidase subunit I
            (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 1993

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1806 catgaatgaattacatcagttgctgt 1781
to top
>gb|AY675438.1| Maculinea arionides voucher UK99W804 cytochrome oxidase subunit I
            (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 1965

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1770 catgaatgaattacatcagttgctgt 1745
to top
>gb|AY675437.1| Maculinea teleius voucher UK99W801 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 1974

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1779 catgaatgaattacatcagttgctgt 1754
to top
>gb|AY675436.1| Maculinea alcon voucher TDA99Q996 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 1965

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1775 catgaatgaattacatcagttgctgt 1750
to top
>gb|AY675435.1| Maculinea rebeli voucher TDA99Q995 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1806 catgaatgaattacatcagttgctgt 1781
to top
>gb|AY675434.1| Maculinea rebeli voucher TDA99Q990 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1806 catgaatgaattacatcagttgctgt 1781
to top
>gb|AY675433.1| Maculinea arion voucher TDA99Q989 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 1982

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1796 catgaatgaattacatcagttgctgt 1771
to top
>gb|AY675432.1| Maculinea arion voucher TDA99Q986 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 1978

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1794 catgaatgaattacatcagttgctgt 1769
to top
>gb|AY675431.1| Maculinea alcon voucher TDA99Q985 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 1993

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1806 catgaatgaattacatcagttgctgt 1781
to top
>gb|AY675430.1| Maculinea alcon voucher TDA99Q980 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 1989

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1806 catgaatgaattacatcagttgctgt 1781
to top
>gb|AY675429.1| Maculinea teleius voucher TDA99Q976 cytochrome oxidase subunit I
            (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 1984

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1795 catgaatgaattacatcagttgctgt 1770
to top
>gb|AY675428.1| Maculinea teleius voucher TDA99Q975 cytochrome oxidase subunit I
            (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 1989

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1797 catgaatgaattacatcagttgctgt 1772
to top
>gb|AY675425.1| Phengaris daitozanus voucher SY03A503 cytochrome oxidase subunit I
            (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1806 catgaatgaattacatcagttgctgt 1781
to top
>gb|AY675422.1| Maculinea arion voucher RV03N585 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1806 catgaatgaattacatcagttgctgt 1781
to top
>gb|AY675421.1| Pseudophilotes vicrama voucher NK00P753 cytochrome oxidase subunit I
            (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1806 catgaatgaattacatcagttgctgt 1781
to top
>gb|AY675420.1| Maculinea alcon voucher NK00P662 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 1986

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1800 catgaatgaattacatcagttgctgt 1775
to top
>gb|AY675419.1| Maculinea arion voucher NK00P589 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 1975

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1803 catgaatgaattacatcagttgctgt 1778
to top
>gb|AY675418.1| Maculinea teleius voucher MG02N009 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1806 catgaatgaattacatcagttgctgt 1781
to top
>gb|AY675417.1| Maculinea alcon voucher MG02N001 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1806 catgaatgaattacatcagttgctgt 1781
to top
>gb|AY675416.1| Pseudophilotes baton voucher MAT99Q829 cytochrome oxidase subunit I
            (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1806 catgaatgaattacatcagttgctgt 1781
to top
>gb|AY675415.1| Maculinea rebeli voucher MAT99Q829 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 1989

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1796 catgaatgaattacatcagttgctgt 1771
to top
>gb|AY675412.1| Euphilotes battoides voucher AS92Z166 cytochrome oxidase subunit I
            (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 2002

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1807 catgaatgaattacatcagttgctgt 1782
to top
>gb|AY675410.1| Euphilotes enoptes voucher AS92Z024 cytochrome oxidase subunit I
            (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 2000

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1807 catgaatgaattacatcagttgctgt 1782
to top
>gb|AY675409.1| Maculinea cyanecula voucher AD03B078 cytochrome oxidase subunit I
            (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 1982

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1787 catgaatgaattacatcagttgctgt 1762
to top
>gb|AY675408.1| Maculinea arionides voucher AD02A161 cytochrome oxidase subunit I
            (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1806 catgaatgaattacatcagttgctgt 1781
to top
>gb|AY675407.1| Maculinea arion voucher AD00Q102 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 1970

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1799 catgaatgaattacatcagttgctgt 1774
to top
>gb|AY675406.1| Maculinea alcon voucher AD00P203 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 1988

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1799 catgaatgaattacatcagttgctgt 1774
to top
>gb|AY675405.1| Pseudophilotes bavius voucher AD00P155 cytochrome oxidase subunit I
            (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1806 catgaatgaattacatcagttgctgt 1781
to top
>gb|AY675404.1| Maculinea alcon voucher AD00P146 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 1986

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1805 catgaatgaattacatcagttgctgt 1780
to top
>gb|AY675402.1| Maculinea arion voucher AD00P055 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit I (COII) gene,
            partial cds; mitochondrial
          Length = 1982

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1806 catgaatgaattacatcagttgctgt 1781
to top
>gb|AY004305.1| Tegeticula maculata cytochrome oxidase subunit I gene, partial cds;
            tRNA-Leu gene, complete sequence; and cytochrome oxidase
            subunit II gene, partial cds; mitochondrial
          Length = 2104

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 2070 catgaatgaattacatcagttgctgt 2045
to top
>gb|AC044804.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-15K8, complete
              sequence
          Length = 253000

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 110    aatatacaaacctacaaacacaaaat 135
              |||||||||||||| |||||||||||
Sbjct: 163285 aatatacaaacctaaaaacacaaaat 163310
to top
>gb|AY527043.1| Agonopterix n. sp. TLH-2004 cytochrome oxidase subunit II gene,
           partial cds; mitochondrial
          Length = 522

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 432 catgaatgaattacatcagttgctgt 407
to top
>gb|AY527039.1| Agonopterix nigrinotella cytochrome oxidase subunit II gene,
           partial cds; mitochondrial
          Length = 522

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 432 catgaatgaattacatcagttgctgt 407
to top
>gb|AC122847.4| Mus musculus BAC clone RP23-163F2 from 6, complete sequence
          Length = 193343

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 110    aatatacaaacctacaaacacaaaat 135
              |||||||||||||| |||||||||||
Sbjct: 191838 aatatacaaacctaaaaacacaaaat 191813
to top
>gb|AY334328.1| Percus politus tRNA-Leu gene, partial sequence; cytochrome c
           oxidase subunit II (CO2) gene, complete cds; and
           tRNA-Lys gene, partial sequence; mitochondrial genes for
           mitochondrial products
          Length = 747

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 533 catgaatgaattacatcagttgctgt 508
to top
>gb|AY334327.1| Percus patruelis tRNA-Leu gene, partial sequence; cytochrome c
           oxidase subunit II (CO2) gene, complete cds; and
           tRNA-Lys gene, partial sequence; mitochondrial genes for
           mitochondrial products
          Length = 747

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 533 catgaatgaattacatcagttgctgt 508
to top
>gb|AF537150.1| Percus cylindricus tRNA-Leu gene, partial sequence; cytochrome c
           oxidase subunit 2 gene, complete cds; and tRNA-Lys gene,
           partial sequence; mitochondrial genes for mitochondrial
           products
          Length = 746

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 532 catgaatgaattacatcagttgctgt 507
to top
>gb|AF537144.1| Percus strictus oberleitneri tRNA-Leu gene, partial sequence;
           cytochrome c oxidase subunit 2 gene, complete cds; and
           tRNA-Lys gene, partial sequence; mitochondrial genes for
           mitochondrial products
          Length = 745

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 531 catgaatgaattacatcagttgctgt 506
to top
>gb|AF537143.1| Percus strictus oberleitneri tRNA-Leu gene, partial sequence;
           cytochrome c oxidase subunit 2 gene, complete cds; and
           tRNA-Lys gene, partial sequence; mitochondrial genes for
           mitochondrial products
          Length = 746

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 532 catgaatgaattacatcagttgctgt 507
to top
>gb|AF537142.1| Percus strictus oberleitneri tRNA-Leu gene, partial sequence;
           cytochrome c oxidase subunit 2 gene, complete cds; and
           tRNA-Lys gene, partial sequence; mitochondrial genes for
           mitochondrial products
          Length = 745

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 531 catgaatgaattacatcagttgctgt 506
to top
>gb|AF537141.1| Percus strictus oberleitneri tRNA-Leu gene, partial sequence;
           cytochrome c oxidase subunit 2 gene, complete cds; and
           tRNA-Lys gene, partial sequence; mitochondrial genes for
           mitochondrial products
          Length = 745

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 531 catgaatgaattacatcagttgctgt 506
to top
>gb|AF537140.1| Percus strictus oberleitneri tRNA-Leu gene, partial sequence;
           cytochrome c oxidase subunit 2 gene, complete cds; and
           tRNA-Lys gene, partial sequence; mitochondrial genes for
           mitochondrial products
          Length = 745

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 531 catgaatgaattacatcagttgctgt 506
to top
>gb|AF537139.1| Percus strictus strictus tRNA-Leu gene, partial sequence;
           cytochrome c oxidase subunit 2 gene, complete cds; and
           tRNA-Lys gene, partial sequence; mitochondrial genes for
           mitochondrial products
          Length = 746

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 532 catgaatgaattacatcagttgctgt 507
to top
>gb|AF537138.1| Percus strictus strictus tRNA-Leu gene, partial sequence;
           cytochrome c oxidase subunit 2 gene, complete cds; and
           tRNA-Lys gene, partial sequence; mitochondrial genes for
           mitochondrial products
          Length = 746

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 532 catgaatgaattacatcagttgctgt 507
to top
>gb|AF537137.1| Percus strictus strictus tRNA-Leu gene, partial sequence;
           cytochrome c oxidase subunit 2 gene, complete cds; and
           tRNA-Lys gene, partial sequence; mitochondrial genes for
           mitochondrial products
          Length = 746

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 532 catgaatgaattacatcagttgctgt 507
to top
>gb|AF537136.1| Percus strictus lacertosus tRNA-Leu gene, partial sequence;
           cytochrome c oxidase subunit 2 gene, complete cds; and
           tRNA-Lys gene, partial sequence; mitochondrial genes for
           mitochondrial products
          Length = 746

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 532 catgaatgaattacatcagttgctgt 507
to top
>gb|AY919287.1| Delias eichhorni cytochrome oxidase subunit I (COI) gene, partial
            cds; tRNA-Leu gene, complete sequence; and cytochrome
            oxidase subunit II gene, partial cds; mitochondrial
          Length = 2002

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1807 catgaatgaattacatcagttgctgt 1782
to top
>gb|AY040167.1| Houlbertia wardii cytochrome oxidase subunit II (COII) gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 420

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 258 catgaatgaattacatcagttgctgt 233
to top
>gb|AF337460.1|AF337460 Notagonum submetallicum clone JK39 cytochrome oxidase subunit II
           (COII) gene, partial cds; mitochondrial gene for
           mitochondrial product
          Length = 559

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 455 catgaatgaattacatcagttgctgt 430
to top
>gb|AC159299.2| Mus musculus BAC clone RP23-241K11 from chromosome 6, complete sequence
          Length = 207837

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 110    aatatacaaacctacaaacacaaaat 135
              |||||||||||||| |||||||||||
Sbjct: 126158 aatatacaaacctaaaaacacaaaat 126183
to top
>gb|AF413704.1| Eueides lybia isolate STRI-B-556 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            complete cds; mitochondrial genes for mitochondrial
            products
          Length = 1592

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 1366 catgaatgaattacatcagttgctgt 1341
to top
>emb|AJ505069.1|CAR505069 Celastrina argiolus partial mitochondrial tRNA-Leu gene and coii
           gene for cytochrome oxidase subunit II, specimen voucher
           W66
          Length = 611

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 517 catgaatgaattacatcagttgctgt 492
to top
>emb|AJ505067.1|MAR505067 Maculinea arion partial mitochondrial tRNA-Leu gene and coii gene
           for cytochrome oxidase subunit II, specimen voucher W152
          Length = 611

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 517 catgaatgaattacatcagttgctgt 492
to top
>emb|AJ505066.1|MAR505066 Maculinea arion partial mitochondrial tRNA-Leu gene and coii gene
           for cytochrome oxidase subunit II, specimen voucher W155
          Length = 611

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 517 catgaatgaattacatcagttgctgt 492
to top
>emb|AJ505065.1|MTE505065 Maculinea teleius partial mitochondrial tRNA-Leu gene and coii gene
           for cytochrome oxidase subunit II, specimen voucher W199
          Length = 611

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 517 catgaatgaattacatcagttgctgt 492
to top
>emb|AJ505064.1|MTE505064 Maculinea teleius partial mitochondrial tRNA-Leu gene and coii gene
           for cytochrome oxidase subunit II, specimen voucher W146
          Length = 611

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 517 catgaatgaattacatcagttgctgt 492
to top
>emb|AJ505061.1|MAL505061 Maculinea alcon taranis partial mitochondrial tRNA-Leu gene and
           coii gene for cytochrome oxidase subunit II, specimen
           voucher W201
          Length = 611

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 517 catgaatgaattacatcagttgctgt 492
to top
>emb|AJ505060.1|MAL505060 Maculinea alcon rebeli partial mitochondrial tRNA-Leu gene and coii
           gene for cytochrome oxidase subunit II, specimen voucher
           W197
          Length = 611

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 517 catgaatgaattacatcagttgctgt 492
to top
>emb|AJ505059.1|MAL505059 Maculinea alcon rebeli partial mitochondrial tRNA-Leu gene and coii
           gene for cytochrome oxidase subunit II, specimen voucher
           W150
          Length = 611

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 517 catgaatgaattacatcagttgctgt 492
to top
>emb|AJ505058.1|MAL505058 Maculinea alcon rebeli partial mitochondrial tRNA-Leu gene and coii
           gene for cytochrome oxidase subunit II, specimen voucher
           W144
          Length = 611

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 517 catgaatgaattacatcagttgctgt 492
to top
>emb|AJ505057.1|MAL505057 Maculinea alcon rebeli partial mitochondrial tRNA-Leu gene and coii
           gene for cytochrome oxidase subunit II, specimen voucher
           W138
          Length = 611

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 517 catgaatgaattacatcagttgctgt 492
to top
>emb|AJ505056.1|MAL505056 Maculinea alcon rebeli partial mitochondrial tRNA-Leu gene and coii
           gene for cytochrome oxidase subunit II, specimen voucher
           W193
          Length = 611

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 517 catgaatgaattacatcagttgctgt 492
to top
>emb|AJ505055.1|MAL505055 Maculinea alcon rebeli partial mitochondrial tRNA-Leu gene and coii
           gene for cytochrome oxidase subunit II, specimen voucher
           W156
          Length = 611

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 517 catgaatgaattacatcagttgctgt 492
to top
>emb|AJ505054.1|MAL505054 Maculinea alcon alcon partial mitochondrial tRNA-Leu gene and coii
           gene for cytochrome oxidase subunit II, specimen voucher
           W203
          Length = 611

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 517 catgaatgaattacatcagttgctgt 492
to top
>emb|AJ505053.1|MAL505053 Maculinea alcon alcon partial mitochondrial tRNA-Leu gene and coii
           gene for cytochrome oxidase subunit II, specimen voucher
           W141
          Length = 611

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 517 catgaatgaattacatcagttgctgt 492
to top
>emb|AJ505052.1|MAL505052 Maculinea alcon alcon partial mitochondrial tRNA-Leu gene and coii
           gene for cytochrome oxidase subunit II, specimen voucher
           W149
          Length = 611

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 517 catgaatgaattacatcagttgctgt 492
to top
>gb|AF150924.1|AF150924 Parategeticula sp. country Mexico cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu gene, complete sequence; and
            cytochrome oxidase subunit II (COII) gene, partial cds;
            mitochondrial genes for mitochondrial products
          Length = 2104

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 2070 catgaatgaattacatcagttgctgt 2045
to top
>gb|AF150923.1|AF150923 Parategeticula sp. country Mexico cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu gene, complete sequence; and
            cytochrome oxidase subunit II (COII) gene, partial cds;
            mitochondrial genes for mitochondrial products
          Length = 2104

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 2070 catgaatgaattacatcagttgctgt 2045
to top
>gb|U04887.1|TMU04887 Tegeticula maculata mitochondrion tRNA-Leu gene, complete sequence,
           and cytochrome oxidase subunit I and II genes, partial
           cds
          Length = 769

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 702 catgaatgaattacatcagttgctgt 677
to top
>gb|U94220.1|SAU94220 Scaptomyza albovittata cytochrome oxidase subunit II (COII) gene,
           mitochondrial gene encoding mitochondrial protein,
           partial cds
          Length = 365

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 164 catgaatgaattccatcagttgctgt 189
           |||||||||||| |||||||||||||
Sbjct: 197 catgaatgaattacatcagttgctgt 172
to top
>gb|U49024.1|TMU49024 Tegeticula maculata maculata cytochrome oxidase subunit I, cytochrome
            oxidase subunit II genes, mitochondrial genes encoding
            mitochondrial proteins, partial cds, and tRNA-Leu gene,
            mitochondrial gene
          Length = 2103

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  catgaatgaattccatcagttgctgt 189
            |||||||||||| |||||||||||||
Sbjct: 2069 catgaatgaattacatcagttgctgt 2044
to top
>gb|AC095247.5| Rattus norvegicus 4 BAC CH230-10C6 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 238466

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 113    atacaaacctacaaacacaaa 133
              |||||||||||||||||||||
Sbjct: 179150 atacaaacctacaaacacaaa 179170
to top
>gb|AC150210.1| Pan troglodytes chromosome X clone RP43-051H11 map human ortholog p21.3,
              complete sequence
          Length = 188797

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 115    acaaacctacaaacacaaaataaag 139
              ||||||| |||||||||||||||||
Sbjct: 106526 acaaaccgacaaacacaaaataaag 106550
to top
>gb|AC087112.2| Rattus norvegicus strain Brown Norway clone RP31-162L19, complete
             sequence
          Length = 149639

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 113   atacaaacctacaaacacaaa 133
             |||||||||||||||||||||
Sbjct: 11262 atacaaacctacaaacacaaa 11282
to top
>gb|AC129328.4| Mus musculus BAC clone RP23-15O6 from chromosome 17, complete sequence
          Length = 234041

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 61    aaagaaaaacaagcaaccaca 81
             |||||||||||||||||||||
Sbjct: 93530 aaagaaaaacaagcaaccaca 93510



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 61    aaagaaaaacaagcaaccaca 81
             |||||||||||||||||||||
Sbjct: 33572 aaagaaaaacaagcaaccaca 33552



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 62     aagaaaaacaagcaaccaca 81
              ||||||||||||||||||||
Sbjct: 153312 aagaaaaacaagcaaccaca 153293
to top
>gb|AC121216.4| Rattus norvegicus 4 CH230-220A21 (Children's Hospital Oakland Research
             Institute) complete sequence
          Length = 224326

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 113   atacaaacctacaaacacaaa 133
             |||||||||||||||||||||
Sbjct: 91659 atacaaacctacaaacacaaa 91679
to top
>emb|AL359532.26| Human DNA sequence from clone RP11-330O11 on chromosome 10 Contains the
              3' end of the gene for a novel protein (LOC220929)
              (FLJ32761), a DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide
              10 (RNA helicase) (DDH10) pseudogene and a CpG island,
              complete sequence
          Length = 179798

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 52     attctgttcaaagaaaaacaa 72
              |||||||||||||||||||||
Sbjct: 165613 attctgttcaaagaaaaacaa 165633
to top
>emb|AL031466.2|HS653H13 Human DNA sequence from clone RP4-653H13 on chromosome Xp11.4-21.3
             Contains part of the IL1RAPL1 gene for interleukin 1
             receptor accessory protein-like 1 and a CpG island,
             complete sequence
          Length = 122269

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 115   acaaacctacaaacacaaaataaag 139
             ||||||| |||||||||||||||||
Sbjct: 31559 acaaaccgacaaacacaaaataaag 31583
to top
>gb|AC117220.4| Mus musculus BAC clone RP23-344H17 from chromosome 17, complete sequence
          Length = 187691

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 61     aaagaaaaacaagcaaccaca 81
              |||||||||||||||||||||
Sbjct: 187577 aaagaaaaacaagcaaccaca 187557



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 61     aaagaaaaacaagcaaccaca 81
              |||||||||||||||||||||
Sbjct: 127618 aaagaaaaacaagcaaccaca 127598



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 61    aaagaaaaacaagcaaccaca 81
             |||||||||||||||||||||
Sbjct: 70403 aaagaaaaacaagcaaccaca 70383



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 62    aagaaaaacaagcaaccaca 81
             ||||||||||||||||||||
Sbjct: 22157 aagaaaaacaagcaaccaca 22138
to top
>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome
          Length = 3304561

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 58      ttcaaagaaaaacaagcaacc 78
               |||||||||||||||||||||
Sbjct: 1960924 ttcaaagaaaaacaagcaacc 1960944
to top
>gb|DP000027.1| Rattus norvegicus target 1 genomic scaffold
          Length = 1888123

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 113     atacaaacctacaaacacaaa 133
               |||||||||||||||||||||
Sbjct: 1003048 atacaaacctacaaacacaaa 1003068
to top
>gb|AC129948.3| Branchiostoma floridae, clone -33B4, complete sequence
          Length = 66265

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 128   cacaaaataaagaagaaattc 148
             |||||||||||||||||||||
Sbjct: 18885 cacaaaataaagaagaaattc 18865
to top
>gb|AC097721.3| Homo sapiens BAC clone RP11-36O6 from 2, complete sequence
          Length = 144493

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 118   aacctacaaacacaaaataaagaagaaat 146
             ||||||| |||||| ||||||||||||||
Sbjct: 94305 aacctactaacacagaataaagaagaaat 94277
to top
>dbj|AB011476.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDA7
          Length = 82033

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 111   atatacaaacctacaaacacaaaat 135
             ||||||| |||||||||||||||||
Sbjct: 26026 atatacatacctacaaacacaaaat 26050
to top
>gb|AC164105.4| Mus musculus BAC clone RP23-433B2 from chromosome 9, complete sequence
          Length = 215089

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 157    caaaatacatgaatgaattccatc 180
              ||||||||||||||||| ||||||
Sbjct: 108902 caaaatacatgaatgaaatccatc 108879
to top
>gb|AC159627.2| Mus musculus BAC clone RP24-202P24 from chromosome 12, complete
             sequence
          Length = 168305

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 50    ttattctgttcaaagaaaaa 69
             ||||||||||||||||||||
Sbjct: 38962 ttattctgttcaaagaaaaa 38981
to top
>gb|AY496797.1| Agrodiaetus turcicolus VL-01-L352 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY496796.1| Agrodiaetus turcicolus VL-01-L348 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY496795.1| Agrodiaetus turcicolus VL-01-L228 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY496793.1| Agrodiaetus surakovi sekercioglu VL-01-L196 cytochrome oxidase
            subunit I (COI) gene, partial cds; tRNA-Leu (trnL) gene,
            complete sequence; and cytochrome oxidase subunit II
            (COII) gene, partial cds; mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY496792.1| Agrodiaetus surakovi surakovi AD-00-P006 cytochrome oxidase subunit I
            (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 1994

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1796 gaatgaattacatcagttgctgtg 1773
to top
>gb|AY496791.1| Agrodiaetus sp. VL-01-B210 cytochrome oxidase subunit I (COI) gene,
            partial cds; tRNA-Leu (trnL) gene, complete sequence; and
            cytochrome oxidase subunit II (COII) gene, partial cds;
            mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY496778.1| Agrodiaetus putnami VL-01-L416 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY496777.1| Agrodiaetus pseudactis AD-00-P263 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY496775.1| Agrodiaetus poseidon VL-01-L108 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY496773.1| Agrodiaetus pierceae VL-01-L365 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 1981

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY496768.1| Agrodiaetus ninae firuze VL-01-L169 cytochrome oxidase subunit I
            (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY496767.1| Agrodiaetus ninae AD-00-P345 cytochrome oxidase subunit I (COI) gene,
            partial cds; tRNA-Leu (trnL) gene, complete sequence; and
            cytochrome oxidase subunit II (COII) gene, partial cds;
            mitochondrial
          Length = 1984

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1794 gaatgaattacatcagttgctgtg 1771
to top
>gb|AY496766.1| Agrodiaetus ninae AD-00-P004 cytochrome oxidase subunit I (COI) gene,
            partial cds; tRNA-Leu (trnL) gene, complete sequence; and
            cytochrome oxidase subunit II (COII) gene, partial cds;
            mitochondrial
          Length = 1980

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1792 gaatgaattacatcagttgctgtg 1769
to top
>gb|AY496764.1| Agrodiaetus merhaba VL-01-L458 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY496762.1| Agrodiaetus kurdistanicus VL-01-L190 cytochrome oxidase subunit I
            (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 2000

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1802 gaatgaattacatcagttgctgtg 1779
to top
>gb|AY496761.1| Agrodiaetus kendevani VL-01-B209 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY496754.1| Agrodiaetus huberti VL-01-L315 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY496753.1| Agrodiaetus huberti VL-01-L123 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY496752.1| Agrodiaetus huberti huberti AD-00-P260 cytochrome oxidase subunit I
            (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 2000

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1802 gaatgaattacatcagttgctgtg 1779
to top
>gb|AY496745.1| Agrodiaetus firdussii VL-01-B199 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY496741.1| Agrodiaetus elbursicus zapvadi VL-01-L195 cytochrome oxidase subunit
            I (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY496723.1| Agrodiaetus carmon munzuricus VL-01-Q129 cytochrome oxidase subunit I
            (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY496722.1| Agrodiaetus carmon carmon VL-01-L262 cytochrome oxidase subunit I
            (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY496721.1| Agrodiaetus bilgini VL-01-Q140 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY496719.1| Agrodiaetus aserbeidschanus VL-01-B033 cytochrome oxidase subunit I
            (COI) gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY496718.1| Agrodiaetus arasbarani neglectus AD-00-P325 cytochrome oxidase
            subunit I (COI) gene, partial cds; tRNA-Leu (trnL) gene,
            complete sequence; and cytochrome oxidase subunit II
            (COII) gene, partial cds; mitochondrial
          Length = 1991

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1794 gaatgaattacatcagttgctgtg 1771
to top
>gb|AY496717.1| Agrodiaetus antidolus VL-01-L270 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu (trnL) gene, complete
            sequence; and cytochrome oxidase subunit II (COII) gene,
            partial cds; mitochondrial
          Length = 2000

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1802 gaatgaattacatcagttgctgtg 1779
to top
>ref|NM_177945.3| Bos taurus peroxisome proliferator activated receptor gamma
            coactivator 1 alpha (PPARGC1A), mRNA
          Length = 6324

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 58   ttcaaagaaaaacaagcaac 77
            ||||||||||||||||||||
Sbjct: 3911 ttcaaagaaaaacaagcaac 3892
to top
>emb|CR847924.7| Zebrafish DNA sequence from clone CH211-261H11 in linkage group 18,
             complete sequence
          Length = 150088

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 39    gattatgcaatttattctgttcaa 62
             |||| |||||||||||||||||||
Sbjct: 39500 gattgtgcaatttattctgttcaa 39523
to top
>gb|AC083946.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-132J21, complete
             sequence
          Length = 200910

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 126   aacacaaaataaagaagaaattcc 149
             |||| |||||||||||||||||||
Sbjct: 57051 aacaaaaaataaagaagaaattcc 57028
to top
>gb|AC148481.9| Medicago truncatula clone mth2-36d21, complete sequence
          Length = 105513

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   atcaaaactgtttccatctt 387
             ||||||||||||||||||||
Sbjct: 39292 atcaaaactgtttccatctt 39273
to top
>gb|AC148291.22| Medicago truncatula clone mth2-14n3, complete sequence
          Length = 138853

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 368    atcaaaactgtttccatctt 387
              ||||||||||||||||||||
Sbjct: 123182 atcaaaactgtttccatctt 123163
to top
>gb|AE017245.1| Mycoplasma synoviae 53, complete genome
          Length = 799476

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 128   cacaaaataaagaagaaatt 147
             ||||||||||||||||||||
Sbjct: 65243 cacaaaataaagaagaaatt 65224
to top
>emb|CR352210.11| Zebrafish DNA sequence from clone DKEY-166N8 in linkage group 23,
              complete sequence
          Length = 180924

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 150    tattacacaaaatacatgaa 169
              ||||||||||||||||||||
Sbjct: 161504 tattacacaaaatacatgaa 161485
to top
>emb|AL590311.5| Human DNA sequence from clone RP11-20F16 on chromosome 9 Contains the
             5' end of the GDA gene for guanine deaminase and a CpG
             island, complete sequence
          Length = 131933

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   aaacacaaaataaagaagaa 144
             ||||||||||||||||||||
Sbjct: 34864 aaacacaaaataaagaagaa 34883
to top
>emb|AL359376.22| Human DNA sequence from clone RP11-366K17 on chromosome 1, complete
             sequence
          Length = 46975

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 129   acaaaataaagaagaaattc 148
             ||||||||||||||||||||
Sbjct: 13138 acaaaataaagaagaaattc 13119
to top
>emb|AL359178.10| Human DNA sequence from clone RP11-481K24 on chromosome 13, complete
            sequence
          Length = 86117

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 40   attatgcaatttattctgtt 59
            ||||||||||||||||||||
Sbjct: 3092 attatgcaatttattctgtt 3073
to top
>emb|CR354401.17| Zebrafish DNA sequence from clone CH211-101C7 in linkage group 12,
             complete sequence
          Length = 168372

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 190   gtaacttcctggcagcagtg 209
             ||||||||||||||||||||
Sbjct: 25648 gtaacttcctggcagcagtg 25667
to top
>emb|CR380957.1| Candida glabrata strain CBS138 chromosome K complete sequence
          Length = 1302002

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 99     tacaattcatcaatatacaa 118
              ||||||||||||||||||||
Sbjct: 586937 tacaattcatcaatatacaa 586918
to top
>emb|CR378677.1| Photobacterium profundum SS9 chromosome 2; segment 3/7
          Length = 348759

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 253    ctagcactatgcttgttggt 272
              ||||||||||||||||||||
Sbjct: 173194 ctagcactatgcttgttggt 173213
to top
>emb|AL589701.9| Mouse DNA sequence from clone RP23-202F3 on chromosome 13 Contains a
             novel gene and the 3' end of a novel gene (1190005B03Rik),
             complete sequence
          Length = 219200

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   acaaaatacatgaatgaatt 175
             ||||||||||||||||||||
Sbjct: 69238 acaaaatacatgaatgaatt 69257
to top
>emb|AL138640.1|ATT12K4 Arabidopsis thaliana DNA chromosome 3, BAC clone T12K4
          Length = 108879

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 119   acctacaaacacaaaataaa 138
             ||||||||||||||||||||
Sbjct: 93417 acctacaaacacaaaataaa 93436
to top
>emb|CR293518.13| Zebrafish DNA sequence from clone CH211-129L10 in linkage group 12,
             complete sequence
          Length = 196374

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 190   gtaacttcctggcagcagtg 209
             ||||||||||||||||||||
Sbjct: 65452 gtaacttcctggcagcagtg 65471
to top
>gb|AY954021.1| Agrodiaetus lukhtanovi cytochrome oxidase subunit I (COI) gene,
            partial cds; tRNA-Leu gene, complete sequence; and
            cytochrome oxidase subunit II (COII) gene, partial cds;
            mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY954006.1| Agrodiaetus rjabovi ssp. NPK-2005 cytochrome oxidase subunit I (COI)
            gene, partial cds; tRNA-Leu gene, complete sequence; and
            cytochrome oxidase subunit II (COII) gene, partial cds;
            mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY953999.1| Agrodiaetus elbursicus cytochrome oxidase subunit I (COI) gene,
            partial cds; tRNA-Leu gene, complete sequence; and
            cytochrome oxidase subunit II (COII) gene, partial cds;
            mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY953997.1| Agrodiaetus firdussii cytochrome oxidase subunit I (COI) gene,
            partial cds; tRNA-Leu gene, complete sequence; and
            cytochrome oxidase subunit II (COII) gene, partial cds;
            mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY953994.1| Agrodiaetus zarathustra cytochrome oxidase subunit I (COI) gene,
            partial cds; tRNA-Leu gene, complete sequence; and
            cytochrome oxidase subunit II (COII) gene, partial cds;
            mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>gb|AY953988.1| Agrodiaetus iphidamon cytochrome oxidase subunit I (COI) gene,
            partial cds; tRNA-Leu gene, complete sequence; and
            cytochrome oxidase subunit II (COII) gene, partial cds;
            mitochondrial
          Length = 1990

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1792 gaatgaattacatcagttgctgtg 1769
to top
>gb|AY953986.1| Agrodiaetus elbursicus cytochrome oxidase subunit I (COI) gene,
            partial cds; tRNA-Leu gene, complete sequence; and
            cytochrome oxidase subunit II (COII) gene, partial cds;
            mitochondrial
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 167  gaatgaattccatcagttgctgtg 190
            ||||||||| ||||||||||||||
Sbjct: 1803 gaatgaattacatcagttgctgtg 1780
to top
>emb|BX511029.9| Zebrafish DNA sequence from clone DKEY-18H21 in linkage group 3,
             complete sequence
          Length = 151867

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 116   caaacctacaaacacaaaataaag 139
             ||||||| ||||||||||||||||
Sbjct: 93124 caaacctgcaaacacaaaataaag 93147
to top
>gb|AC114913.4| Homo sapiens BAC clone RP11-588P8 from 4, complete sequence
          Length = 17375

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 124   caaacacaaaataaagaaga 143
             ||||||||||||||||||||
Sbjct: 11744 caaacacaaaataaagaaga 11725
to top
>gb|AC105245.4| Homo sapiens chromosome 18, clone CTD-2515C13, complete sequence
          Length = 200721

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 124   caaacacaaaataaagaagaaatt 147
             |||||| |||||||||||||||||
Sbjct: 67756 caaacaaaaaataaagaagaaatt 67733
to top
>gb|AC090349.7| Homo sapiens chromosome 18, clone RP11-844N22, complete sequence
          Length = 132191

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 124    caaacacaaaataaagaagaaatt 147
              |||||| |||||||||||||||||
Sbjct: 110810 caaacaaaaaataaagaagaaatt 110787
to top
>gb|AY321517.1| Bos taurus peroxisome proliferator activated receptor gamma
            coactivator 1 alpha (PPARGC1A) mRNA, complete cds
          Length = 6324

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 58   ttcaaagaaaaacaagcaac 77
            ||||||||||||||||||||
Sbjct: 3911 ttcaaagaaaaacaagcaac 3892
to top
>dbj|AK032149.1| Mus musculus adult male olfactory brain cDNA, RIKEN full-length
           enriched library, clone:6430402E12 product:hypothetical
           protein, full insert sequence
          Length = 1803

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 58  ttcaaagaaaaacaagcaac 77
           ||||||||||||||||||||
Sbjct: 529 ttcaaagaaaaacaagcaac 510
to top
>dbj|AK082685.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:C230085P21
           product:unclassifiable, full insert sequence
          Length = 1172

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 58  ttcaaagaaaaacaagcaac 77
           ||||||||||||||||||||
Sbjct: 533 ttcaaagaaaaacaagcaac 514
to top
>dbj|AK043827.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length
           enriched library, clone:A830037N07 product:hypothetical
           protein, full insert sequence
          Length = 1616

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 58  ttcaaagaaaaacaagcaac 77
           ||||||||||||||||||||
Sbjct: 563 ttcaaagaaaaacaagcaac 544
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 49      tttattctgttcaaagaaaa 68
               ||||||||||||||||||||
Sbjct: 9730829 tttattctgttcaaagaaaa 9730848
to top
>gb|AC012307.8| Homo sapiens BAC clone RP11-574O17 from 2, complete sequence
          Length = 145918

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 446   tcttggttctactccaactc 465
             ||||||||||||||||||||
Sbjct: 84407 tcttggttctactccaactc 84388
to top
>gb|AC062039.3| Homo sapiens BAC clone RP11-814A15 from 2, complete sequence
          Length = 141040

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 40     attatgcaatttattctgttcaaa 63
              |||||| |||||||||||||||||
Sbjct: 139268 attatgtaatttattctgttcaaa 139291
to top
>gb|AC005034.2| Homo sapiens BAC clone RP11-342K6 from 2, complete sequence
          Length = 198587

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 52     attctgttcaaagaaaaacaagca 75
              |||||||||||||||||| |||||
Sbjct: 110781 attctgttcaaagaaaaaaaagca 110758
to top
>gb|AC013401.10| Homo sapiens BAC clone RP11-98N11 from 2, complete sequence
          Length = 168595

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 40  attatgcaatttattctgttcaaa 63
           |||||| |||||||||||||||||
Sbjct: 228 attatgtaatttattctgttcaaa 251
to top
>dbj|AP005863.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
            clone:OSJNBa0040N23
          Length = 101061

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 49   tttattctgttcaaagaaaa 68
            ||||||||||||||||||||
Sbjct: 3248 tttattctgttcaaagaaaa 3267
to top
>dbj|AP005811.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0706E03
          Length = 188028

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 49     tttattctgttcaaagaaaa 68
              ||||||||||||||||||||
Sbjct: 170926 tttattctgttcaaagaaaa 170945
to top
>gb|AF026395.1|AF026395 Saccharomyces servazzii Oxa1p (OXA1) and Pet122p (PET122) genes,
            complete cds
          Length = 2800

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 124  caaacacaaaataaagaagaaatt 147
            |||| |||||||||||||||||||
Sbjct: 2562 caaaaacaaaataaagaagaaatt 2585
to top
>emb|BX004853.7| Zebrafish DNA sequence from clone DKEY-13O11, complete sequence
          Length = 182526

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 53     ttctgttcaaagaaaaacaa 72
              ||||||||||||||||||||
Sbjct: 173598 ttctgttcaaagaaaaacaa 173579
to top
>gb|AC172989.2| Mus musculus BAC clone RP24-556J6 from chromosome 15, complete sequence
          Length = 184996

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   ttccatcagttgctgtgtaa 193
             ||||||||||||||||||||
Sbjct: 63465 ttccatcagttgctgtgtaa 63446
to top
>emb|AL591977.1| Listeria monocytogenes strain EGD, complete genome, segment 5/12
          Length = 270050

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 123    acaaacacaaaataaagaag 142
              ||||||||||||||||||||
Sbjct: 265500 acaaacacaaaataaagaag 265481
to top
>emb|AL928607.8| Mouse DNA sequence from clone RP23-326J18 on chromosome 2, complete
             sequence
          Length = 128293

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 135   taaagaagaaattcctatta 154
             ||||||||||||||||||||
Sbjct: 97213 taaagaagaaattcctatta 97194
to top
>gb|AC167818.4| Mus musculus BAC clone RP23-120O24 from chromosome 15, complete
             sequence
          Length = 203474

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   ttccatcagttgctgtgtaa 193
             ||||||||||||||||||||
Sbjct: 28021 ttccatcagttgctgtgtaa 28002
to top
>gb|AC116763.11| Mus musculus chromosome 5, clone RP23-385G21, complete sequence
          Length = 196521

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     ttcaaagaaaaacaagcaac 77
              ||||||||||||||||||||
Sbjct: 113671 ttcaaagaaaaacaagcaac 113652
to top
>emb|AL451009.3| Human DNA sequence from clone RP11-440G22 on chromosome 1, complete
            sequence
          Length = 68697

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 129  acaaaataaagaagaaattc 148
            ||||||||||||||||||||
Sbjct: 6056 acaaaataaagaagaaattc 6037
to top
>dbj|AP002358.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-1036E20, complete
             sequences
          Length = 190904

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 471   aagtgtagctgaaggtacag 490
             ||||||||||||||||||||
Sbjct: 78737 aagtgtagctgaaggtacag 78756


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,962,221
Number of Sequences: 3902068
Number of extensions: 5962221
Number of successful extensions: 136599
Number of sequences better than 10.0: 190
Number of HSP's better than 10.0 without gapping: 190
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 136153
Number of HSP's gapped (non-prelim): 446
length of query: 534
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 511
effective length of database: 17,143,297,704
effective search space: 8760225126744
effective search space used: 8760225126744
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top