ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart10a11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC124441.5| Mus musculus BAC clone RP24-176L17 from chromosom... 42 0.45
2ref|XM_718896.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 42 0.45
3gb|AC011992.3| Homo sapiens BAC clone CTD-2327A23 from 7, comple... 42 0.45
4gb|AC122863.4| Mus musculus BAC clone RP23-142A14 from chromosom... 40 1.8
5gb|AC122537.4| Mus musculus BAC clone RP24-548A15 from chromosom... 40 1.8
6gb|AC146819.19| Medicago truncatula clone mth2-176k6, complete s... 40 1.8
7gb|AC133341.11| Medicago truncatula clone mth2-28i3, complete se... 40 1.8
8gb|AC113250.3| Drosophila melanogaster 3L BAC RP98-6P13 (Roswell... 40 1.8
9gb|AC079246.2| Homo sapiens BAC clone CTD-2002G20 from 2, comple... 40 1.8
10gb|AE003529.3| Drosophila melanogaster chromosome 3L, section 56... 40 1.8
11gb|AC148868.3| Pan troglodytes BAC clone CH251-126E24 from Y, co... 38 7.0
12gb|AC147877.10| Medicago truncatula clone mth2-9b13, complete se... 38 7.0
13gb|AC140849.8| Medicago truncatula clone mth2-17f20, complete se... 38 7.0
14emb|AL161913.11| Human DNA sequence from clone RP11-64P11 on chr... 38 7.0
15emb|BX323071.16| Zebrafish DNA sequence from clone DKEYP-51F12, ... 38 7.0
16emb|BX649302.22| Zebrafish DNA sequence from clone CH211-248I6 i... 38 7.0
17gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 38 7.0
18emb|AJ249405.1|ASQ249405 Aphelandra squarrosa chloroplast partia... 38 7.0
19gb|AF410153.1| Swinepox virus isolate 17077-99, complete genome 38 7.0
20gb|AC159110.2| Pan troglodytes BAC clone CH251-533A11 from chrom... 38 7.0
21gb|AC149094.4| Pan troglodytes BAC clone CH251-268E10 from chrom... 38 7.0
22gb|AC148874.4| Pan troglodytes BAC clone CH251-429C12 from chrom... 38 7.0
23gb|AE004743.1| Pseudomonas aeruginosa PAO1, section 304 of 529 o... 38 7.0
24emb|BX255940.4| Zebrafish DNA sequence from clone DKEY-3P8 in li... 38 7.0
25gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome 38 7.0
26emb|BX927255.9| Zebrafish DNA sequence from clone CH211-266I18 i... 38 7.0
27emb|BX284682.7| Zebrafish DNA sequence from clone DKEYP-74C5 in ... 38 7.0
28gb|AY228504.1| Xiphorphorus macualtus xmrk gene, partial sequenc... 38 7.0
29gb|AC159650.5| Pan troglodytes BAC clone CH251-379D1 from chromo... 38 7.0
30gb|U50932.1|PAU50932 Pseudomonas aeruginosa glucose uptake regul... 38 7.0
31dbj|BA000009.3| Beta vulgaris subsp. vulgaris mitochondrial geno... 38 7.0
32dbj|BA000024.1| Beta vulgaris subsp. vulgaris mitochondrial geno... 38 7.0

>gb|AC124441.5| Mus musculus BAC clone RP24-176L17 from chromosome 18, complete sequence
          Length = 190119

 Score = 42.1 bits (21), Expect = 0.45
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 4      gcatgacataacattaacata 24
              |||||||||||||||||||||
Sbjct: 153707 gcatgacataacattaacata 153687



to top

>ref|XM_718896.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY03787)
           partial mRNA
          Length = 369

 Score = 42.1 bits (21), Expect = 0.45
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 8   gacataacattaacatattggaata 32
           ||||||| |||||||||||||||||
Sbjct: 268 gacataaaattaacatattggaata 292



to top

>gb|AC011992.3| Homo sapiens BAC clone CTD-2327A23 from 7, complete sequence
          Length = 80515

 Score = 42.1 bits (21), Expect = 0.45
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 39    aacaaacagcataactaattc 59
             |||||||||||||||||||||
Sbjct: 60766 aacaaacagcataactaattc 60786



to top

>gb|AC122863.4| Mus musculus BAC clone RP23-142A14 from chromosome 7, complete sequence
          Length = 226601

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 80     acttggaaaactttagtgtg 99
              ||||||||||||||||||||
Sbjct: 223412 acttggaaaactttagtgtg 223431



to top

>gb|AC122537.4| Mus musculus BAC clone RP24-548A15 from chromosome 7, complete sequence
          Length = 195987

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 80    acttggaaaactttagtgtg 99
             ||||||||||||||||||||
Sbjct: 57747 acttggaaaactttagtgtg 57766



to top

>gb|AC146819.19| Medicago truncatula clone mth2-176k6, complete sequence
          Length = 127131

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 6     atgacataacattaacatat 25
             ||||||||||||||||||||
Sbjct: 25983 atgacataacattaacatat 25964



to top

>gb|AC133341.11| Medicago truncatula clone mth2-28i3, complete sequence
          Length = 138850

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 6     atgacataacattaacatat 25
             ||||||||||||||||||||
Sbjct: 12184 atgacataacattaacatat 12203



to top

>gb|AC113250.3| Drosophila melanogaster 3L BAC RP98-6P13 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 168299

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 76     taggacttggaaaactttagtgtg 99
              |||||||||||||||||| |||||
Sbjct: 116737 taggacttggaaaacttttgtgtg 116714



to top

>gb|AC079246.2| Homo sapiens BAC clone CTD-2002G20 from 2, complete sequence
          Length = 99940

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 120   gactggacacggttttatgaaggacaga 147
             ||||||||| | ||||||||||||||||
Sbjct: 83705 gactggacaagtttttatgaaggacaga 83732



to top

>gb|AE003529.3| Drosophila melanogaster chromosome 3L, section 56 of 83 of the complete
              sequence
          Length = 252201

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 76     taggacttggaaaactttagtgtg 99
              |||||||||||||||||| |||||
Sbjct: 110575 taggacttggaaaacttttgtgtg 110552



to top

>gb|AC148868.3| Pan troglodytes BAC clone CH251-126E24 from Y, complete sequence
          Length = 170533

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 80   acttggaaaactttagtgtggaa 102
            ||||||||| |||||||||||||
Sbjct: 7732 acttggaaatctttagtgtggaa 7710



to top

>gb|AC147877.10| Medicago truncatula clone mth2-9b13, complete sequence
          Length = 122251

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 2     gagcatgacataacattaa 20
             |||||||||||||||||||
Sbjct: 16535 gagcatgacataacattaa 16517



to top

>gb|AC140849.8| Medicago truncatula clone mth2-17f20, complete sequence
          Length = 136131

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 2     gagcatgacataacattaa 20
             |||||||||||||||||||
Sbjct: 53649 gagcatgacataacattaa 53667



to top

>emb|AL161913.11| Human DNA sequence from clone RP11-64P11 on chromosome 9, complete
              sequence
          Length = 137897

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 80     acttggaaaactttagtgtggaa 102
              ||||||||||||||||| |||||
Sbjct: 133133 acttggaaaactttagtctggaa 133111



to top

>emb|BX323071.16| Zebrafish DNA sequence from clone DKEYP-51F12, complete sequence
          Length = 208116

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 7      tgacataacattaacatat 25
              |||||||||||||||||||
Sbjct: 176917 tgacataacattaacatat 176899



to top

>emb|BX649302.22| Zebrafish DNA sequence from clone CH211-248I6 in linkage group 12,
              complete sequence
          Length = 154089

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 7      tgacataacattaacatat 25
              |||||||||||||||||||
Sbjct: 123566 tgacataacattaacatat 123548



to top

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                       
Query: 80       acttggaaaactttagtgtggaa 102
                ||||||||| |||||||||||||
Sbjct: 13101931 acttggaaatctttagtgtggaa 13101909



 Score = 38.2 bits (19), Expect = 7.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                      
Query: 80      acttggaaaactttagtgtggaa 102
               ||||||||| |||||||||||||
Sbjct: 4797534 acttggaaatctttagtgtggaa 4797556



 Score = 38.2 bits (19), Expect = 7.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                      
Query: 80      acttggaaaactttagtgtggaa 102
               ||||||||| |||||||||||||
Sbjct: 1142216 acttggaaatctttagtgtggaa 1142238



to top

>emb|AJ249405.1|ASQ249405 Aphelandra squarrosa chloroplast partial ndhF gene for NADH
           dehydrogenase
          Length = 2000

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 12  taacattaacatattggaa 30
           |||||||||||||||||||
Sbjct: 211 taacattaacatattggaa 193



to top

>gb|AF410153.1| Swinepox virus isolate 17077-99, complete genome
          Length = 146454

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                        
Query: 5     catgacataacattaacatattggaat 31
             |||||||||||||||||| ||| ||||
Sbjct: 49961 catgacataacattaacagatttgaat 49935



to top

>gb|AC159110.2| Pan troglodytes BAC clone CH251-533A11 from chromosome y, complete
              sequence
          Length = 174450

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 80     acttggaaaactttagtgtggaa 102
              ||||||||| |||||||||||||
Sbjct: 168754 acttggaaatctttagtgtggaa 168732



to top

>gb|AC149094.4| Pan troglodytes BAC clone CH251-268E10 from chromosome y, complete
              sequence
          Length = 175247

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 80     acttggaaaactttagtgtggaa 102
              ||||||||| |||||||||||||
Sbjct: 167503 acttggaaatctttagtgtggaa 167525



to top

>gb|AC148874.4| Pan troglodytes BAC clone CH251-429C12 from chromosome y, complete
             sequence
          Length = 168193

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 80    acttggaaaactttagtgtggaa 102
             ||||||||| |||||||||||||
Sbjct: 71348 acttggaaatctttagtgtggaa 71370



to top

>gb|AE004743.1| Pseudomonas aeruginosa PAO1, section 304 of 529 of the complete
            genome
          Length = 10146

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 114  actggcgactggacacggt 132
            |||||||||||||||||||
Sbjct: 3620 actggcgactggacacggt 3602



to top

>emb|BX255940.4| Zebrafish DNA sequence from clone DKEY-3P8 in linkage group 20, complete
              sequence
          Length = 211261

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 9      acataacattaacatattg 27
              |||||||||||||||||||
Sbjct: 183608 acataacattaacatattg 183626



to top

>gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome
          Length = 3940880

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 54      taattcttgttcgaggtaa 72
               |||||||||||||||||||
Sbjct: 2989830 taattcttgttcgaggtaa 2989812



to top

>emb|BX927255.9| Zebrafish DNA sequence from clone CH211-266I18 in linkage group 20,
             complete sequence
          Length = 155519

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 36    actaacaaacagcataactaatt 58
             ||||||||||||| |||||||||
Sbjct: 24833 actaacaaacagcctaactaatt 24855



to top

>emb|BX284682.7| Zebrafish DNA sequence from clone DKEYP-74C5 in linkage group 22,
              complete sequence
          Length = 206289

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 9      acataacattaacatattg 27
              |||||||||||||||||||
Sbjct: 201064 acataacattaacatattg 201046



to top

>gb|AY228504.1| Xiphorphorus macualtus xmrk gene, partial sequence and 3' flanking
             region
          Length = 71813

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 6     atgacataacattaacata 24
             |||||||||||||||||||
Sbjct: 10192 atgacataacattaacata 10174



to top

>gb|AC159650.5| Pan troglodytes BAC clone CH251-379D1 from chromosome y, complete
             sequence
          Length = 214370

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 80    acttggaaaactttagtgtggaa 102
             ||||||||| |||||||||||||
Sbjct: 96909 acttggaaatctttagtgtggaa 96887



to top

>gb|U50932.1|PAU50932 Pseudomonas aeruginosa glucose uptake regulatory protein (gltR)
           gene, complete cds
          Length = 1197

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 114 actggcgactggacacggt 132
           |||||||||||||||||||
Sbjct: 486 actggcgactggacacggt 504



to top

>dbj|BA000009.3| Beta vulgaris subsp. vulgaris mitochondrial genomic DNA, complete
              sequence
          Length = 368801

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 68     ggtaataataggacttgga 86
              |||||||||||||||||||
Sbjct: 165401 ggtaataataggacttgga 165419



to top

>dbj|BA000024.1| Beta vulgaris subsp. vulgaris mitochondrial genomic DNA, complete
              sequence
          Length = 501020

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 68     ggtaataataggacttgga 86
              |||||||||||||||||||
Sbjct: 395603 ggtaataataggacttgga 395621



 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 68     ggtaataataggacttgga 86
              |||||||||||||||||||
Sbjct: 221091 ggtaataataggacttgga 221073


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,277,706
Number of Sequences: 3902068
Number of extensions: 1277706
Number of successful extensions: 79832
Number of sequences better than 10.0: 32
Number of HSP's better than 10.0 without gapping: 33
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79682
Number of HSP's gapped (non-prelim): 150
length of query: 147
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 126
effective length of database: 17,151,101,840
effective search space: 2161038831840
effective search space used: 2161038831840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top