Clone Information

BLAST Search Result

Clone Name	rbart09h12
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	gb\|AY108456.1\| Zea mays PCO091049 mRNA sequence	133	5e-28
2	ref\|XM_480184.1\| Oryza sativa (japonica cultivar-group), mRNA	109	8e-21
3	dbj\|AP008214.1\| Oryza sativa (japonica cultivar-group) genomic D...	109	8e-21
4	dbj\|AP004460.2\| Oryza sativa (japonica cultivar-group) genomic D...	109	8e-21
5	dbj\|AK108144.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	109	8e-21
6	emb\|AL929566.30\| Zebrafish DNA sequence from clone CH211-159C13 ...	48	0.024
7	gb\|AC087269.5\| Homo sapiens chromosome 8, clone RP11-211C9, comp...	48	0.024
8	gb\|AC093176.6\| Mus musculus Strain C57BL6/J chromosome 6 BAC, RP...	46	0.097
9	gb\|AC026250.16\| Homo sapiens chromosome 11, clone RP11-540A21, c...	46	0.097
10	emb\|CR352330.14\| Mouse DNA sequence from clone RP23-374F1 on chr...	46	0.097
11	emb\|BX901908.8\| Zebrafish DNA sequence from clone DKEY-268B12 in...	46	0.097
12	emb\|AL954657.14\| Zebrafish DNA sequence from clone CH211-223E21 ...	46	0.097
13	emb\|CR855311.15\| Zebrafish DNA sequence from clone DKEY-97I18 in...	46	0.097
14	gb\|U79397.1\|MGU79397 Meleagris gallopavo microsatellite repeat s...	46	0.097
15	gb\|U79330.1\|MGU79330 Meleagris gallopavo microsatellite repeat s...	46	0.097
16	dbj\|AP002387.4\| Homo sapiens genomic DNA, chromosome 11 clone:RP...	46	0.097
17	dbj\|AP004370.2\| Homo sapiens genomic DNA, chromosome 11q clone:R...	46	0.097
18	gb\|AC164398.8\| Mus musculus chromosome 7, clone RP23-307M24, com...	44	0.38
19	gb\|AC153607.15\| Mus musculus 6 BAC RP23-100I21 (Roswell Park Can...	44	0.38
20	gb\|AC146249.2\| Pan troglodytes BAC clone CH251-140O11 from Y, co...	44	0.38
21	gb\|AC158347.4\| Mus musculus chromosome 3, clone RP23-380F8, comp...	44	0.38
22	gb\|AC123934.2\| Mus musculus BAC clone RP23-354D22 from chromosom...	44	0.38
23	gb\|AC105304.24\| Mus musculus strain C57BL/6J clone rp23-71k5 map...	44	0.38
24	emb\|AL161774.49\| Human DNA sequence from clone RP11-245B11 on ch...	44	0.38
25	emb\|AL121761.5\|HSJ122P22 Human DNA sequence from clone RP1-122P2...	44	0.38
26	emb\|AL096763.14\|HSJ1129A6 Human DNA sequence from clone RP5-1129...	44	0.38
27	emb\|AL050312.8\|HSBA9F11 Human DNA sequence from clone RP11-9F11 ...	44	0.38
28	dbj\|BS000599.1\| Pan troglodytes chromosome Y clone:PTB-225K16, c...	44	0.38
29	gb\|DP000054.1\| Pan troglodytes chromosome Y, partial sequence	44	0.38
30	gb\|AC099550.5\| Homo sapiens BAC clone RP11-484O2 from 4, complet...	44	0.38
31	ref\|NG_002806.1\| Homo sapiens adlican pseudogene (ADLICANP) on c...	44	0.38
32	gb\|AC136735.7\| Mus musculus chromosome 3, clone RP23-175G2, comp...	44	0.38
33	gb\|AC107739.9\| Mus musculus chromosome 7, clone RP23-345M1, comp...	44	0.38
34	gb\|AC011302.3\|AC011302 Homo sapiens BAC clone RP11-333E9 from Y,...	44	0.38
35	gb\|AC144818.4\| Mus musculus BAC clone RP23-97O1 from chromosome ...	44	0.38
36	emb\|AL731871.12\| Mouse DNA sequence from clone RP23-111J19 on ch...	44	0.38
37	dbj\|D13384.1\|TFLPLABPII Snake BP-II gene for phospholipase A2, c...	44	0.38
38	dbj\|D13383.1\|TFLPLABPI Snake BP-I gene for phospholipase A2, com...	44	0.38
39	dbj\|AP000867.5\| Homo sapiens genomic DNA, chromosome 11 clone:RP...	44	0.38
40	gb\|AC104882.30\| Mus musculus chromosome 8, clone RP23-401L9, com...	42	1.5
41	gb\|CP000081.1\| Leishmania major chromosome 35, complete sequence	42	1.5
42	gb\|AY577942.1\| Petromyzon marinus clone PAC4 variable lymphocyte...	42	1.5
43	gb\|AC147555.2\| Mus musculus BAC clone RP23-478E6 from chromosome...	42	1.5
44	gb\|AY079050.1\| Mus musculus tongue plunc-like protein (Tpl) gene...	42	1.5
45	gb\|AC151266.4\| Mus musculus BAC clone RP24-279K24 from chromosom...	42	1.5
46	gb\|AC126944.3\| Mus musculus BAC clone RP23-19A4 from chromosome ...	42	1.5
47	gb\|AC005056.2\| Homo sapiens BAC clone CTB-51J22 from 7, complete...	42	1.5
48	gb\|AC124496.3\| Mus musculus BAC clone RP23-471J10 from chromosom...	42	1.5
49	gb\|AC125410.4\| Mus musculus BAC clone RP23-146N3 from 3, complet...	42	1.5
50	gb\|AC116827.7\| Mus musculus chromosome 18, clone RP24-370N5, com...	42	1.5
51	gb\|AC102105.8\| Mus musculus chromosome 12, clone RP23-89G24, com...	42	1.5
52	emb\|AL445931.29\| Human DNA sequence from clone RP11-374P20 on ch...	42	1.5
53	emb\|AL358593.22\| Human DNA sequence from clone RP11-473A10 on ch...	42	1.5
54	emb\|AL355137.23\| Human DNA sequence from clone RP11-511D14 on ch...	42	1.5
55	gb\|AC158213.4\| Mus musculus chromosome 7, clone RP24-253H20, com...	42	1.5
56	emb\|BX883047.1\| Rattus norvegicus chromosome 20, major histocomp...	42	1.5
57	ref\|NM_001016226.2\| Xenopus tropicalis CBF1 interacting corepres...	42	1.5
58	emb\|BX537273.16\| Zebrafish DNA sequence from clone CH211-151F2 i...	42	1.5
59	emb\|BX510991.10\| Zebrafish DNA sequence from clone RP71-44C4 in ...	42	1.5
60	emb\|BX649460.11\| Zebrafish DNA sequence from clone CH211-286F20 ...	42	1.5
61	gb\|AC009093.10\| Homo sapiens chromosome 16 clone RP11-426C22, co...	42	1.5
62	dbj\|AK157495.1\| Mus musculus activated spleen cDNA, RIKEN full-l...	42	1.5
63	gb\|AC008985.7\| Homo sapiens chromosome 19 clone LLNLF-198H7, com...	42	1.5
64	gb\|AC005089.3\| Homo sapiens BAC clone CTA-315H11 from 7, complet...	42	1.5
65	gb\|AC026791.4\|AC026791 Homo sapiens chromosome 5 clone CTD-2265D...	42	1.5
66	gb\|AC138512.4\| Homo sapiens chromosome 16 clone RP11-93B18, comp...	42	1.5
67	gb\|AC100735.15\| Mus musculus chromosome 7, clone RP24-331F7, com...	42	1.5
68	gb\|AC149590.5\| Mus musculus BAC clone RP23-348L9 from chromosome...	42	1.5
69	gb\|AC138433.2\| Homo sapiens chromosome 19 clone XXfos-85899E4, c...	42	1.5
70	gb\|AC006124.2\| Homo sapiens chromosome 19, cosmid R34739, comple...	42	1.5
71	gb\|AC025279.6\| Homo sapiens chromosome 16 clone RP11-231C14, com...	42	1.5
72	emb\|BX649428.7\| Zebrafish DNA sequence from clone CH211-51A6 in ...	42	1.5
73	dbj\|AP004648.3\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
74	emb\|BX511298.10\| Zebrafish DNA sequence from clone DKEY-210E13 i...	42	1.5
75	gb\|AC107631.20\| Mus musculus chromosome 5, clone RP23-5M20, comp...	42	1.5
76	emb\|BX927333.11\| Zebrafish DNA sequence from clone CH211-69C15 i...	42	1.5
77	emb\|CR926299.2\| Xenopus tropicalis finished cDNA, clone TEgg080d21	42	1.5
78	gb\|AC103664.12\| Mus musculus chromosome 7, clone RP23-348F4, com...	42	1.5
79	gb\|AC153562.2\| Mus musculus 10 BAC RP23-143D12 (Roswell Park Can...	42	1.5
80	emb\|AL845461.11\| Mouse DNA sequence from clone RP23-331F18 on ch...	42	1.5
81	gb\|AC153560.5\| Mus musculus 10 BAC RP23-376E10 (Roswell Park Can...	42	1.5
82	gb\|AC005264.1\|AC005264 Homo sapiens chromosome 19, cosmid R31335...	42	1.5
83	gb\|AC104098.5\| Mus musculus BAC clone RP24-372H3 from 5, complet...	42	1.5
84	gb\|AC002110.1\|AC002110 Genomic sequence from Human 9q34, complet...	42	1.5
85	gb\|AC002104.1\|AC002104 Genomic sequence from Human 9q34, complet...	42	1.5
86	gb\|AC000405.1\|AC000405 Genomic sequence from Human 9q34, complet...	42	1.5
87	gb\|AC136837.1\| Homo sapiens chromosome 16 clone RP11-483N11, com...	42	1.5
88	gb\|AC091401.2\| Sus scrofa clone RP44-198J22, complete sequence	42	1.5
89	emb\|AL512356.6\|CNS07EF5 Human chromosome 14 DNA sequence BAC R-4...	42	1.5
90	emb\|AL591204.14\| Mouse DNA sequence from clone RP23-28C17 on chr...	42	1.5
91	gb\|AC122562.8\| Mus musculus chromosome 5, clone RP24-103L16, com...	40	6.0
92	gb\|AC098644.4\| Takifugu rubripes clone 205P11, complete sequence	40	6.0
93	gb\|AC138265.9\| Mus musculus chromosome 5, clone RP23-41J13, comp...	40	6.0
94	gb\|AC122005.3\| Mus musculus chromosome 5 clone RP24-340B11, comp...	40	6.0
95	gb\|AC113041.9\| Mus musculus chromosome 8, clone RP23-240K12, com...	40	6.0
96	gb\|AC144767.4\| Mus musculus BAC clone RP23-82F8 from chromosome ...	40	6.0
97	gb\|AC153356.5\| Mus musculus BAC clone RP24-477I13 from chromosom...	40	6.0
98	gb\|AC112962.15\| Mus musculus chromosome 19, clone RP24-74N6, com...	40	6.0
99	gb\|AC102291.7\| Mus musculus chromosome 15, clone RP24-366F6, com...	40	6.0
100	gb\|AC124228.16\| Mus musculus chromosome 5, clone RP23-345O14, co...	40	6.0
101	gb\|AY207448.1\| Hemibagrus nemurus clone Mnbp5-2-05 microsatellit...	40	6.0
102	gb\|AC123662.13\| Mus musculus chromosome 5, clone RP23-213N8, com...	40	6.0
103	gb\|AC151715.3\| Mus musculus BAC clone RP23-396L12 from chromosom...	40	6.0
104	gb\|AC135079.9\| Mus musculus chromosome 15, clone RP24-439P7, com...	40	6.0
105	gb\|AC131725.2\| Mus musculus BAC clone RP23-129H16 from chromosom...	40	6.0
106	gb\|AC147377.4\| Mus musculus BAC clone RP23-156K23 from chromosom...	40	6.0
107	gb\|AC183804.3\| Pan troglodytes BAC clone CH251-67P16 from chromo...	40	6.0
108	gb\|AC140302.2\| Mus musculus BAC clone RP24-321I14 from chromosom...	40	6.0
109	gb\|AC141426.3\| Mus musculus BAC clone RP23-280I14 from chromosom...	40	6.0
110	gb\|DQ481667.1\| Takifugu rubripes HoxCa gene cluster, complete se...	40	6.0
111	gb\|AC137154.2\| Mus musculus BAC clone RP24-572L22 from chromosom...	40	6.0
112	gb\|AC124374.5\| Mus musculus BAC clone RP24-567K8 from chromosome...	40	6.0
113	gb\|AC144758.2\| Danio rerio, complete sequence	40	6.0
114	gb\|AC006012.2\| Homo sapiens PAC clone RP5-942I16 from 7, complet...	40	6.0
115	gb\|AC101737.6\| Mus musculus chromosome 1, clone RP23-471L1, comp...	40	6.0
116	gb\|AC115800.13\| Mus musculus chromosome 8, clone RP23-407E22, co...	40	6.0
117	gb\|AC134832.5\| Mus musculus BAC clone RP24-561D12 from chromosom...	40	6.0
118	emb\|CR388131.10\| Zebrafish DNA sequence from clone DKEY-114G9 in...	40	6.0
119	gb\|AC007616.5\| Homo sapiens chromosome 16 clone RP11-547D14, com...	40	6.0
120	gb\|AC007613.8\| Homo sapiens chromosome 16 clone RP11-490O6, comp...	40	6.0
121	gb\|AC137749.11\| Mus musculus chromosome 6, clone RP23-69C16, com...	40	6.0
122	emb\|CR936360.14\| Human DNA sequence from clone RP13-440N7 on chr...	40	6.0
123	emb\|CR855305.12\| Zebrafish DNA sequence from clone DKEY-98F17 in...	40	6.0
124	gb\|AC127264.4\| Mus musculus BAC clone RP24-336J13 from chromosom...	40	6.0
125	gb\|AC124520.4\| Mus musculus BAC clone RP23-395G14 from chromosom...	40	6.0
126	gb\|AC068594.15\| Homo sapiens chromosome 17, clone RP11-285E9, co...	40	6.0
127	gb\|AC121771.3\| Mus musculus BAC clone RP23-348H21 from chromosom...	40	6.0
128	gb\|AC091092.3\| Papio anubis clone RP41-191D8, complete sequence	40	6.0
129	gb\|AC125050.6\| Mus musculus BAC clone RP23-372I18 from chromosom...	40	6.0
130	gb\|AC126263.4\| Mus musculus BAC clone RP23-359P12 from chromosom...	40	6.0
131	gb\|AC125207.5\| Mus musculus BAC clone RP23-220C16 from 8, comple...	40	6.0
132	emb\|CR735141.14\| Zebrafish DNA sequence from clone CH211-128E9 i...	40	6.0
133	gb\|AC124198.2\| Mus musculus BAC clone RP23-306E4 from 8, complet...	40	6.0
134	gb\|AC006001.2\| Homo sapiens PAC clone RP4-756H11 from 7, complet...	40	6.0
135	gb\|AC113085.6\| Mus musculus chromosome 8, clone RP23-292P21, com...	40	6.0
136	gb\|AC101833.14\| Mus musculus chromosome 1, clone RP24-496H15, co...	40	6.0
137	emb\|CR559944.12\| Zebrafish DNA sequence from clone CH211-10D19 i...	40	6.0
138	gb\|AC158914.4\| Mus musculus chromosome 5, clone RP24-249F11, com...	40	6.0
139	emb\|CR391930.9\| Zebrafish DNA sequence from clone CH211-154B16 i...	40	6.0
140	emb\|AL831732.18\| Human DNA sequence from clone RP11-396L10 on ch...	40	6.0
141	emb\|Z84475.1\|HS162C6 Human DNA sequence from clone RP1-162C6 on ...	40	6.0
142	emb\|BX908382.8\| Human DNA sequence from clone WI2-87105E3 on chr...	40	6.0
143	emb\|AL607044.24\| Human DNA sequence from clone RP13-392N17 on ch...	40	6.0
144	emb\|AL606510.10\| Human DNA sequence from clone RP11-435D11 on ch...	40	6.0
145	emb\|AL592549.7\| Human DNA sequence from clone RP11-374B16 on chr...	40	6.0
146	emb\|AL592156.4\| Human DNA sequence from clone RP11-492O8 on chro...	40	6.0
147	emb\|AL512383.11\| Human DNA sequence from clone RP11-193J6 on chr...	40	6.0
148	emb\|AL513304.27\| Human DNA sequence from clone RP11-398B16 on ch...	40	6.0
149	emb\|AL451164.13\| Human DNA sequence from clone RP11-298E9 on chr...	40	6.0
150	emb\|AL445201.14\| Human DNA sequence from clone RP11-358L16 on ch...	40	6.0
151	emb\|AL391316.7\| Human DNA sequence from clone XX-YM901F10 on chr...	40	6.0
152	emb\|AL359983.7\| Human DNA sequence from clone RP11-139L21 on chr...	40	6.0
153	emb\|AL357509.13\| Human DNA sequence from clone RP11-387P17 on ch...	40	6.0
154	emb\|AL355132.19\| Human DNA sequence from clone RP11-181D10 on ch...	40	6.0
155	emb\|AL356552.8\| Human DNA sequence from clone RP4-732F8 on chrom...	40	6.0
156	emb\|AL354921.12\| Human DNA sequence from clone RP5-840O13 on chr...	40	6.0
157	emb\|AL158086.32\| Human DNA sequence from clone RP4-815O16 on chr...	40	6.0
158	emb\|AL160412.14\| Human DNA sequence from clone RP5-827E24 on chr...	40	6.0
159	emb\|AL121829.30\|HSJ697K14 Human DNA sequence from clone RP4-697K...	40	6.0
160	emb\|AL121908.16\|HSDJ719C8 Human DNA sequence from clone RP4-719C...	40	6.0
161	emb\|AL035682.16\|HS1009H6 Human DNA sequence from clone RP5-1009H...	40	6.0
162	emb\|AL031588.1\|HS1163J1 Human DNA sequence from clone RP5-1163J1...	40	6.0
163	emb\|AL732484.13\| Mouse DNA sequence from clone RP23-37B7 on chro...	40	6.0
164	emb\|AL020994.1\|HS929C8 Human DNA sequence from clone CTA-929C8 o...	40	6.0
165	emb\|BX323824.17\| Zebrafish DNA sequence from clone DKEY-37F18 in...	40	6.0
166	emb\|CR626941.10\| Zebrafish DNA sequence from clone DKEY-12J5 in ...	40	6.0
167	gb\|AC051649.21\| Homo sapiens chromosome 11, clone RP11-534I22, c...	40	6.0
168	gb\|AC010538.9\| Homo sapiens chromosome 16 clone RP11-368I7, comp...	40	6.0
169	emb\|X86563.2\|ZMA86563 Zea mays complete chloroplast genome	40	6.0
170	gb\|AC163627.4\| Mus musculus BAC clone RP23-341E13 from chromosom...	40	6.0
171	emb\|CR927553.8\| Zebrafish DNA sequence from clone DKEY-206P8 in ...	40	6.0
172	emb\|AL954254.2\| Pan troglodytes chromosome 22 clone PTB-153H02 m...	40	6.0
173	emb\|AL954255.1\| Pan troglodytes chromosome 22 clone PTB-044C19 m...	40	6.0
174	emb\|BX510906.21\| Zebrafish DNA sequence from clone CH211-203M24 ...	40	6.0
175	emb\|AL672026.11\| Mouse DNA sequence from clone RP23-403O11 on ch...	40	6.0
176	gb\|AC021763.10\| Homo sapiens chromosome 18, clone RP11-56O21, co...	40	6.0
177	gb\|AC158402.6\| Mus musculus chromosome 1, clone RP24-328M23, com...	40	6.0
178	emb\|BX548162.12\| Zebrafish DNA sequence from clone DKEYP-90D11 i...	40	6.0
179	gb\|AC159301.2\| Mus musculus BAC clone RP23-213B1 from chromosome...	40	6.0
180	emb\|BX537142.10\| Zebrafish DNA sequence from clone CH211-271D10 ...	40	6.0
181	emb\|BX005225.20\| Zebrafish DNA sequence from clone DKEY-34L15 in...	40	6.0
182	gb\|AE014175.1\| Mus musculus piebald deletion region section 3 of...	40	6.0
183	gb\|AC098613.2\| Homo sapiens chromosome 3 clone RP11-24F11, compl...	40	6.0
184	gb\|AC119424.2\| Homo sapiens chromosome 3 clone RP11-475O23, comp...	40	6.0
185	gb\|AC112673.7\| Homo sapiens chromosome 8, clone RP11-212F11, com...	40	6.0
186	gb\|AC015959.9\| Homo sapiens chromosome 18, clone RP11-63I8, comp...	40	6.0
187	emb\|BX510999.11\| Zebrafish DNA sequence from clone CH211-157P22 ...	40	6.0
188	gb\|AC011490.7\| Homo sapiens chromosome 19 clone CTB-179L3, compl...	40	6.0
189	gb\|AC011480.3\| Homo sapiens chromosome 19 clone CTB-124I16, comp...	40	6.0
190	gb\|AC122110.4\| Mus Musculus Strain C57BL6/J Chromosome 2 BAC, RP...	40	6.0
191	gb\|AC113145.7\| Homo sapiens chromosome 8, clone RP11-109P6, comp...	40	6.0
192	gb\|AC112175.2\| Homo sapiens chromosome 5 clone CTD-2568P10, comp...	40	6.0
193	gb\|AC008540.6\| Homo sapiens chromosome 19 clone CTC-496P20, comp...	40	6.0
194	gb\|AC104304.2\| Homo sapiens chromosome 3 clone RP11-509I21, comp...	40	6.0
195	emb\|BX511037.9\| Zebrafish DNA sequence from clone DKEY-66N24 in ...	40	6.0
196	gb\|AC105751.2\| Homo sapiens chromosome 3 clone RP11-908O9, compl...	40	6.0
197	gb\|AC083841.9\| Homo sapiens chromosome 8, clone RP11-706C16, com...	40	6.0
198	gb\|AC087636.5\| Homo sapiens chromosome 15, clone RP11-469K5, com...	40	6.0
199	gb\|AC016397.6\| Homo sapiens chromosome 10 clone RP11-541M12, com...	40	6.0
200	gb\|AC092851.9\| Homo sapiens 12 BAC RP11-459D22 (Roswell Park Can...	40	6.0
201	gb\|AC109357.3\| Homo sapiens BAC clone RP11-636M7 from 4, complet...	40	6.0
202	gb\|AC091988.3\| Homo sapiens chromosome 5 clone RP11-73G8, comple...	40	6.0
203	gb\|AC016399.9\| Homo sapiens chromosome 10 clone RP11-70E21, comp...	40	6.0
204	gb\|AC105270.2\| Homo sapiens chromosome 1 clone RP4-684L20, compl...	40	6.0
205	gb\|AC087240.17\| Homo sapiens 12p BAC RP11-752F20 (Roswell Park C...	40	6.0
206	dbj\|AK142905.1\| Mus musculus 15 days embryo head cDNA, RIKEN ful...	40	6.0
207	gb\|AC093479.13\| Mus musculus chromosome 16, clone RP23-61K2, com...	40	6.0
208	gb\|AC087633.5\| Homo sapiens chromosome 15, clone RP11-255M2, com...	40	6.0
209	gb\|AC009335.10\| Homo sapiens chromosome 17, clone RP11-20O2, com...	40	6.0
210	gb\|AC087761.6\| Homo sapiens chromosome 15, clone RP11-2E17, comp...	40	6.0
211	gb\|AC012337.8\| Homo sapiens chromosome , clone RP11-119O22, comp...	40	6.0
212	gb\|AC090625.5\| Homo sapiens chromosome 11, clone RP4-683L5, comp...	40	6.0
213	gb\|AC040165.6\| Homo sapiens chromosome 16 clone RP11-420O6, comp...	40	6.0
214	dbj\|AK163572.1\| Mus musculus adult male corpora quadrigemina cDN...	40	6.0
215	gb\|AC011260.8\| Homo sapiens, clone RP11-1E21, complete sequence	40	6.0
216	gb\|AC022915.14\| Homo sapiens chromosome 8, clone RP11-770E5, com...	40	6.0
217	gb\|AC093153.2\| Homo sapiens chromosome 1 clone RP11-477C23, comp...	40	6.0
218	gb\|AC017091.8\| Homo sapiens BAC clone RP11-506N2 from 4, complet...	40	6.0
219	gb\|AC092040.2\| Homo sapiens chromosome 3 clone RP11-129B22, comp...	40	6.0
220	gb\|AC157916.2\| Mus musculus chromosome 19, clone RP24-330P23, co...	40	6.0
221	emb\|BX663513.13\| Zebrafish DNA sequence from clone DKEY-234F12 i...	40	6.0
222	emb\|BX890629.6\| Zebrafish DNA sequence from clone CH211-42G2, co...	40	6.0
223	gb\|AC134682.8\| Homo sapiens chromosome 8, clone RP13-467H17, com...	40	6.0
224	gb\|AC130669.17\| Mus musculus chromosome 15, clone RP24-84O5, com...	40	6.0
225	gb\|AC132217.15\| Homo sapiens chromosome 11, clone RP11-889I17, c...	40	6.0
226	gb\|AC148338.2\| Homo sapiens FOSMID clone XXFOS-801736F1 from chr...	40	6.0
227	gb\|AC073057.6\| Homo sapiens BAC clone RP11-114G11 from 7, comple...	40	6.0
228	gb\|AC136742.15\| Mus musculus chromosome 5, clone RP23-145H8, com...	40	6.0
229	gb\|AC159643.2\| Mus musculus BAC clone RP23-384H10 from chromosom...	40	6.0
230	gb\|AC155815.2\| Mus musculus BAC clone RP24-135C18 from chromosom...	40	6.0
231	gb\|AC140776.6\| Mus musculus chromosome 1, clone RP23-284K5, comp...	40	6.0
232	gb\|AY958432.1\| Homo sapiens methionine sulfoxide reductase gene,...	40	6.0
233	dbj\|AK076864.1\| Mus musculus adult male testis cDNA, RIKEN full-...	40	6.0
234	ref\|NM_064768.1\| Caenorhabditis elegans F40G9.14 (F40G9.14) mRNA...	40	6.0
235	dbj\|AK028637.1\| Mus musculus 10 days neonate skin cDNA, RIKEN fu...	40	6.0
236	dbj\|AK082946.1\| Mus musculus 12 days embryo spinal cord cDNA, RI...	40	6.0
237	emb\|AL929493.20\| Zebrafish DNA sequence from clone CH211-157D2, ...	40	6.0
238	gb\|AC021843.6\|AC021843 Homo sapiens chromosome 18, clone RP11-71...	40	6.0
239	gb\|AC135782.4\| Homo sapiens chromosome 16 clone CTD-2555A7, comp...	40	6.0
240	dbj\|AP008208.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
241	gb\|AC090956.1\|AC090956 Homo sapiens chromosome 3 clone RP11-659G...	40	6.0
242	gb\|AC131212.6\| Homo sapiens 12 BAC RP13-554M15 (Rowsell Park Can...	40	6.0
243	gb\|AC026797.3\|AC026797 Homo sapiens chromosome 5 clone CTD-2299N...	40	6.0
244	gb\|AC097476.2\| Homo sapiens BAC clone RP11-109N11 from 4, comple...	40	6.0
245	gb\|AC092384.5\| Homo sapiens chromosome 16 clone RP11-830F9, comp...	40	6.0
246	gb\|AC008732.9\| Homo sapiens chromosome 16 clone CTD-2519M14, com...	40	6.0
247	gb\|AC079080.5\| Homo sapiens BAC clone RP11-162O12 from 4, comple...	40	6.0
248	gb\|AC017099.11\| Homo sapiens BAC clone RP11-542D13 from 2, compl...	40	6.0
249	gb\|AC026218.5\|AC026218 Homo sapiens chromosome 3 clone RP11-813N...	40	6.0
250	gb\|AC018505.4\|AC018505 Homo sapiens chromosome 3 clone RP11-58I1...	40	6.0
251	gb\|AC018831.4\|AC018831 Homo sapiens chromosome 3 clone RP11-481B...	40	6.0
252	gb\|AC153559.4\| Mus musculus 10 BAC RP23-86P1 (Roswell Park Cance...	40	6.0
253	gb\|AC154310.2\| Mus musculus BAC clone RP23-358E14 from chromosom...	40	6.0
254	gb\|AC154733.2\| Mus musculus BAC clone RP24-380I6 from chromosome...	40	6.0
255	gb\|AC157813.6\| Mus musculus chromosome 1, clone RP24-70I14, comp...	40	6.0
256	gb\|AC021534.19\| Homo sapiens chromosome 17, clone RP11-398J5, co...	40	6.0
257	dbj\|AP000057.1\| Homo sapiens genomic DNA, chromosome 21q22.1, se...	40	6.0
258	gb\|AC140675.5\| Mus musculus BAC clone RP23-44J10 from chromosome...	40	6.0
259	gb\|AC133645.5\| Mus musculus BAC clone RP23-73O10 from chromosome...	40	6.0
260	gb\|AC132265.4\| Mus musculus BAC clone RP24-373J20 from chromosom...	40	6.0
261	gb\|AC151828.3\| Mus musculus BAC clone RP24-444L19 from chromosom...	40	6.0
262	gb\|AC079779.7\| Homo sapiens BAC clone RP11-356M6 from 2, complet...	40	6.0
263	gb\|AC013272.5\| Homo sapiens BAC clone RP11-401C13 from 2, comple...	40	6.0
264	gb\|AC113611.3\| Homo sapiens BAC clone RP11-421M20 from 4, comple...	40	6.0
265	gb\|AC106772.3\| Homo sapiens chromosome 5 clone RP11-310P5, compl...	40	6.0
266	emb\|BX088592.12\| Zebrafish DNA sequence from clone DKEYP-61C12 i...	40	6.0
267	gb\|AC148026.2\| Homo sapiens BAC clone RP11-625I24 from 2, comple...	40	6.0
268	gb\|AY928077.1\| Zea mays cultivar B73 chloroplast, complete genome	40	6.0
269	gb\|AC009434.19\| Homo sapiens chromosome 15, clone RP11-96C21, co...	40	6.0
270	gb\|AC021636.16\| Homo sapiens chromosome 8, clone RP11-637F16, co...	40	6.0
271	emb\|AL824704.27\| Mouse DNA sequence from clone RP23-286H14 on ch...	40	6.0
272	gb\|U92572.1\|FRU92572 Fugu rubripes homeobox protein HOXC-9 (FrHO...	40	6.0
273	gb\|AC130303.8\| Homo sapiens chromosome 11, clone RP4-539G11, com...	40	6.0
274	gb\|AC117695.15\| Mus musculus chromosome 1, clone RP23-450I19, co...	40	6.0
275	gb\|AC167566.1\| Mus musculus BAC clone RP24-84B10 from chromosome...	40	6.0
276	gb\|AC074362.5\| Homo sapiens BAC clone RP11-1C10 from 2, complete...	40	6.0
277	gb\|AC004706.1\|AC004706 Homo sapiens chromosome 17, clone hCIT.28...	40	6.0
278	gb\|AC008268.3\|AC008268 Homo sapiens BAC clone RP11-34G16 from 2,...	40	6.0
279	gb\|AC155842.4\| Mus musculus 6 BAC RP24-122N23 (Roswell Park Canc...	40	6.0
280	emb\|BX664704.4\| Human DNA sequence from clone DAQB-35G9 on chrom...	40	6.0
281	emb\|BX255940.4\| Zebrafish DNA sequence from clone DKEY-3P8 in li...	40	6.0
282	emb\|AL954707.18\| Mouse DNA sequence from clone RP23-359C15 on ch...	40	6.0
283	emb\|BX649330.5\| Zebrafish DNA sequence from clone CH211-140F21 i...	40	6.0
284	emb\|BX247882.6\| Zebrafish DNA sequence from clone CH211-224P3 in...	40	6.0
285	emb\|AL772133.30\| Zebrafish DNA sequence from clone CH211-121J5 i...	40	6.0
286	dbj\|AP005291.3\| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
287	emb\|BX072555.14\| Zebrafish DNA sequence from clone DKEY-30O19 in...	40	6.0
288	gb\|AC011599.8\|AC011599 Homo sapiens 3 BAC RP11-606C6 (Roswell Pa...	40	6.0
289	emb\|AL627127.20\| Mouse DNA sequence from clone RP23-360O1 on chr...	40	6.0
290	gb\|AC105957.13\| Mus musculus chromosome 18, clone RP24-303O20, c...	40	6.0
291	gb\|AC122566.14\| Mus musculus chromosome 5, clone RP24-259O11, co...	40	6.0
292	gb\|AF119358.1\|AF119358 Homo sapiens clone B colorectal tumor bre...	40	6.0
293	gb\|AF119357.1\|AF119357 Homo sapiens clone A colorectal tumor bre...	40	6.0
294	gb\|AC114598.9\| Mus musculus chromosome 8, clone RP23-301G13, com...	40	6.0
295	gb\|AC154140.7\| Mus musculus chromosome 1, clone RP23-184B11, com...	40	6.0
296	gb\|AC156940.1\| Mus musculus BAC clone RP23-42F24 from 9, complet...	40	6.0
297	emb\|BX465216.5\| Mouse DNA sequence from clone RP23-282I18 on chr...	40	6.0
298	emb\|BX248418.16\| Zebrafish DNA sequence from clone DKEY-181I3 in...	40	6.0
299	gb\|AC125061.3\| Mus musculus BAC clone RP23-418E13 from 5, comple...	40	6.0
300	gb\|AC154663.2\| Mus musculus BAC clone RP24-283H12 from 16, compl...	40	6.0
301	gb\|AC117207.5\| Mus musculus BAC clone RP23-278A7 from 8, complet...	40	6.0
302	emb\|BX927361.31\| Zebrafish DNA sequence from clone CH211-121K8 i...	40	6.0
303	emb\|BX927116.18\| Zebrafish DNA sequence from clone DKEY-261D11 i...	40	6.0
304	emb\|BX571946.9\| Zebrafish DNA sequence from clone DKEY-232H18 in...	40	6.0
305	gb\|AC107666.13\| Mus musculus chromosome 5, clone RP23-111M3, com...	40	6.0
306	gb\|AC133578.12\| Mus musculus chromosome 15, clone RP23-212I23, c...	40	6.0
307	emb\|AM177460.1\| Darwinula stevensoni retrotransposon Syrinx L1a81	40	6.0
308	gb\|AC106841.11\| Mus musculus chromosome 1, clone RP24-554B1, com...	40	6.0
309	emb\|AJ230968.1\|RNO230968 Rattus norvegicus repeat; map D7Wox22-D...	40	6.0
310	gb\|AC006952.6\|AC006952 Homo sapiens chromosome 9, clone hRPK.374...	40	6.0
311	dbj\|AP006462.2\| Homo sapiens genomic DNA, chromosome 11 clone:RP...	40	6.0
312	dbj\|AP001721.1\| Homo sapiens genomic DNA, chromosome 21q, sectio...	40	6.0
313	gb\|AC114410.9\| Mus musculus chromosome 14, clone RP23-151K8, com...	40	6.0
314	gb\|AC157763.2\| Pan troglodytes BAC clone CH251-340C15 from chrom...	40	6.0
315	gb\|AC157793.6\| Mus musculus chromosome 1, clone RP24-175H22, com...	40	6.0
316	emb\|CR854915.21\| Zebrafish DNA sequence from clone DKEY-4G13 in ...	40	6.0
317	gb\|AC100967.15\| Mus musculus chromosome 5, clone RP23-74L20, com...	40	6.0
318	gb\|AC008734.7\| Homo sapiens chromosome 19 clone CTD-2529P6, comp...	40	6.0
319	emb\|BX927101.19\| Zebrafish DNA sequence from clone CH211-120F16 ...	40	6.0
320	emb\|CR855880.13\| Zebrafish DNA sequence from clone DKEY-215C14 i...	40	6.0
321	gb\|AC121256.22\| Mus musculus chromosome 1, clone RP24-576N23, co...	40	6.0
322	gb\|AC005796.1\|AC005796 Homo sapiens chromosome 19, cosmid R31408...	40	6.0
323	emb\|AL935060.17\| Mouse DNA sequence from clone RP24-151H6 on chr...	40	6.0
324	emb\|CT009569.17\| Pig DNA sequence from clone CH242-213C10 on chr...	40	6.0
325	gb\|AC174763.1\| Gasterosteus aculeatus clone VMRC28-119C03, compl...	40	6.0
326	emb\|CR848750.27\| Zebrafish DNA sequence from clone RP71-4B23 in ...	40	6.0
327	gb\|AC005619.1\|AC005619 Homo sapiens chromosome 19, cosmid R34241...	40	6.0
328	emb\|AL935202.7\| Zebrafish DNA sequence from clone CH211-197E11, ...	40	6.0
329	gb\|AC005325.1\|AC005325 Homo sapiens chromosome 17, clone hRPK.60...	40	6.0
330	gb\|AC147558.3\| Mus musculus BAC clone RP23-470N2 from 8, complet...	40	6.0
331	gb\|AC133944.4\| Mus musculus BAC clone RP24-113L10 from 10, compl...	40	6.0
332	gb\|AC002406.1\|AC002406 Mouse chromosome X BAC B178A13 (Research ...	40	6.0
333	gb\|AC127370.3\| Mus musculus BAC clone RP23-26H6 from 9, complete...	40	6.0
334	gb\|AC150648.2\| Mus musculus BAC clone RP23-235N5 from 7, complet...	40	6.0
335	gb\|AC127328.6\| Mus musculus BAC clone RP23-259B8 from 6, complet...	40	6.0
336	gb\|AC147476.3\| Mus musculus BAC clone RP23-132H10 from 3, comple...	40	6.0
337	emb\|AL928610.8\| Zebrafish DNA sequence from clone CH211-245P6, c...	40	6.0
338	emb\|AL805931.4\| Mouse DNA sequence from clone RP23-195A22 on chr...	40	6.0
339	emb\|AL627238.15\| Mouse DNA sequence from clone RP23-46M23 on chr...	40	6.0
340	emb\|AL929343.7\| Zebrafish DNA sequence from clone CH211-144G12, ...	40	6.0
341	gb\|AC151413.2\| Mus musculus BAC clone RP23-103N6 from 19, comple...	40	6.0
342	emb\|CT030154.8\| Mouse DNA sequence from clone RP23-387H3 on chro...	40	6.0
343	emb\|CR847498.12\| Zebrafish DNA sequence from clone DKEY-263P22 i...	40	6.0
344	dbj\|AP005270.2\| Homo sapiens genomic DNA, chromosome 18 clone:RP...	40	6.0
345	gb\|M12704.1\|MZECPPS2G Maize chloroplast psbG gene encoding PSII-...	40	6.0
346	emb\|X17438.1\|CHZMNPOO Maize chloroplast ndhC, psbG genes for NDH...	40	6.0
347	emb\|AL611985.22\| Mouse DNA sequence from clone RP23-421E12 on ch...	40	6.0
348	emb\|AL732474.8\| Mouse DNA sequence from clone RP23-180I2 on chro...	40	6.0
349	emb\|AL603651.14\| Mouse DNA sequence from clone RP23-398J2 on chr...	40	6.0
350	emb\|AL604045.7\| Mouse DNA sequence from clone RP23-418O11 on chr...	40	6.0
351	emb\|AL606967.14\| Mouse DNA sequence from clone RP23-304D5 on chr...	40	6.0
352	emb\|AL833787.8\| Mouse DNA sequence from clone RP23-228E2 on chro...	40	6.0
353	gb\|AC069271.5\| Homo sapiens chromosome 3 clone RP11-715I4 map 3p...	40	6.0
354	dbj\|AP003183.2\| Mus musculus genomic DNA, chromosome 7 clone:B22...	40	6.0
355	dbj\|AP000331.1\| Homo sapiens genomic DNA, chromosome 21q22.1, D2...	40	6.0
356	dbj\|AP000172.1\| Homo sapiens genomic DNA, chromosome 21q22.1, D2...	40	6.0
357	emb\|AL607073.15\| Mouse DNA sequence from clone RP23-321K1 on chr...	40	6.0
358	emb\|AL606926.6\| Mouse DNA sequence from clone RP23-231M4 on chro...	40	6.0

>gb|AY108456.1| Zea mays PCO091049 mRNA sequence
          Length = 753

 Score =  133 bits (67), Expect = 5e-28
 Identities = 73/75 (97%)
 Strand = Plus / Minus

                                                                       
Query: 245 caccagatccaatgcaggtagccatccctgtcctcctcataattagtgcctcacctacca 304
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 483 caccagatccaatgcaggtagccatccctgtcctcctcataatttgtgcctcacctacca 424

                          
Query: 305 ataatactccaccac 319
           |||||||| ||||||
Sbjct: 423 ataatactgcaccac 409

to top

>ref|XM_480184.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1223

 Score =  109 bits (55), Expect = 8e-21
 Identities = 76/83 (91%), Gaps = 5/83 (6%)
 Strand = Plus / Minus

                                                                       
Query: 242 attcaccagatccaa-----tgcaggtagccatccctgtcctcctcataattagtgcctc 296
           |||||||||||||||     ||||||||||||||| ||||||||||||||||||||||||
Sbjct: 897 attcaccagatccaatgcagtgcaggtagccatccttgtcctcctcataattagtgcctc 838

                                  
Query: 297 acctaccaataatactccaccac 319
           |||||||||||||||||| ||||
Sbjct: 837 acctaccaataatactcctccac 815

to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score =  109 bits (55), Expect = 8e-21
 Identities = 76/83 (91%), Gaps = 5/83 (6%)
 Strand = Plus / Plus

                                                                           
Query: 242     attcaccagatccaa-----tgcaggtagccatccctgtcctcctcataattagtgcctc 296
               |||||||||||||||     ||||||||||||||| ||||||||||||||||||||||||
Sbjct: 3320341 attcaccagatccaatgcagtgcaggtagccatccttgtcctcctcataattagtgcctc 3320400

                                      
Query: 297     acctaccaataatactccaccac 319
               |||||||||||||||||| ||||
Sbjct: 3320401 acctaccaataatactcctccac 3320423



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 322     aaacatacacacggacaccta 342
               |||||||||||||||||||||
Sbjct: 8231867 aaacatacacacggacaccta 8231847

to top

>dbj|AP004460.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0438H08
          Length = 148626

 Score =  109 bits (55), Expect = 8e-21
 Identities = 76/83 (91%), Gaps = 5/83 (6%)
 Strand = Plus / Plus

                                                                         
Query: 242   attcaccagatccaa-----tgcaggtagccatccctgtcctcctcataattagtgcctc 296
             |||||||||||||||     ||||||||||||||| ||||||||||||||||||||||||
Sbjct: 97908 attcaccagatccaatgcagtgcaggtagccatccttgtcctcctcataattagtgcctc 97967

                                    
Query: 297   acctaccaataatactccaccac 319
             |||||||||||||||||| ||||
Sbjct: 97968 acctaccaataatactcctccac 97990

to top

>dbj|AK108144.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-139-E12, full
           insert sequence
          Length = 1223

 Score =  109 bits (55), Expect = 8e-21
 Identities = 76/83 (91%), Gaps = 5/83 (6%)
 Strand = Plus / Minus

                                                                       
Query: 242 attcaccagatccaa-----tgcaggtagccatccctgtcctcctcataattagtgcctc 296
           |||||||||||||||     ||||||||||||||| ||||||||||||||||||||||||
Sbjct: 897 attcaccagatccaatgcagtgcaggtagccatccttgtcctcctcataattagtgcctc 838

                                  
Query: 297 acctaccaataatactccaccac 319
           |||||||||||||||||| ||||
Sbjct: 837 acctaccaataatactcctccac 815

to top

>emb|AL929566.30| Zebrafish DNA sequence from clone CH211-159C13 in linkage group 8,
             complete sequence
          Length = 137166

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||||||||||||||||
Sbjct: 63681 tggagagatgggtggatggatgga 63704

to top

>gb|AC087269.5| Homo sapiens chromosome 8, clone RP11-211C9, complete sequence
          Length = 187924

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              ||||||||||||||||||||||||
Sbjct: 110756 tggagagatgggtggatggatgga 110733

to top

>gb|AC093176.6| Mus musculus Strain C57BL6/J chromosome 6 BAC, RP23-109H11, Complete
              Sequence, complete sequence
          Length = 192227

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 403    gcatggatccgtggagagatgggtggatggatgga 437
              |||||||| | |||| |||||||||||||||||||
Sbjct: 120769 gcatggatgcatggatagatgggtggatggatgga 120735



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                
Query: 403    gcatggatccgtggagagatgggtggatggatgg 436
              |||||||| | |||| ||||||||||||||||||
Sbjct: 120289 gcatggatgcatggatagatgggtggatggatgg 120256

to top

>gb|AC026250.16| Homo sapiens chromosome 11, clone RP11-540A21, complete sequence
          Length = 160681

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 414    tggagagatgggtggatggatgg 436
              |||||||||||||||||||||||
Sbjct: 113745 tggagagatgggtggatggatgg 113723

to top

>emb|CR352330.14| Mouse DNA sequence from clone RP23-374F1 on chromosome X, complete
            sequence
          Length = 82726

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 415  ggagagatgggtggatggatgga 437
            |||||||||||||||||||||||
Sbjct: 9557 ggagagatgggtggatggatgga 9579

to top

>emb|BX901908.8| Zebrafish DNA sequence from clone DKEY-268B12 in linkage group 4,
             complete sequence
          Length = 210697

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 183   gaggagctgaaaaagaaagaaaa 205
             |||||||||||||||||||||||
Sbjct: 13866 gaggagctgaaaaagaaagaaaa 13888

to top

>emb|AL954657.14| Zebrafish DNA sequence from clone CH211-223E21 in linkage group 4,
             complete sequence
          Length = 200352

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 183   gaggagctgaaaaagaaagaaaa 205
             |||||||||||||||||||||||
Sbjct: 53588 gaggagctgaaaaagaaagaaaa 53610

to top

>emb|CR855311.15| Zebrafish DNA sequence from clone DKEY-97I18 in linkage group 16,
            complete sequence
          Length = 161379

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 409  atccgtggagagatgggtggatggatg 435
            ||||||||| |||||||||||||||||
Sbjct: 4696 atccgtggatagatgggtggatggatg 4670

to top

>gb|U79397.1|MGU79397 Meleagris gallopavo microsatellite repeat sequence
          Length = 500

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 414 tggagagatgggtggatggatggagaa 440
           |||||| ||||||||||||||||||||
Sbjct: 167 tggagaaatgggtggatggatggagaa 141



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 414 tggagagatgggtggatggatggagaa 440
           |||||| ||||||||||||||||||||
Sbjct: 147 tggagaaatgggtggatggatggagaa 121



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 414 tggagagatgggtggatggatggagaa 440
           |||||| ||||||||||||||||||||
Sbjct: 127 tggagaaatgggtggatggatggagaa 101



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 414 tggagagatgggtggatggatggagaa 440
           |||||| ||||||||||||||||||||
Sbjct: 107 tggagaaatgggtggatggatggagaa 81



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 414 tggagagatgggtggatggatggagaa 440
           |||||| ||||||||||||||||||||
Sbjct: 87  tggagaaatgggtggatggatggagaa 61



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 414 tggagagatgggtggatggatggagaa 440
           |||||| ||||||||||||||||||||
Sbjct: 67  tggagaaatgggtggatggatggagaa 41

to top

>gb|U79330.1|MGU79330 Meleagris gallopavo microsatellite repeat sequence
          Length = 600

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 414 tggagagatgggtggatggatggagaa 440
           |||||| ||||||||||||||||||||
Sbjct: 167 tggagaaatgggtggatggatggagaa 141



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 414 tggagagatgggtggatggatggagaa 440
           |||||| ||||||||||||||||||||
Sbjct: 147 tggagaaatgggtggatggatggagaa 121



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 414 tggagagatgggtggatggatggagaa 440
           |||||| ||||||||||||||||||||
Sbjct: 127 tggagaaatgggtggatggatggagaa 101



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 414 tggagagatgggtggatggatggagaa 440
           |||||| ||||||||||||||||||||
Sbjct: 107 tggagaaatgggtggatggatggagaa 81



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 414 tggagagatgggtggatggatggagaa 440
           |||||| ||||||||||||||||||||
Sbjct: 87  tggagaaatgggtggatggatggagaa 61



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 414 tggagagatgggtggatggatggagaa 440
           |||||| ||||||||||||||||||||
Sbjct: 67  tggagaaatgggtggatggatggagaa 41

to top

>dbj|AP002387.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-660L16, complete
            sequence
          Length = 170523

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                   
Query: 399  gaaagcatggatccgtggagagatgggtggatggatgga 437
            ||||| ||||||  |||||||||||| ||||||||||||
Sbjct: 2566 gaaagaatggatgggtggagagatggttggatggatgga 2604



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 415    ggagagatgggtggatggatgg 436
              ||||||||||||||||||||||
Sbjct: 108811 ggagagatgggtggatggatgg 108790



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 413  gtggagagatgggtggatggatgga 437
            |||||||||||| ||||||||||||
Sbjct: 2644 gtggagagatggttggatggatgga 2668



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 413  gtggagagatgggtggatggatgga 437
            |||||||||||| ||||||||||||
Sbjct: 2452 gtggagagatggttggatggatgga 2476



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||| ||||||||||||||||||
Sbjct: 37196 tggagggatgggtggatggatgga 37219

to top

>dbj|AP004370.2| Homo sapiens genomic DNA, chromosome 11q clone:RP11-512I24, complete
              sequences
          Length = 193212

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                     
Query: 399    gaaagcatggatccgtggagagatgggtggatggatgga 437
              ||||| ||||||  |||||||||||| ||||||||||||
Sbjct: 172569 gaaagaatggatgggtggagagatggttggatggatgga 172607



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 413    gtggagagatgggtggatggatgga 437
              |||||||||||| ||||||||||||
Sbjct: 172647 gtggagagatggttggatggatgga 172671



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 413    gtggagagatgggtggatggatgga 437
              |||||||||||| ||||||||||||
Sbjct: 172455 gtggagagatggttggatggatgga 172479

to top

>gb|AC164398.8| Mus musculus chromosome 7, clone RP23-307M24, complete sequence
          Length = 196756

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 416   gagagatgggtggatggatgga 437
             ||||||||||||||||||||||
Sbjct: 49428 gagagatgggtggatggatgga 49407

to top

>gb|AC153607.15| Mus musculus 6 BAC RP23-100I21 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 222828

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 414   tggagagatgggtggatggatggaga 439
             ||||||||||| ||||||||||||||
Sbjct: 72047 tggagagatggatggatggatggaga 72072



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||| ||||||||||||
Sbjct: 72111 tggagagatggatggatggatgga 72134



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||| ||||||||||||
Sbjct: 72067 tggagagatggatggatggatgga 72090



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 414   tggagagatgggtggatgga 433
             ||||||||||||||||||||
Sbjct: 72031 tggagagatgggtggatgga 72050



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||| ||||||||||||
Sbjct: 71995 tggagagatggatggatggatgga 72018



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||| ||||||||||||
Sbjct: 71939 tggagagatggatggatggatgga 71962

to top

>gb|AC146249.2| Pan troglodytes BAC clone CH251-140O11 from Y, complete sequence
          Length = 173078

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 414    tggagagatgggtggatggatg 435
              ||||||||||||||||||||||
Sbjct: 127050 tggagagatgggtggatggatg 127029

to top

>gb|AC158347.4| Mus musculus chromosome 3, clone RP23-380F8, complete sequence
          Length = 193489

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 317   cacacaaacatacacacggaca 338
             ||||||||||||||||||||||
Sbjct: 10007 cacacaaacatacacacggaca 9986

to top

>gb|AC123934.2| Mus musculus BAC clone RP23-354D22 from chromosome 17, complete
             sequence
          Length = 207817

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 308   atactccaccacacaaacatacacac 333
             ||||| ||||||||||||||||||||
Sbjct: 83491 atactacaccacacaaacatacacac 83516

to top

>gb|AC105304.24| Mus musculus strain C57BL/6J clone rp23-71k5 map 17, complete sequence
          Length = 229816

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 308   atactccaccacacaaacatacacac 333
             ||||| ||||||||||||||||||||
Sbjct: 42932 atactacaccacacaaacatacacac 42907

to top

>emb|AL161774.49| Human DNA sequence from clone RP11-245B11 on chromosome 13 Contains
            the 5' end of the gene for RAS p21 protein activator
            (GTPase activating protein) 3 (Ins(1,3,4,5)P4-binding
            protein) (GAP1IP4BP), a novel gene and 20 CpG islands,
            complete sequence
          Length = 162296

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 416  gagagatgggtggatggatgga 437
            ||||||||||||||||||||||
Sbjct: 2317 gagagatgggtggatggatgga 2296

to top

>emb|AL121761.5|HSJ122P22 Human DNA sequence from clone RP1-122P22 on chromosome 20 Contains
           the 3' end the SLC24A3 gene for solute carrier family 24
           (sodium/potassium/calcium exchanger) member 3, a novel
           gene and a CpG island, complete sequence
          Length = 118990

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 414 tggagagatgggtggatggatggaga 439
           ||||||||||| ||||||||||||||
Sbjct: 529 tggagagatggatggatggatggaga 554

to top

>emb|AL096763.14|HSJ1129A6 Human DNA sequence from clone RP5-1129A6 on chromosome Xp22.11-22.2
             Contains the 3'end of the SCML2 gene for sex comb on
             midleg-like 2 (Drosophila), a novel protein (MGC33653) and
             one CpG island, complete sequence
          Length = 109018

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 377   atccccttttgatttctctctt 398
             ||||||||||||||||||||||
Sbjct: 52374 atccccttttgatttctctctt 52353

to top

>emb|AL050312.8|HSBA9F11 Human DNA sequence from clone RP11-9F11 on chromosome 22, complete
             sequence
          Length = 45896

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 416   gagagatgggtggatggatgga 437
             ||||||||||||||||||||||
Sbjct: 11254 gagagatgggtggatggatgga 11233

to top

>dbj|BS000599.1| Pan troglodytes chromosome Y clone:PTB-225K16, complete sequences
          Length = 105000

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 414   tggagagatgggtggatggatg 435
             ||||||||||||||||||||||
Sbjct: 20116 tggagagatgggtggatggatg 20095

to top

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 414      tggagagatgggtggatggatg 435
                ||||||||||||||||||||||
Sbjct: 22406489 tggagagatgggtggatggatg 22406510

to top

>gb|AC099550.5| Homo sapiens BAC clone RP11-484O2 from 4, complete sequence
          Length = 145479

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 412   cgtggagagatgggtggatggatgga 437
             ||||||||||||| ||||||||||||
Sbjct: 64982 cgtggagagatggatggatggatgga 65007

to top

>ref|NG_002806.1| Homo sapiens adlican pseudogene (ADLICANP) on chromosome Y
          Length = 31571

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 414   tggagagatgggtggatggatg 435
             ||||||||||||||||||||||
Sbjct: 25414 tggagagatgggtggatggatg 25393

to top

>gb|AC136735.7| Mus musculus chromosome 3, clone RP23-175G2, complete sequence
          Length = 182455

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 317   cacacaaacatacacacggaca 338
             ||||||||||||||||||||||
Sbjct: 86885 cacacaaacatacacacggaca 86906

to top

>gb|AC107739.9| Mus musculus chromosome 7, clone RP23-345M1, complete sequence
          Length = 205227

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 416    gagagatgggtggatggatgga 437
              ||||||||||||||||||||||
Sbjct: 158987 gagagatgggtggatggatgga 158966

to top

>gb|AC011302.3|AC011302 Homo sapiens BAC clone RP11-333E9 from Y, complete sequence
          Length = 178137

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 414   tggagagatgggtggatggatg 435
             ||||||||||||||||||||||
Sbjct: 31528 tggagagatgggtggatggatg 31507

to top

>gb|AC144818.4| Mus musculus BAC clone RP23-97O1 from chromosome 5, complete sequence
          Length = 213322

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                
Query: 404    catggatccgtggagagatgggtggatggatgga 437
              ||||||||| |||| |||||| ||||||||||||
Sbjct: 139231 catggatccatggacagatggatggatggatgga 139198



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                               
Query: 404    catggatccgtggagagatgggtggatggatgg 436
              ||||||||| |||| |||||| |||||||||||
Sbjct: 138329 catggatccatggacagatggatggatggatgg 138297

to top

>emb|AL731871.12| Mouse DNA sequence from clone RP23-111J19 on chromosome 2, complete
              sequence
          Length = 195003

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 416    gagagatgggtggatggatgga 437
              ||||||||||||||||||||||
Sbjct: 141805 gagagatgggtggatggatgga 141826



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 416    gagagatgggtggatggatggaga 439
              ||||||||||||||||||| ||||
Sbjct: 141946 gagagatgggtggatggatagaga 141969

to top

>dbj|D13384.1|TFLPLABPII Snake BP-II gene for phospholipase A2, complete cds
          Length = 3086

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 318  acacaaacatacacacggacac 339
            ||||||||||||||||||||||
Sbjct: 1229 acacaaacatacacacggacac 1250

to top

>dbj|D13383.1|TFLPLABPI Snake BP-I gene for phospholipase A2, complete cds
          Length = 2713

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 318  acacaaacatacacacggacac 339
            ||||||||||||||||||||||
Sbjct: 1317 acacaaacatacacacggacac 1338

to top

>dbj|AP000867.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-684B2, complete
             sequences
          Length = 199999

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 415   ggagagatgggtggatggatgg 436
             ||||||||||||||||||||||
Sbjct: 14610 ggagagatgggtggatggatgg 14589

to top

>gb|AC104882.30| Mus musculus chromosome 8, clone RP23-401L9, complete sequence
          Length = 209525

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 413    gtggagagatgggtggatggatgga 437
              ||||| |||||||||||||||||||
Sbjct: 178461 gtggatagatgggtggatggatgga 178437

to top

>gb|CP000081.1| Leishmania major chromosome 35, complete sequence
          Length = 2090491

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 419    agatgggtggatggatggaga 439
              |||||||||||||||||||||
Sbjct: 512489 agatgggtggatggatggaga 512469

to top

>gb|AY577942.1| Petromyzon marinus clone PAC4 variable lymphocyte receptor (VLR)
            gene, partial sequence
          Length = 58162

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 319  cacaaacatacacacggacac 339
            |||||||||||||||||||||
Sbjct: 6845 cacaaacatacacacggacac 6825

to top

>gb|AC147555.2| Mus musculus BAC clone RP23-478E6 from chromosome 5, complete sequence
          Length = 176491

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 420   gatgggtggatggatggagaa 440
             |||||||||||||||||||||
Sbjct: 57245 gatgggtggatggatggagaa 57225

to top

>gb|AY079050.1| Mus musculus tongue plunc-like protein (Tpl) gene, complete cds
          Length = 5796

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 413  gtggagagatgggtggatggatgga 437
            ||||| |||||||||||||||||||
Sbjct: 3581 gtggatagatgggtggatggatgga 3605

to top

>gb|AC151266.4| Mus musculus BAC clone RP24-279K24 from chromosome 17, complete
             sequence
          Length = 171074

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 413   gtggagagatgggtggatggatgga 437
             ||||| |||||||||||||||||||
Sbjct: 95235 gtggacagatgggtggatggatgga 95259

to top

>gb|AC126944.3| Mus musculus BAC clone RP23-19A4 from chromosome 19, complete sequence
          Length = 184164

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 413    gtggagagatgggtggatggatgga 437
              |||||||||||| ||||||||||||
Sbjct: 118197 gtggagagatggatggatggatgga 118221

to top

>gb|AC005056.2| Homo sapiens BAC clone CTB-51J22 from 7, complete sequence
          Length = 98188

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 405   atggatccgtggagagatgggtggatggatgga 437
             |||||||| |||||| |||| ||||||||||||
Sbjct: 45024 atggatccatggagaaatggatggatggatgga 45056

to top

>gb|AC124496.3| Mus musculus BAC clone RP23-471J10 from chromosome 3, complete sequence
          Length = 185141

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 180    gaagaggagctgaaaaagaaa 200
              |||||||||||||||||||||
Sbjct: 157729 gaagaggagctgaaaaagaaa 157749

to top

>gb|AC125410.4| Mus musculus BAC clone RP23-146N3 from 3, complete sequence
          Length = 213701

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 180   gaagaggagctgaaaaagaaa 200
             |||||||||||||||||||||
Sbjct: 16371 gaagaggagctgaaaaagaaa 16391

to top

>gb|AC116827.7| Mus musculus chromosome 18, clone RP24-370N5, complete sequence
          Length = 151007

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 413   gtggagagatgggtggatggatgga 437
             |||| ||||||||||||||||||||
Sbjct: 92554 gtggggagatgggtggatggatgga 92578

to top

>gb|AC102105.8| Mus musculus chromosome 12, clone RP23-89G24, complete sequence
          Length = 188853

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 413   gtggagagatgggtggatggatgga 437
             ||||| |||||||||||||||||||
Sbjct: 78226 gtggatagatgggtggatggatgga 78250

to top

>emb|AL445931.29| Human DNA sequence from clone RP11-374P20 on chromosome 9 Contains the 5'
              end of the VAV2 gene for vav 2 oncogene, a novel gene
              (FLJ35348), the 3' end of the BRD3 gene for bromodomain
              containing 3, a novel gene and five CpG islands, complete
              sequence
          Length = 175033

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 414    tggagagatgggtggatggatggag 438
              ||||| |||||||||||||||||||
Sbjct: 112345 tggagggatgggtggatggatggag 112321

to top

>emb|AL358593.22| Human DNA sequence from clone RP11-473A10 on chromosome 1 Contains the
             3' end of the gene for a novel protein (KIAA1626,
             FLJ34701, FLJ44929, FLJ10521) and the 5' end of a novel
             gene, complete sequence
          Length = 142454

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 414   tggagagatgggtggatggat 434
             |||||||||||||||||||||
Sbjct: 31617 tggagagatgggtggatggat 31597

to top

>emb|AL355137.23| Human DNA sequence from clone RP11-511D14 on chromosome 6p23-24.3
             Contains the gene for a novel protein isentical to
             ribosomal protein L15 (RPL15), complete sequence
          Length = 190223

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 420   gatgggtggatggatggagaa 440
             |||||||||||||||||||||
Sbjct: 35463 gatgggtggatggatggagaa 35443

to top

>gb|AC158213.4| Mus musculus chromosome 7, clone RP24-253H20, complete sequence
          Length = 175873

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 417   agagatgggtggatggatgga 437
             |||||||||||||||||||||
Sbjct: 92193 agagatgggtggatggatgga 92173

to top

>emb|BX883047.1| Rattus norvegicus chromosome 20, major histocompatibility complex,
              assembled from 40 BACs, strain Brown Norway (BN/ssNHsd),
              RT1n haplotype; segment 6/11
          Length = 349571

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 413    gtggagagatgggtggatggatgga 437
              |||||||||||| ||||||||||||
Sbjct: 153629 gtggagagatggatggatggatgga 153605

to top

>ref|NM_001016226.2| Xenopus tropicalis CBF1 interacting corepressor (cir), mRNA
          Length = 2423

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 184 aggagctgaaaaagaaagaaaagag 208
           ||||||||||||||||| |||||||
Sbjct: 317 aggagctgaaaaagaaataaaagag 341

to top

>emb|BX537273.16| Zebrafish DNA sequence from clone CH211-151F2 in linkage group 10,
            complete sequence
          Length = 167226

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 419  agatgggtggatggatggaga 439
            |||||||||||||||||||||
Sbjct: 9870 agatgggtggatggatggaga 9890

to top

>emb|BX510991.10| Zebrafish DNA sequence from clone RP71-44C4 in linkage group 17,
             complete sequence
          Length = 116313

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 413   gtggagagatgggtggatggatgga 437
             ||||| |||||||||||||||||||
Sbjct: 10709 gtggatagatgggtggatggatgga 10733



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 413   gtggagagatgggtggatggatgga 437
             ||||| |||||||||||||||||||
Sbjct: 10358 gtggatagatgggtggatggatgga 10382

to top

>emb|BX649460.11| Zebrafish DNA sequence from clone CH211-286F20 in linkage group 13,
             complete sequence
          Length = 79591

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 416   gagagatgggtggatggatgg 436
             |||||||||||||||||||||
Sbjct: 65950 gagagatgggtggatggatgg 65970

to top

>gb|AC009093.10| Homo sapiens chromosome 16 clone RP11-426C22, complete sequence
          Length = 207997

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 413    gtggagagatgggtggatggatgga 437
              ||||| |||||||||||||||||||
Sbjct: 201513 gtggacagatgggtggatggatgga 201537

to top

>dbj|AK157495.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830219I22 product:unclassifiable, full
            insert sequence
          Length = 2920

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 420  gatgggtggatggatggagaa 440
            |||||||||||||||||||||
Sbjct: 1405 gatgggtggatggatggagaa 1385

to top

>gb|AC008985.7| Homo sapiens chromosome 19 clone LLNLF-198H7, complete sequence
          Length = 46202

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 414   tggagagatgggtggatggatggag 438
             ||||| |||||||||||||||||||
Sbjct: 35616 tggagggatgggtggatggatggag 35640

to top

>gb|AC005089.3| Homo sapiens BAC clone CTA-315H11 from 7, complete sequence
          Length = 177893

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 417   agagatgggtggatggatgga 437
             |||||||||||||||||||||
Sbjct: 10366 agagatgggtggatggatgga 10386

to top

>gb|AC026791.4|AC026791 Homo sapiens chromosome 5 clone CTD-2265D9, complete sequence
          Length = 154318

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 413   gtggagagatgggtggatggatgga 437
             |||||| ||||||||||||||||||
Sbjct: 67580 gtggagggatgggtggatggatgga 67604

to top

>gb|AC138512.4| Homo sapiens chromosome 16 clone RP11-93B18, complete sequence
          Length = 159064

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 413   gtggagagatgggtggatggatgga 437
             ||||| |||||||||||||||||||
Sbjct: 44907 gtggacagatgggtggatggatgga 44883

to top

>gb|AC100735.15| Mus musculus chromosome 7, clone RP24-331F7, complete sequence
          Length = 179974

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 413   gtggagagatgggtggatggatgga 437
             ||||| |||||||||||||||||||
Sbjct: 62980 gtggatagatgggtggatggatgga 63004

to top

>gb|AC149590.5| Mus musculus BAC clone RP23-348L9 from chromosome 5, complete sequence
          Length = 196662

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 413   gtggagagatgggtggatggatgga 437
             ||||| |||||||||||||||||||
Sbjct: 88967 gtggatagatgggtggatggatgga 88991



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 413   gtggagagatgggtggatggatgg 436
             ||||| ||||||||||||||||||
Sbjct: 88943 gtggatagatgggtggatggatgg 88966

to top

>gb|AC138433.2| Homo sapiens chromosome 19 clone XXfos-85899E4, complete sequence
          Length = 38016

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 413   gtggagagatgggtggatggatgga 437
             ||||| |||||||||||||||||||
Sbjct: 28789 gtggacagatgggtggatggatgga 28813

to top

>gb|AC006124.2| Homo sapiens chromosome 19, cosmid R34739, complete sequence
          Length = 32735

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 413  gtggagagatgggtggatggatgga 437
            ||||| |||||||||||||||||||
Sbjct: 9074 gtggacagatgggtggatggatgga 9098

to top

>gb|AC025279.6| Homo sapiens chromosome 16 clone RP11-231C14, complete sequence
          Length = 171940

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 413  gtggagagatgggtggatggatgga 437
            ||||| |||||||||||||||||||
Sbjct: 7545 gtggacagatgggtggatggatgga 7569

to top

>emb|BX649428.7| Zebrafish DNA sequence from clone CH211-51A6 in linkage group 20,
             complete sequence
          Length = 109495

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 416   gagagatgggtggatggatgg 436
             |||||||||||||||||||||
Sbjct: 58935 gagagatgggtggatggatgg 58915

to top

>dbj|AP004648.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1449_H02
          Length = 117860

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 322   aaacatacacacggacaccta 342
             |||||||||||||||||||||
Sbjct: 64549 aaacatacacacggacaccta 64529

to top

>emb|BX511298.10| Zebrafish DNA sequence from clone DKEY-210E13 in linkage group 4,
              complete sequence
          Length = 217817

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 314    caccacacaaacatacacacg 334
              |||||||||||||||||||||
Sbjct: 116004 caccacacaaacatacacacg 116024

to top

>gb|AC107631.20| Mus musculus chromosome 5, clone RP23-5M20, complete sequence
          Length = 225977

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 413    gtggagagatgggtggatggatgga 437
              ||||| |||||||||||||||||||
Sbjct: 224968 gtggatagatgggtggatggatgga 224944



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 413    gtggagagatgggtggatggatgg 436
              ||||| ||||||||||||||||||
Sbjct: 224992 gtggatagatgggtggatggatgg 224969

to top

>emb|BX927333.11| Zebrafish DNA sequence from clone CH211-69C15 in linkage group 10,
             complete sequence
          Length = 146168

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 420   gatgggtggatggatggagaa 440
             |||||||||||||||||||||
Sbjct: 44436 gatgggtggatggatggagaa 44456

to top

>emb|CR926299.2| Xenopus tropicalis finished cDNA, clone TEgg080d21
          Length = 2423

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 184 aggagctgaaaaagaaagaaaagag 208
           ||||||||||||||||| |||||||
Sbjct: 317 aggagctgaaaaagaaataaaagag 341

to top

>gb|AC103664.12| Mus musculus chromosome 7, clone RP23-348F4, complete sequence
          Length = 222413

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 417   agagatgggtggatggatgga 437
             |||||||||||||||||||||
Sbjct: 58816 agagatgggtggatggatgga 58796

to top

>gb|AC153562.2| Mus musculus 10 BAC RP23-143D12 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 212486

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 422    tgggtggatggatggagaagg 442
              |||||||||||||||||||||
Sbjct: 153768 tgggtggatggatggagaagg 153788

to top

>emb|AL845461.11| Mouse DNA sequence from clone RP23-331F18 on chromosome 2, complete
             sequence
          Length = 33467

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 413   gtggagagatgggtggatggatgga 437
             ||||| |||||||||||||||||||
Sbjct: 18281 gtggatagatgggtggatggatgga 18305

to top

>gb|AC153560.5| Mus musculus 10 BAC RP23-376E10 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 183485

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 422    tgggtggatggatggagaagg 442
              |||||||||||||||||||||
Sbjct: 142684 tgggtggatggatggagaagg 142664

to top

>gb|AC005264.1|AC005264 Homo sapiens chromosome 19, cosmid R31335, complete sequence
          Length = 39172

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 413   gtggagagatgggtggatggatgga 437
             ||||| |||||||||||||||||||
Sbjct: 23568 gtggacagatgggtggatggatgga 23592

to top

>gb|AC104098.5| Mus musculus BAC clone RP24-372H3 from 5, complete sequence
          Length = 180886

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 420    gatgggtggatggatggagaa 440
              |||||||||||||||||||||
Sbjct: 103805 gatgggtggatggatggagaa 103785

to top

>gb|AC002110.1|AC002110 Genomic sequence from Human 9q34, complete sequence
          Length = 30900

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 414  tggagagatgggtggatggatggag 438
            ||||| |||||||||||||||||||
Sbjct: 9672 tggagggatgggtggatggatggag 9648

to top

>gb|AC002104.1|AC002104 Genomic sequence from Human 9q34, complete sequence
          Length = 47036

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 414   tggagagatgggtggatggatggag 438
             ||||| |||||||||||||||||||
Sbjct: 35533 tggagggatgggtggatggatggag 35509

to top

>gb|AC000405.1|AC000405 Genomic sequence from Human 9q34, complete sequence
          Length = 38250

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 414  tggagagatgggtggatggatggag 438
            ||||| |||||||||||||||||||
Sbjct: 6142 tggagggatgggtggatggatggag 6166

to top

>gb|AC136837.1| Homo sapiens chromosome 16 clone RP11-483N11, complete sequence
          Length = 65756

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 413   gtggagagatgggtggatggatgga 437
             ||||| |||||||||||||||||||
Sbjct: 42662 gtggacagatgggtggatggatgga 42686

to top

>gb|AC091401.2| Sus scrofa clone RP44-198J22, complete sequence
          Length = 177559

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 192  aaaaagaaagaaaagagcatgtgga 216
            |||||||||||||| ||||||||||
Sbjct: 1645 aaaaagaaagaaaaaagcatgtgga 1669

to top

>emb|AL512356.6|CNS07EF5 Human chromosome 14 DNA sequence BAC R-44N21 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 158467

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 417   agagatgggtggatggatgga 437
             |||||||||||||||||||||
Sbjct: 67839 agagatgggtggatggatgga 67819

to top

>emb|AL591204.14| Mouse DNA sequence from clone RP23-28C17 on chromosome 11, complete
             sequence
          Length = 148846

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 413   gtggagagatgggtggatggatgga 437
             ||||| |||||||||||||||||||
Sbjct: 86321 gtggatagatgggtggatggatgga 86345

to top

>gb|AC122562.8| Mus musculus chromosome 5, clone RP24-103L16, complete sequence
          Length = 172210

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 192   aaaaagaaagaaaagagcat 211
             ||||||||||||||||||||
Sbjct: 27846 aaaaagaaagaaaagagcat 27865

to top

>gb|AC098644.4| Takifugu rubripes clone 205P11, complete sequence
          Length = 89481

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 420   gatgggtggatggatggagaaggg 443
             ||||||||||||||||||| ||||
Sbjct: 47897 gatgggtggatggatggaggaggg 47920

to top

>gb|AC138265.9| Mus musculus chromosome 5, clone RP23-41J13, complete sequence
          Length = 172279

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 420    gatgggtggatggatggaga 439
              ||||||||||||||||||||
Sbjct: 169814 gatgggtggatggatggaga 169833

to top

>gb|AC122005.3| Mus musculus chromosome 5 clone RP24-340B11, complete sequence
          Length = 183264

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 418   gagatgggtggatggatgga 437
             ||||||||||||||||||||
Sbjct: 77646 gagatgggtggatggatgga 77627

to top

>gb|AC113041.9| Mus musculus chromosome 8, clone RP23-240K12, complete sequence
          Length = 175827

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 418    gagatgggtggatggatgga 437
              ||||||||||||||||||||
Sbjct: 125543 gagatgggtggatggatgga 125562

to top

>gb|AC144767.4| Mus musculus BAC clone RP23-82F8 from chromosome 6, complete sequence
          Length = 229027

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 25320 tggatagatgggtggatggatgga 25343

to top

>gb|AC153356.5| Mus musculus BAC clone RP24-477I13 from chromosome 10, complete
             sequence
          Length = 207243

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 314   caccacacaaacatacacac 333
             ||||||||||||||||||||
Sbjct: 47508 caccacacaaacatacacac 47489

to top

>gb|AC112962.15| Mus musculus chromosome 19, clone RP24-74N6, complete sequence
          Length = 182999

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 420   gatgggtggatggatggaga 439
             ||||||||||||||||||||
Sbjct: 48597 gatgggtggatggatggaga 48578

to top

>gb|AC102291.7| Mus musculus chromosome 15, clone RP24-366F6, complete sequence
          Length = 143783

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 420   gatgggtggatggatggaga 439
             ||||||||||||||||||||
Sbjct: 33775 gatgggtggatggatggaga 33756

to top

>gb|AC124228.16| Mus musculus chromosome 5, clone RP23-345O14, complete sequence
          Length = 219244

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              ||||| ||||||||||||||||||
Sbjct: 116188 tggagggatgggtggatggatgga 116211

to top

>gb|AY207448.1| Hemibagrus nemurus clone Mnbp5-2-05 microsatellite locus
          Length = 663

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 417 agagatgggtggatggatgg 436
           ||||||||||||||||||||
Sbjct: 331 agagatgggtggatggatgg 350

to top

>gb|AC123662.13| Mus musculus chromosome 5, clone RP23-213N8, complete sequence
          Length = 223267

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 192    aaaaagaaagaaaagagcat 211
              ||||||||||||||||||||
Sbjct: 212856 aaaaagaaagaaaagagcat 212875

to top

>gb|AC151715.3| Mus musculus BAC clone RP23-396L12 from chromosome 7, complete sequence
          Length = 204221

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||| ||||||||||||
Sbjct: 68796 tggagagatggatggatggatgga 68773

to top

>gb|AC135079.9| Mus musculus chromosome 15, clone RP24-439P7, complete sequence
          Length = 155778

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 420   gatgggtggatggatggaga 439
             ||||||||||||||||||||
Sbjct: 14027 gatgggtggatggatggaga 14046

to top

>gb|AC131725.2| Mus musculus BAC clone RP23-129H16 from chromosome 5, complete sequence
          Length = 203437

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 16934 tggatagatgggtggatggatgga 16911

to top

>gb|AC147377.4| Mus musculus BAC clone RP23-156K23 from chromosome 5, complete sequence
          Length = 236084

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 181696 tggatagatgggtggatggatgga 181673



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 111617 tggatagatgggtggatggatgga 111640

to top

>gb|AC183804.3| Pan troglodytes BAC clone CH251-67P16 from chromosome 2, complete
             sequence
          Length = 169437

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 74326 tggatagatgggtggatggatgga 74303



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 74302 tggatagatgggtggatggatgga 74279



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 74282 tggatagatgggtggatggatgga 74259



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 74258 tggatagatgggtggatggatgga 74235



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 74230 tggatagatgggtggatggatgga 74207



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 74102 tggatagatgggtggatggatgga 74079

to top

>gb|AC140302.2| Mus musculus BAC clone RP24-321I14 from chromosome 5, complete sequence
          Length = 174372

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 420   gatgggtggatggatggaga 439
             ||||||||||||||||||||
Sbjct: 17777 gatgggtggatggatggaga 17758

to top

>gb|AC141426.3| Mus musculus BAC clone RP23-280I14 from chromosome 12, complete sequence
          Length = 227835

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 133024 tggacagatgggtggatggatgga 133001

to top

>gb|DQ481667.1| Takifugu rubripes HoxCa gene cluster, complete sequence
          Length = 378763

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 191    gaaaaagaaagaaaagagca 210
              ||||||||||||||||||||
Sbjct: 144482 gaaaaagaaagaaaagagca 144501

to top

>gb|AC137154.2| Mus musculus BAC clone RP24-572L22 from chromosome 5, complete sequence
          Length = 173460

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 418    gagatgggtggatggatgga 437
              ||||||||||||||||||||
Sbjct: 168801 gagatgggtggatggatgga 168782

to top

>gb|AC124374.5| Mus musculus BAC clone RP24-567K8 from chromosome 5, complete sequence
          Length = 181395

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 170317 tggatagatgggtggatggatgga 170340

to top

>gb|AC144758.2| Danio rerio, complete sequence
          Length = 177787

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||| ||||||||||||
Sbjct: 23204 tggagagatggatggatggatgga 23181



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||| ||||||||||||
Sbjct: 22716 tggagagatggatggatggatgga 22693

to top

>gb|AC006012.2| Homo sapiens PAC clone RP5-942I16 from 7, complete sequence
          Length = 121598

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 420   gatgggtggatggatggaga 439
             ||||||||||||||||||||
Sbjct: 66240 gatgggtggatggatggaga 66221

to top

>gb|AC101737.6| Mus musculus chromosome 1, clone RP23-471L1, complete sequence
          Length = 235405

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 187   agctgaaaaagaaagaaaag 206
             ||||||||||||||||||||
Sbjct: 76144 agctgaaaaagaaagaaaag 76163

to top

>gb|AC115800.13| Mus musculus chromosome 8, clone RP23-407E22, complete sequence
          Length = 228513

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 210033 tggatagatgggtggatggatgga 210010

to top

>gb|AC134832.5| Mus musculus BAC clone RP24-561D12 from chromosome 7, complete sequence
          Length = 158123

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 72421 tggatagatgggtggatggatgga 72398

to top

>emb|CR388131.10| Zebrafish DNA sequence from clone DKEY-114G9 in linkage group 1,
             complete sequence
          Length = 169443

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 88799 tggatagatgggtggatggatgga 88822

to top

>gb|AC007616.5| Homo sapiens chromosome 16 clone RP11-547D14, complete sequence
          Length = 132492

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 413    gtggagagatgggtggatggatgg 436
              ||||| ||||||||||||||||||
Sbjct: 108768 gtggatagatgggtggatggatgg 108791

to top

>gb|AC007613.8| Homo sapiens chromosome 16 clone RP11-490O6, complete sequence
          Length = 161146

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 413  gtggagagatgggtggatggatgg 436
            ||||| ||||||||||||||||||
Sbjct: 5573 gtggatagatgggtggatggatgg 5596

to top

>gb|AC137749.11| Mus musculus chromosome 6, clone RP23-69C16, complete sequence
          Length = 293695

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 105263 tggatagatgggtggatggatgga 105286

to top

>emb|CR936360.14| Human DNA sequence from clone RP13-440N7 on chromosome X, complete
              sequence
          Length = 154563

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 116105 tggatagatgggtggatggatgga 116128

to top

>emb|CR855305.12| Zebrafish DNA sequence from clone DKEY-98F17 in linkage group 5, complete
              sequence
          Length = 155542

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 126535 tggatagatgggtggatggatgga 126558

to top

>gb|AC127264.4| Mus musculus BAC clone RP24-336J13 from chromosome 19, complete
             sequence
          Length = 169256

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 88350 tggatagatgggtggatggatgga 88373

to top

>gb|AC124520.4| Mus musculus BAC clone RP23-395G14 from chromosome 7, complete sequence
          Length = 205352

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 419    agatgggtggatggatggag 438
              ||||||||||||||||||||
Sbjct: 153002 agatgggtggatggatggag 152983

to top

>gb|AC068594.15| Homo sapiens chromosome 17, clone RP11-285E9, complete sequence
          Length = 168501

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 180   gaagaggagctgaaaaagaaagaaaaga 207
             |||||||||  |||||||||||||||||
Sbjct: 32668 gaagaggaggagaaaaagaaagaaaaga 32641

to top

>gb|AC121771.3| Mus musculus BAC clone RP23-348H21 from chromosome 3, complete sequence
          Length = 190309

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 316    ccacacaaacatacacacggacac 339
              |||||||| |||||||||||||||
Sbjct: 143433 ccacacaagcatacacacggacac 143410

to top

>gb|AC091092.3| Papio anubis clone RP41-191D8, complete sequence
          Length = 167732

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 413   gtggagagatgggtggatggatgg 436
             ||||| ||||||||||||||||||
Sbjct: 44937 gtggatagatgggtggatggatgg 44914



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 420   gatgggtggatggatggaga 439
             ||||||||||||||||||||
Sbjct: 44059 gatgggtggatggatggaga 44040

to top

>gb|AC125050.6| Mus musculus BAC clone RP23-372I18 from chromosome 7, complete sequence
          Length = 199810

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||| ||||||||||||
Sbjct: 26938 tggagagatggatggatggatgga 26915



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||| ||||||||||||
Sbjct: 26882 tggagagatggatggatggatgga 26859



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||| ||||||||||||
Sbjct: 26770 tggagagatggatggatggatgga 26747

to top

>gb|AC126263.4| Mus musculus BAC clone RP23-359P12 from chromosome 8, complete sequence
          Length = 223991

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 213266 tggatagatgggtggatggatgga 213289

to top

>gb|AC125207.5| Mus musculus BAC clone RP23-220C16 from 8, complete sequence
          Length = 189936

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||||||| ||||||||
Sbjct: 42374 tggagagatgggtgggtggatgga 42351

to top

>emb|CR735141.14| Zebrafish DNA sequence from clone CH211-128E9 in linkage group 15,
             complete sequence
          Length = 108767

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||| ||||||||||||||
Sbjct: 83163 tggagagataggtggatggatgga 83140

to top

>gb|AC124198.2| Mus musculus BAC clone RP23-306E4 from 8, complete sequence
          Length = 172546

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 191    gaaaaagaaagaaaagagca 210
              ||||||||||||||||||||
Sbjct: 109112 gaaaaagaaagaaaagagca 109093

to top

>gb|AC006001.2| Homo sapiens PAC clone RP4-756H11 from 7, complete sequence
          Length = 135044

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 189    ctgaaaaagaaagaaaagag 208
              ||||||||||||||||||||
Sbjct: 131238 ctgaaaaagaaagaaaagag 131257

to top

>gb|AC113085.6| Mus musculus chromosome 8, clone RP23-292P21, complete sequence
          Length = 211723

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 418    gagatgggtggatggatgga 437
              ||||||||||||||||||||
Sbjct: 196068 gagatgggtggatggatgga 196049

to top

>gb|AC101833.14| Mus musculus chromosome 1, clone RP24-496H15, complete sequence
          Length = 167684

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 193   aaaagaaagaaaagagcatg 212
             ||||||||||||||||||||
Sbjct: 16179 aaaagaaagaaaagagcatg 16198

to top

>emb|CR559944.12| Zebrafish DNA sequence from clone CH211-10D19 in linkage group 13,
             complete sequence
          Length = 180933

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||| ||||||||||||||||||
Sbjct: 74042 tggagggatgggtggatggatgga 74065

to top

>gb|AC158914.4| Mus musculus chromosome 5, clone RP24-249F11, complete sequence
          Length = 155216

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 154502 tggatagatgggtggatggatgga 154479

to top

>emb|CR391930.9| Zebrafish DNA sequence from clone CH211-154B16 in linkage group 15,
             complete sequence
          Length = 175972

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||| ||||||||||||
Sbjct: 67692 tggagagatggatggatggatgga 67669

to top

>emb|AL831732.18| Human DNA sequence from clone RP11-396L10 on chromosome 1, complete
             sequence
          Length = 38529

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 27647 tggatagatgggtggatggatgga 27624

to top

>emb|Z84475.1|HS162C6 Human DNA sequence from clone RP1-162C6 on chromosome 6q21, complete
             sequence
          Length = 91017

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 314   caccacacaaacatacacac 333
             ||||||||||||||||||||
Sbjct: 80533 caccacacaaacatacacac 80514

to top

>emb|BX908382.8| Human DNA sequence from clone WI2-87105E3 on chromosome X Contains the
             5' end of the CRLF2 gene for cytokine receptor-like factor
             2, complete sequence
          Length = 33657

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 31237 tggatagatgggtggatggatgga 31260

to top

>emb|AL607044.24| Human DNA sequence from clone RP13-392N17 on chromosome 10, complete
             sequence
          Length = 125086

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 26036 tggatagatgggtggatggatgga 26059

to top

>emb|AL606510.10| Human DNA sequence from clone RP11-435D11 on chromosome 10, complete
            sequence
          Length = 99961

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 414  tggagagatgggtggatggatgga 437
            |||| |||||||||||||||||||
Sbjct: 7089 tggacagatgggtggatggatgga 7112

to top

>emb|AL592549.7| Human DNA sequence from clone RP11-374B16 on chromosome 9, complete
             sequence
          Length = 128613

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 85084 tggatagatgggtggatggatgga 85107

to top

>emb|AL592156.4| Human DNA sequence from clone RP11-492O8 on chromosome X Contains a H2A
              histone family B pseudogene, complete sequence
          Length = 134995

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 421    atgggtggatggatggagaa 440
              ||||||||||||||||||||
Sbjct: 132507 atgggtggatggatggagaa 132488

to top

>emb|AL512383.11| Human DNA sequence from clone RP11-193J6 on chromosome 1 Contains
            part of the PRDM16 gene for PR domain containing 16,
            complete sequence
          Length = 44335

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 413  gtggagagatgggtggatggatgg 436
            ||||| ||||||||||||||||||
Sbjct: 8635 gtggatagatgggtggatggatgg 8612

to top

>emb|AL513304.27| Human DNA sequence from clone RP11-398B16 on chromosome 10 Contains part
              of the gene for double-stranded RNA specific adenosine
              deaminase (ADAR3), a novel gene and two CpG islands,
              complete sequence
          Length = 163243

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 106199 tggatagatgggtggatggatgga 106176

to top

>emb|AL451164.13| Human DNA sequence from clone RP11-298E9 on chromosome 10 Contains the 3'
              end of the PFKP gene for phosphofructokinase platelet, a
              novel gene (FLJ40226) the PITRM1 gene for pitrilysin
              metalloproteinase 1 (MP1 hMP1 KIAA1104), three novel genes
              and two CpG islands, complete sequence
          Length = 163070

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 119516 tggatagatgggtggatggatgga 119493

to top

>emb|AL445201.14| Human DNA sequence from clone RP11-358L16 on chromosome 10 Contains a AFR
              GTPase-activating protein (MRIP2) pseudogene, a novel gene,
              gene LOC93550, the 3' end of a KIAA0592 pseudogene and
              three CpG islands, complete sequence
          Length = 179193

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 192    aaaaagaaagaaaagagcat 211
              ||||||||||||||||||||
Sbjct: 126212 aaaaagaaagaaaagagcat 126193

to top

>emb|AL391316.7| Human DNA sequence from clone XX-YM901F10 on chromosome 20 Contains
             ESTs, GSSs and STSs, complete sequence
          Length = 49377

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 316   ccacacaaacatacacacggacac 339
             |||||||||||||||||| |||||
Sbjct: 31007 ccacacaaacatacacacagacac 30984

to top

>emb|AL359983.7| Human DNA sequence from clone RP11-139L21 on chromosome 1 Contains part
              of a novel gene (FLJ10157), complete sequence
          Length = 166254

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              ||||||||||| ||||||||||||
Sbjct: 131429 tggagagatggatggatggatgga 131406



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              ||||||||||| ||||||||||||
Sbjct: 131405 tggagagatggatggatggatgga 131382



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              ||||||||||| ||||||||||||
Sbjct: 131329 tggagagatggatggatggatgga 131306

to top

>emb|AL357509.13| Human DNA sequence from clone RP11-387P17 on chromosome 1, complete
             sequence
          Length = 89104

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||| ||||||||||||
Sbjct: 30641 tggagagatggatggatggatgga 30618

to top

>emb|AL355132.19| Human DNA sequence from clone RP11-181D10 on chromosome 13 Contains a
             ring finger protein 12 (RNF12) pseudogene, the 5' end of
             the FOXO1A gene for forkhead box O1A (rhabdomyosarcoma),
             the 3' end of the MRPS31 gene for mitochondrial ribosomal
             protein S31 and a CpG island, complete sequence
          Length = 151261

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 418   gagatgggtggatggatgga 437
             ||||||||||||||||||||
Sbjct: 90533 gagatgggtggatggatgga 90552

to top

>emb|AL356552.8| Human DNA sequence from clone RP4-732F8 on chromosome 1p34.3-36.11
            Contains GSSs, complete sequence
          Length = 25633

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 414  tggagagatgggtggatggatgga 437
            ||||||||||||||||||| ||||
Sbjct: 6535 tggagagatgggtggatgggtgga 6558

to top

>emb|AL354921.12| Human DNA sequence from clone RP5-840O13 on chromosome 11p12-13, complete
              sequence
          Length = 106657

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              ||||||||||| ||||||||||||
Sbjct: 105696 tggagagatggatggatggatgga 105673

to top

>emb|AL158086.32| Human DNA sequence from clone RP4-815O16 on chromosome 1p35.1-36.13
             Contains the C1QA gene for complement component 1( q
             subcomponent, alpha polypeptide), the C1QG gene for
             complement component 1 (q subcomponent, gamma
             polypeptide), the C1QB gene for complement component 1 (q
             subcomponent, beta polypeptide), the 5' end of the  EPHB2
             gene for EphB2 and a CpG island, complete sequence
          Length = 87320

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 416   gagagatgggtggatggatggaga 439
             ||||||||| ||||||||||||||
Sbjct: 31647 gagagatggatggatggatggaga 31670

to top

>emb|AL160412.14| Human DNA sequence from clone RP5-827E24 on chromosome 20 Contains ESTs,
              STSs and GSSs, complete sequence
          Length = 111824

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 413    gtggagagatgggtggatggatgg 436
              ||||| ||||||||||||||||||
Sbjct: 100594 gtggatagatgggtggatggatgg 100571

to top

>emb|AL121829.30|HSJ697K14 Human DNA sequence from clone RP4-697K14 on chromosome 20 Contains the
             C20orf148 gene for a novel tyrosine kinase, the PTK6 gene
             for protein tyrosine kinase 6, a novel gene, the EEF1A2
             gene for eukaryotic translation elongation factor 1 alpha
             2, the 5' end of the KCNQ2 gene for potassium
             voltage-gated channel (KQT-like subfamily member 2), the
             gene for peroxisomal proliferator-activated receptor A
             interacting complex 285 (PRIC285)(FLJ00244, KIAA1769), the
             C20orf149 gene, the gene for novel protein MGC5356
             (MGC5356), the gene for a novel protein (LOC200213), a
             novel gene and thirteen CpG islands, complete sequence
          Length = 113196

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||| ||||||||||||
Sbjct: 21472 tggagagatggatggatggatgga 21495

to top

>emb|AL121908.16|HSDJ719C8 Human DNA sequence from clone RP4-719C8 on chromosome 20 Contains three
             different 5' ends of the C20orf101 gene and three CpG
             islands, complete sequence
          Length = 150985

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 420   gatgggtggatggatggaga 439
             ||||||||||||||||||||
Sbjct: 63734 gatgggtggatggatggaga 63753

to top

>emb|AL035682.16|HS1009H6 Human DNA sequence from clone RP5-1009H6 on chromosome 20 Contains the
             3' end of the NFATC2 gene for cytoplasmic
             calcineurin-dependent (2) nuclear factor of activated
             T-cells, complete sequence
          Length = 89163

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 75492 tggatagatgggtggatggatgga 75515

to top

>emb|AL031588.1|HS1163J1 Human DNA sequence from clone RP5-1163J1 on chromosome 22q13.2-13.33,
             complete sequence
          Length = 127168

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||| ||||||||||||||||
Sbjct: 58228 tggagaggtgggtggatggatgga 58251

to top

>emb|AL732484.13| Mouse DNA sequence from clone RP23-37B7 on chromosome 2, complete
             sequence
          Length = 201265

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 33266 tggacagatgggtggatggatgga 33289



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 33202 tggacagatgggtggatggatgga 33225

to top

>emb|AL020994.1|HS929C8 Human DNA sequence from clone CTA-929C8 on chromosome 22q12.1-12.3,
             complete sequence
          Length = 139190

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 44372 tggatagatgggtggatggatgga 44349

to top

>emb|BX323824.17| Zebrafish DNA sequence from clone DKEY-37F18 in linkage group 25,
            complete sequence
          Length = 168743

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 414  tggagagatgggtggatggatgga 437
            ||||||||||| ||||||||||||
Sbjct: 1183 tggagagatggatggatggatgga 1160

to top

>emb|CR626941.10| Zebrafish DNA sequence from clone DKEY-12J5 in linkage group 16,
             complete sequence
          Length = 238554

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 419   agatgggtggatggatggagaagg 442
             ||||||||||||||||||| ||||
Sbjct: 98658 agatgggtggatggatggaaaagg 98681

to top

>gb|AC051649.21| Homo sapiens chromosome 11, clone RP11-534I22, complete sequence
          Length = 188519

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 136524 tggatagatgggtggatggatgga 136501

to top

>gb|AC010538.9| Homo sapiens chromosome 16 clone RP11-368I7, complete sequence
          Length = 210031

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 413    gtggagagatgggtggatggatgg 436
              ||||| ||||||||||||||||||
Sbjct: 143467 gtggacagatgggtggatggatgg 143490

to top

>emb|X86563.2|ZMA86563 Zea mays complete chloroplast genome
          Length = 140384

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 191   gaaaaagaaagaaaagagca 210
             ||||||||||||||||||||
Sbjct: 51099 gaaaaagaaagaaaagagca 51080

to top

>gb|AC163627.4| Mus musculus BAC clone RP23-341E13 from chromosome 6, complete sequence
          Length = 191467

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 38725 tggatagatgggtggatggatgga 38702

to top

>emb|CR927553.8| Zebrafish DNA sequence from clone DKEY-206P8 in linkage group 17,
            complete sequence
          Length = 162064

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 421  atgggtggatggatggagaa 440
            ||||||||||||||||||||
Sbjct: 9560 atgggtggatggatggagaa 9541

to top

>emb|AL954254.2| Pan troglodytes chromosome 22 clone PTB-153H02 map 22q22.3, complete
              sequence
          Length = 182818

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 405    atggatccgtggagagatgggtggatggatgg 436
              |||||| |||||  ||||||||||||||||||
Sbjct: 125772 atggatgcgtgggtagatgggtggatggatgg 125741

to top

>emb|AL954255.1| Pan troglodytes chromosome 22 clone PTB-044C19 map 22q22.3, complete
             sequence
          Length = 177268

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 405   atggatccgtggagagatgggtggatggatgg 436
             |||||| |||||  ||||||||||||||||||
Sbjct: 43173 atggatgcgtgggtagatgggtggatggatgg 43142

to top

>emb|BX510906.21| Zebrafish DNA sequence from clone CH211-203M24 in linkage group 20,
            complete sequence
          Length = 70824

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 414  tggagagatgggtggatggatgga 437
            ||||||||||| ||||||||||||
Sbjct: 6377 tggagagatggatggatggatgga 6400

to top

>emb|AL672026.11| Mouse DNA sequence from clone RP23-403O11 on chromosome X, complete
              sequence
          Length = 200566

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 314    caccacacaaacatacacac 333
              ||||||||||||||||||||
Sbjct: 142598 caccacacaaacatacacac 142579

to top

>gb|AC021763.10| Homo sapiens chromosome 18, clone RP11-56O21, complete sequence
          Length = 158405

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 419    agatgggtggatggatggag 438
              ||||||||||||||||||||
Sbjct: 127077 agatgggtggatggatggag 127058

to top

>gb|AC158402.6| Mus musculus chromosome 1, clone RP24-328M23, complete sequence
          Length = 176270

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 191   gaaaaagaaagaaaagagcatgtg 214
             ||||||||| ||||||||||||||
Sbjct: 32108 gaaaaagaatgaaaagagcatgtg 32085

to top

>emb|BX548162.12| Zebrafish DNA sequence from clone DKEYP-90D11 in linkage group 11,
              complete sequence
          Length = 180422

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 133664 tggatagatgggtggatggatgga 133641

to top

>gb|AC159301.2| Mus musculus BAC clone RP23-213B1 from chromosome 13, complete
            sequence
          Length = 188633

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 414  tggagagatgggtggatggatgga 437
            |||| |||||||||||||||||||
Sbjct: 8887 tggatagatgggtggatggatgga 8910



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 414  tggagagatgggtggatggatgga 437
            |||| |||||||||||||||||||
Sbjct: 8767 tggatagatgggtggatggatgga 8790



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 414  tggagagatgggtggatggatgga 437
            |||| |||||||||||||||||||
Sbjct: 8715 tggatagatgggtggatggatgga 8738



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 414  tggagagatgggtggatggatgga 437
            |||| |||||||||||||||||||
Sbjct: 8635 tggatagatgggtggatggatgga 8658



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 414  tggagagatgggtggatggatgga 437
            |||| |||||||||||||||||||
Sbjct: 8455 tggatagatgggtggatggatgga 8478

to top

>emb|BX537142.10| Zebrafish DNA sequence from clone CH211-271D10 in linkage group 16,
             complete sequence
          Length = 176055

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||| ||||||||||||||||||
Sbjct: 87417 tggagggatgggtggatggatgga 87440

to top

>emb|BX005225.20| Zebrafish DNA sequence from clone DKEY-34L15 in linkage group 14,
              complete sequence
          Length = 206042

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 124764 tggatagatgggtggatggatgga 124741

to top

>gb|AE014175.1| Mus musculus piebald deletion region section 3 of 11 of the complete
              sequence
          Length = 404829

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 274658 tggacagatgggtggatggatgga 274681

to top

>gb|AC098613.2| Homo sapiens chromosome 3 clone RP11-24F11, complete sequence
          Length = 185437

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 413    gtggagagatgggtggatggatgg 436
              ||||| ||||||||||||||||||
Sbjct: 180338 gtggacagatgggtggatggatgg 180315

to top

>gb|AC119424.2| Homo sapiens chromosome 3 clone RP11-475O23, complete sequence
          Length = 208015

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              ||||||||||| ||||||||||||
Sbjct: 106449 tggagagatggatggatggatgga 106426

to top

>gb|AC112673.7| Homo sapiens chromosome 8, clone RP11-212F11, complete sequence
          Length = 167547

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 419   agatgggtggatggatggag 438
             ||||||||||||||||||||
Sbjct: 54542 agatgggtggatggatggag 54523

to top

>gb|AC015959.9| Homo sapiens chromosome 18, clone RP11-63I8, complete sequence
          Length = 130528

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 419   agatgggtggatggatggag 438
             ||||||||||||||||||||
Sbjct: 94583 agatgggtggatggatggag 94602

to top

>emb|BX510999.11| Zebrafish DNA sequence from clone CH211-157P22 in linkage group 5,
              complete sequence
          Length = 160405

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 124108 tggatagatgggtggatggatgga 124085

to top

>gb|AC011490.7| Homo sapiens chromosome 19 clone CTB-179L3, complete sequence
          Length = 115289

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 420   gatgggtggatggatggaga 439
             ||||||||||||||||||||
Sbjct: 85679 gatgggtggatggatggaga 85660

to top

>gb|AC011480.3| Homo sapiens chromosome 19 clone CTB-124I16, complete sequence
          Length = 80878

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 405   atggatccgtggagagatgggtggatggatgg 436
             ||||||| || |||||||||||||||| ||||
Sbjct: 16475 atggatcagtagagagatgggtggatgaatgg 16506

to top

>gb|AC122110.4| Mus Musculus Strain C57BL6/J Chromosome 2 BAC, RP23-319K8, Complete
             Sequence, complete sequence
          Length = 179550

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 61239 tggatagatgggtggatggatgga 61262

to top

>gb|AC113145.7| Homo sapiens chromosome 8, clone RP11-109P6, complete sequence
          Length = 173357

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 314    caccacacaaacatacacac 333
              ||||||||||||||||||||
Sbjct: 100265 caccacacaaacatacacac 100284

to top

>gb|AC112175.2| Homo sapiens chromosome 5 clone CTD-2568P10, complete sequence
          Length = 142712

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 77173 tggatagatgggtggatggatgga 77150

to top

>gb|AC008540.6| Homo sapiens chromosome 19 clone CTC-496P20, complete sequence
          Length = 224931

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 182496 tggatagatgggtggatggatgga 182519

to top

>gb|AC104304.2| Homo sapiens chromosome 3 clone RP11-509I21, complete sequence
          Length = 202933

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 413   gtggagagatgggtggatggatgg 436
             ||||| ||||||||||||||||||
Sbjct: 56153 gtggacagatgggtggatggatgg 56130

to top

>emb|BX511037.9| Zebrafish DNA sequence from clone DKEY-66N24 in linkage group 1, complete
              sequence
          Length = 148544

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||||||||||||||||| |||||
Sbjct: 118225 tggagagatgggtggatgaatgga 118202

to top

>gb|AC105751.2| Homo sapiens chromosome 3 clone RP11-908O9, complete sequence
          Length = 168835

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||| ||||||||||||
Sbjct: 81180 tggagagatggatggatggatgga 81203

to top

>gb|AC083841.9| Homo sapiens chromosome 8, clone RP11-706C16, complete sequence
          Length = 203375

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 420    gatgggtggatggatggaga 439
              ||||||||||||||||||||
Sbjct: 140783 gatgggtggatggatggaga 140764

to top

>gb|AC087636.5| Homo sapiens chromosome 15, clone RP11-469K5, complete sequence
          Length = 143410

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 312  tccaccacacaaacatacac 331
            ||||||||||||||||||||
Sbjct: 9493 tccaccacacaaacatacac 9512

to top

>gb|AC016397.6| Homo sapiens chromosome 10 clone RP11-541M12, complete sequence
          Length = 206909

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 142453 tggatagatgggtggatggatgga 142430

to top

>gb|AC092851.9| Homo sapiens 12 BAC RP11-459D22 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 145550

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 317   cacacaaacatacacacgga 336
             ||||||||||||||||||||
Sbjct: 28550 cacacaaacatacacacgga 28531

to top

>gb|AC109357.3| Homo sapiens BAC clone RP11-636M7 from 4, complete sequence
          Length = 110883

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 414  tggagagatgggtggatggatgga 437
            |||| |||||||||||||||||||
Sbjct: 9497 tggatagatgggtggatggatgga 9520

to top

>gb|AC091988.3| Homo sapiens chromosome 5 clone RP11-73G8, complete sequence
          Length = 148263

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||| ||||||||||||
Sbjct: 39955 tggagagatggatggatggatgga 39978

to top

>gb|AC016399.9| Homo sapiens chromosome 10 clone RP11-70E21, complete sequence
          Length = 173239

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 146044 tggatagatgggtggatggatgga 146067

to top

>gb|AC105270.2| Homo sapiens chromosome 1 clone RP4-684L20, complete sequence
          Length = 158043

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 106594 tggatagatgggtggatggatgga 106617

to top

>gb|AC087240.17| Homo sapiens 12p BAC RP11-752F20 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 198068

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 317    cacacaaacatacacacgga 336
              ||||||||||||||||||||
Sbjct: 191624 cacacaaacatacacacgga 191605

to top

>dbj|AK142905.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched
            library, clone:D930044H21 product:unclassifiable, full
            insert sequence
          Length = 4929

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 414  tggagagatgggtggatggatgga 437
            |||| |||||||||||||||||||
Sbjct: 3403 tggatagatgggtggatggatgga 3426

to top

>gb|AC093479.13| Mus musculus chromosome 16, clone RP23-61K2, complete sequence
          Length = 243771

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 419    agatgggtggatggatggag 438
              ||||||||||||||||||||
Sbjct: 157382 agatgggtggatggatggag 157363

to top

>gb|AC087633.5| Homo sapiens chromosome 15, clone RP11-255M2, complete sequence
          Length = 179163

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 312    tccaccacacaaacatacac 331
              ||||||||||||||||||||
Sbjct: 166295 tccaccacacaaacatacac 166314

to top

>gb|AC009335.10| Homo sapiens chromosome 17, clone RP11-20O2, complete sequence
          Length = 159611

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 117526 tggacagatgggtggatggatgga 117503

to top

>gb|AC087761.6| Homo sapiens chromosome 15, clone RP11-2E17, complete sequence
          Length = 153740

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 234   tagtgctcattcaccagatccaat 257
             |||| |||||||||||||||||||
Sbjct: 80018 tagtcctcattcaccagatccaat 80041

to top

>gb|AC012337.8| Homo sapiens chromosome , clone RP11-119O22, complete sequence
          Length = 171695

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 234    tagtgctcattcaccagatccaat 257
              |||| |||||||||||||||||||
Sbjct: 123336 tagtcctcattcaccagatccaat 123359

to top

>gb|AC090625.5| Homo sapiens chromosome 11, clone RP4-683L5, complete sequence
          Length = 142522

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              ||||||||||| ||||||||||||
Sbjct: 136272 tggagagatggatggatggatgga 136295

to top

>gb|AC040165.6| Homo sapiens chromosome 16 clone RP11-420O6, complete sequence
          Length = 209756

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              ||||||||||| ||||||||||||
Sbjct: 203626 tggagagatggatggatggatgga 203603



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              ||||||||||| ||||||||||||
Sbjct: 203602 tggagagatggatggatggatgga 203579



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              ||||||||||| ||||||||||||
Sbjct: 203526 tggagagatggatggatggatgga 203503

to top

>dbj|AK163572.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN full-length
            enriched library, clone:B230383G03
            product:unclassifiable, full insert sequence
          Length = 2660

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 187  agctgaaaaagaaagaaaag 206
            ||||||||||||||||||||
Sbjct: 1020 agctgaaaaagaaagaaaag 1001

to top

>gb|AC011260.8| Homo sapiens, clone RP11-1E21, complete sequence
          Length = 168476

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 119399 tggatagatgggtggatggatgga 119422

to top

>gb|AC022915.14| Homo sapiens chromosome 8, clone RP11-770E5, complete sequence
          Length = 188408

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 130164 tggatagatgggtggatggatgga 130141

to top

>gb|AC093153.2| Homo sapiens chromosome 1 clone RP11-477C23, complete sequence
          Length = 194427

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||| ||||||||||||
Sbjct: 61780 tggagagatggatggatggatgga 61757



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||| ||||||||||||
Sbjct: 61756 tggagagatggatggatggatgga 61733



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||| ||||||||||||
Sbjct: 61680 tggagagatggatggatggatgga 61657

to top

>gb|AC017091.8| Homo sapiens BAC clone RP11-506N2 from 4, complete sequence
          Length = 201536

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 314    caccacacaaacatacacac 333
              ||||||||||||||||||||
Sbjct: 101347 caccacacaaacatacacac 101328

to top

>gb|AC092040.2| Homo sapiens chromosome 3 clone RP11-129B22, complete sequence
          Length = 171177

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 14706 tggatagatgggtggatggatgga 14729



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 14232 tggatagatgggtggatggatgga 14255



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 14084 tggatagatgggtggatggatgga 14107

to top

>gb|AC157916.2| Mus musculus chromosome 19, clone RP24-330P23, complete sequence
          Length = 190666

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 420   gatgggtggatggatggaga 439
             ||||||||||||||||||||
Sbjct: 44403 gatgggtggatggatggaga 44422

to top

>emb|BX663513.13| Zebrafish DNA sequence from clone DKEY-234F12 in linkage group 15,
             complete sequence
          Length = 249413

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||| ||||||||||||
Sbjct: 28902 tggagagatggatggatggatgga 28925

to top

>emb|BX890629.6| Zebrafish DNA sequence from clone CH211-42G2, complete sequence
          Length = 169168

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 414  tggagagatgggtggatggatgga 437
            |||| |||||||||||||||||||
Sbjct: 7066 tggatagatgggtggatggatgga 7089

to top

>gb|AC134682.8| Homo sapiens chromosome 8, clone RP13-467H17, complete sequence
          Length = 54500

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 34607 tggatagatgggtggatggatgga 34584



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 34511 tggatagatgggtggatggatgga 34488



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 34424 tggatagatgggtggatggatgga 34401

to top

>gb|AC130669.17| Mus musculus chromosome 15, clone RP24-84O5, complete sequence
          Length = 205231

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 314    caccacacaaacatacacac 333
              ||||||||||||||||||||
Sbjct: 133216 caccacacaaacatacacac 133235

to top

>gb|AC132217.15| Homo sapiens chromosome 11, clone RP11-889I17, complete sequence
          Length = 170027

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 413    gtggagagatgggtggatggatgg 436
              |||||| |||||||||||||||||
Sbjct: 120650 gtggagggatgggtggatggatgg 120627



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 413    gtggagagatgggtggatggatgg 436
              |||||| |||||||||||||||||
Sbjct: 120590 gtggagggatgggtggatggatgg 120567



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 413    gtggagagatgggtggatggatgg 436
              |||||| |||||||||||||||||
Sbjct: 120566 gtggagggatgggtggatggatgg 120543



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 413    gtggagagatgggtggatggatgg 436
              |||||| |||||||||||||||||
Sbjct: 120399 gtggagggatgggtggatggatgg 120376

to top

>gb|AC148338.2| Homo sapiens FOSMID clone XXFOS-801736F1 from chromosome ul, complete
             sequence
          Length = 45208

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 413   gtggagagatgggtggatggatgg 436
             ||||| ||||||||||||||||||
Sbjct: 42182 gtggatagatgggtggatggatgg 42159



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 413   gtggagagatgggtggatggatgg 436
             ||||| ||||||||||||||||||
Sbjct: 41958 gtggatagatgggtggatggatgg 41935



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 413   gtggagagatgggtggatggatgg 436
             ||||| ||||||||||||||||||
Sbjct: 41820 gtggatagatgggtggatggatgg 41797

to top

>gb|AC073057.6| Homo sapiens BAC clone RP11-114G11 from 7, complete sequence
          Length = 178105

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 416   gagagatgggtggatggatg 435
             ||||||||||||||||||||
Sbjct: 35700 gagagatgggtggatggatg 35681

to top

>gb|AC136742.15| Mus musculus chromosome 5, clone RP23-145H8, complete sequence
          Length = 197131

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 314    caccacacaaacatacacac 333
              ||||||||||||||||||||
Sbjct: 152237 caccacacaaacatacacac 152218

to top

>gb|AC159643.2| Mus musculus BAC clone RP23-384H10 from chromosome 12, complete sequence
          Length = 200939

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 192    aaaaagaaagaaaagagcat 211
              ||||||||||||||||||||
Sbjct: 170948 aaaaagaaagaaaagagcat 170967

to top

>gb|AC155815.2| Mus musculus BAC clone RP24-135C18 from chromosome 12, complete
             sequence
          Length = 181303

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 67658 tggatagatgggtggatggatgga 67681

to top

>gb|AC140776.6| Mus musculus chromosome 1, clone RP23-284K5, complete sequence
          Length = 223196

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 15199 tggatagatgggtggatggatgga 15176

to top

>gb|AY958432.1| Homo sapiens methionine sulfoxide reductase gene, complete cds,
              alternatively spliced
          Length = 379048

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 419    agatgggtggatggatggag 438
              ||||||||||||||||||||
Sbjct: 328923 agatgggtggatggatggag 328942

to top

>dbj|AK076864.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4930518C17 product:unclassifiable, full
           insert sequence
          Length = 1052

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 414 tggagagatgggtggatggatgga 437
           |||| |||||||||||||||||||
Sbjct: 673 tggatagatgggtggatggatgga 650

to top

>ref|NM_064768.1| Caenorhabditis elegans F40G9.14 (F40G9.14) mRNA, complete cds
          Length = 786

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 191 gaaaaagaaagaaaagagca 210
           ||||||||||||||||||||
Sbjct: 349 gaaaaagaaagaaaagagca 368

to top

>dbj|AK028637.1| Mus musculus 10 days neonate skin cDNA, RIKEN full-length enriched
            library, clone:4732421B10 product:unclassifiable, full
            insert sequence
          Length = 2784

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 187  agctgaaaaagaaagaaaag 206
            ||||||||||||||||||||
Sbjct: 1143 agctgaaaaagaaagaaaag 1124

to top

>dbj|AK082946.1| Mus musculus 12 days embryo spinal cord cDNA, RIKEN full-length
           enriched library, clone:C530018C22
           product:unclassifiable, full insert sequence
          Length = 3102

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 191 gaaaaagaaagaaaagagcatgtg 214
           ||||||||| ||||||||||||||
Sbjct: 310 gaaaaagaatgaaaagagcatgtg 333

to top

>emb|AL929493.20| Zebrafish DNA sequence from clone CH211-157D2, complete sequence
          Length = 180578

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||| ||||||||||||
Sbjct: 50927 tggagagatggatggatggatgga 50950

to top

>gb|AC021843.6|AC021843 Homo sapiens chromosome 18, clone RP11-713C1, complete sequence
          Length = 159480

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 414  tggagagatgggtggatggatgga 437
            |||| |||||||||||||||||||
Sbjct: 5447 tggatagatgggtggatggatgga 5470

to top

>gb|AC135782.4| Homo sapiens chromosome 16 clone CTD-2555A7, complete sequence
          Length = 163550

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 420   gatgggtggatggatggaga 439
             ||||||||||||||||||||
Sbjct: 13682 gatgggtggatggatggaga 13701

to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 420      gatgggtggatggatggagaaggg 443
                ||||| ||||||||||||||||||
Sbjct: 25882108 gatggatggatggatggagaaggg 25882131

to top

>gb|AC090956.1|AC090956 Homo sapiens chromosome 3 clone RP11-659G4 map 3p, complete sequence
          Length = 202844

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 154308 tggacagatgggtggatggatgga 154331



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 154242 tggatagatgggtggatggatgga 154265

to top

>gb|AC131212.6| Homo sapiens 12 BAC RP13-554M15 (Rowsell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 160039

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 414  tggagagatgggtggatggatgga 437
            |||| |||||||||||||||||||
Sbjct: 2242 tggacagatgggtggatggatgga 2219

to top

>gb|AC026797.3|AC026797 Homo sapiens chromosome 5 clone CTD-2299N12, complete sequence
          Length = 172043

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             ||||||||||| ||||||||||||
Sbjct: 25345 tggagagatggatggatggatgga 25322

to top

>gb|AC097476.2| Homo sapiens BAC clone RP11-109N11 from 4, complete sequence
          Length = 159852

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 317   cacacaaacatacacacggacacc 340
             ||||||||||||||||| ||||||
Sbjct: 33536 cacacaaacatacacactgacacc 33513

to top

>gb|AC092384.5| Homo sapiens chromosome 16 clone RP11-830F9, complete sequence
          Length = 219070

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 420    gatgggtggatggatggaga 439
              ||||||||||||||||||||
Sbjct: 213034 gatgggtggatggatggaga 213053

to top

>gb|AC008732.9| Homo sapiens chromosome 16 clone CTD-2519M14, complete sequence
          Length = 185158

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 192   aaaaagaaagaaaagagcat 211
             ||||||||||||||||||||
Sbjct: 27235 aaaaagaaagaaaagagcat 27254

to top

>gb|AC079080.5| Homo sapiens BAC clone RP11-162O12 from 4, complete sequence
          Length = 161647

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              ||||||||||| ||||||||||||
Sbjct: 115084 tggagagatggatggatggatgga 115061

to top

>gb|AC017099.11| Homo sapiens BAC clone RP11-542D13 from 2, complete sequence
          Length = 230426

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 131267 tggatagatgggtggatggatgga 131244



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 131243 tggatagatgggtggatggatgga 131220



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 131223 tggatagatgggtggatggatgga 131200



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 131199 tggatagatgggtggatggatgga 131176

to top

>gb|AC026218.5|AC026218 Homo sapiens chromosome 3 clone RP11-813N23 map 3p, complete sequence
          Length = 198597

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 167349 tggacagatgggtggatggatgga 167372



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 414    tggagagatgggtggatggatgga 437
              |||| |||||||||||||||||||
Sbjct: 167283 tggatagatgggtggatggatgga 167306

to top

>gb|AC018505.4|AC018505 Homo sapiens chromosome 3 clone RP11-58I13 map 3p, complete sequence
          Length = 196044

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 52743 tggacagatgggtggatggatgga 52766



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 414   tggagagatgggtggatggatgga 437
             |||| |||||||||||||||||||
Sbjct: 52677 tggatagatgggtggatggatgga 52700


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,252,550
Number of Sequences: 3902068
Number of extensions: 6252550
Number of successful extensions: 417384
Number of sequences better than 10.0: 358
Number of HSP's better than 10.0 without gapping: 359
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 408019
Number of HSP's gapped (non-prelim): 9364
length of query: 443
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 421
effective length of database: 17,147,199,772
effective search space: 7218971104012
effective search space used: 7218971104012
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result