ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart09g12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrins... 593 e-166
2gb|BT016583.1| Zea mays clone Contig416 mRNA sequence 272 9e-70
3gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds 264 2e-67
4gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein... 256 5e-65
5gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein... 240 3e-60
6gb|AY109332.1| Zea mays CL502_5 mRNA sequence 240 3e-60
7gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, comp... 216 4e-53
8ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA 208 1e-50
9ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group... 208 1e-50
10ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group... 208 1e-50
11dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clon... 208 1e-50
12dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clon... 208 1e-50
13dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 208 1e-50
14dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 208 1e-50
15dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clon... 200 3e-48
16dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA ... 198 1e-47
17gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein... 184 2e-43
18gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein... 176 4e-41
19ref|XM_466869.1| Oryza sativa (japonica cultivar-group), mRNA 170 2e-39
20dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clon... 170 2e-39
21gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence 153 5e-34
22dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 149 9e-33
23dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D... 149 9e-33
24gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrins... 149 9e-33
25ref|NM_187081.2| Oryza sativa (japonica cultivar-group), mRNA 147 3e-32
26dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clon... 147 3e-32
27gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds 139 8e-30
28gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protei... 139 8e-30
29dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin ... 133 5e-28
30ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predic... 129 8e-27
31gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence 123 5e-25
32gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-... 123 5e-25
33emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein 123 5e-25
34dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin,... 123 5e-25
35dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd 123 5e-25
36ref|NM_187084.1| Oryza sativa (japonica cultivar-group), mRNA 115 1e-22
37ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group... 115 1e-22
38ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predic... 115 1e-22
39gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putat... 115 1e-22
40dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
41dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
42dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
43dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
44dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
45dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds 115 1e-22
46dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 111 2e-21
47dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic D... 111 2e-21
48emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet... 109 7e-21
49dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-21
50dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-21
51dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-21
52gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, ... 109 7e-21
53dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ... 109 7e-21
54ref|XM_475029.1| Oryza sativa (japonica cultivar-group), predic... 100 7e-18
55emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein 100 7e-18
56gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein... 100 7e-18
57gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein... 100 7e-18
58dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 7e-18
59dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 7e-18
60dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 7e-18
61dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 7e-18
62gb|AY103580.1| Zea mays PCO072544 mRNA sequence 100 7e-18
63gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putat... 98 3e-17
64dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic D... 98 3e-17
65gb|AY107589.1| Zea mays PCO085320 mRNA sequence 98 3e-17
66ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative... 94 4e-16
67gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds 94 4e-16
68dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 4e-16
69gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds 92 2e-15
70emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for p... 92 2e-15
71gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein... 92 2e-15
72emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4,... 90 7e-15
73gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putat... 90 7e-15
74gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds 90 7e-15
75gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, c... 90 7e-15
76gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrin... 90 7e-15
77dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 90 7e-15
78gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1)... 90 7e-15
79dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic D... 90 7e-15
80dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic D... 90 7e-15
81gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasm... 90 7e-15
82gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein... 86 1e-13
83dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 86 1e-13
84emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4,... 86 1e-13
85emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4,... 84 4e-13
86emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Co... 84 4e-13
87gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, comple... 84 4e-13
88gb|AY170841.1| Axonopus compressus plasma membrane MIP protein m... 84 4e-13
89emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for p... 82 2e-12
90gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water chann... 82 2e-12
91gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, co... 82 2e-12
92dbj|AB002149.1| Nicotiana excelsior mRNA for water channel prote... 82 2e-12
93ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channe... 80 7e-12
94gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 80 7e-12
95gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 80 7e-12
96gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds 80 7e-12
97gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 80 7e-12
98emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Co... 80 7e-12
99gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds 80 7e-12
100gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com... 78 3e-11
101dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membran... 78 3e-11
102gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence 76 1e-10
103emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for p... 76 1e-10
104gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma... 76 1e-10
105gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRN... 76 1e-10
106gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic pr... 74 4e-10
107gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 geno... 74 4e-10
108dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 74 4e-10
109gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 74 4e-10
110gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic pr... 74 4e-10
111gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel... 74 4e-10
112gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA 74 4e-10
113ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channe... 72 2e-09
114gb|AY081593.1| Arabidopsis thaliana water channel-like protein (... 72 2e-09
115gb|AY059948.1| Arabidopsis thaliana water channel - like protein... 72 2e-09
116emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
117emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
118emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
119emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
120gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete se... 72 2e-09
121gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (... 70 6e-09
122gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putat... 68 3e-08
123dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - li... 68 3e-08
124gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, c... 68 3e-08
125gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein ... 68 3e-08
126ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G3... 66 1e-07
127gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (... 66 1e-07
128emb|AJ249384.1|SOL249384 Spinacia oleracea mRNA for PM28B protei... 66 1e-07
129gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic pro... 66 1e-07
130emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for p... 66 1e-07
131emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for p... 66 1e-07
132emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides m... 66 1e-07
133emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Co... 66 1e-07
134emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Co... 66 1e-07
135emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Co... 66 1e-07
136emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Co... 66 1e-07
137emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Co... 66 1e-07
138emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Co... 66 1e-07
139emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Co... 66 1e-07
140gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete s... 66 1e-07
141dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membra... 66 1e-07
142gb|U62280.1|NTU62280 Nicotiana tabacum aquaporin (NT2) mRNA, com... 66 1e-07
143dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membran... 66 1e-07
144emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein 64 4e-07
145emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for p... 64 4e-07
146gb|AF290620.1|AF290620 Nicotiana glauca putative PIP2 (MIP4) mRN... 64 4e-07
147gb|AY671950.1| Aegiceras corniculatum aquaporin 2 (PIP2) mRNA, c... 64 4e-07
148gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, co... 64 4e-07
149ref|XM_468463.1| Oryza sativa (japonica cultivar-group), mRNA 62 2e-06
150emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for p... 62 2e-06
151emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intri... 62 2e-06
152dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
153gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein... 62 2e-06
154dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
155dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
156dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
157dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
158dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
159dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
160dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
161gb|AY107675.1| Zea mays PCO112712 mRNA sequence 62 2e-06
162dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
163dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3... 62 2e-06
164dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds 62 2e-06
165dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membran... 62 2e-06
166gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic pr... 60 6e-06
167gb|DQ228343.1| Solanum tuberosum clone 148A12 unknown mRNA 60 6e-06
168gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence 60 6e-06
169emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrins... 60 6e-06
170emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening memb... 60 6e-06
171emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening memb... 60 6e-06
172emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major ... 60 6e-06
173gb|AC006260.4| Arabidopsis thaliana chromosome 2 clone T2N18 map... 60 6e-06
174dbj|AB206101.1| Mimosa pudica pip2;3 mRNA for plasma membrane in... 60 6e-06
175gb|U73467.1|MCU73467 Mesembryanthemum crystallinum water channel... 60 6e-06
176gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel prot... 60 6e-06
177gb|U26538.1|MCU26538 Mesembryanthemum crystallinum major intrins... 60 6e-06
178ref|NM_129274.2| Arabidopsis thaliana RD28; water channel AT2G37... 58 2e-05
179gb|AY096701.1| Arabidopsis thaliana putative aquaporin protein (... 58 2e-05
180gb|AY064029.1| Arabidopsis thaliana putative aquaporin, plasma m... 58 2e-05
181emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp... 58 2e-05
182dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds 58 2e-05
183gb|AY084875.1| Arabidopsis thaliana clone 11998 mRNA, complete s... 58 2e-05
184gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, c... 58 2e-05
185dbj|D13254.1|ATHRD28 Arabidopsis thaliana mRNA for putative tran... 58 2e-05
186dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membra... 58 2e-05
187gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, co... 58 2e-05
188gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mip... 58 2e-05
189dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane ... 58 2e-05
190gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker 56 1e-04
191gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker 56 1e-04
192gb|AF452014.1|AF452014 Petunia x hybrida aquaporin-like protein ... 56 1e-04
193ref|XM_470514.1| Oryza sativa (japonica cultivar-group), mRNA 54 4e-04
194gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 54 4e-04
195gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genom... 54 4e-04
196dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 54 4e-04
197gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, ... 54 4e-04
198dbj|AK109024.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 4e-04
199ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channe... 52 0.001
200gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds 52 0.001
201gb|AF367460.1| Prunus persica clone Mip3 membrane intrinsic prot... 52 0.001
202gb|U56603.1|BMU56603 Bufo marinus vasopressin-insensitive water ... 52 0.001
203dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane in... 52 0.001
204gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete s... 52 0.001
205gb|AF020620.1| Bufo marinus aquaporin-1 homolog (AQP-t1) mRNA, c... 52 0.001
206ref|NM_115339.2| Arabidopsis thaliana PIP2;5/PIP2D; water channe... 50 0.006
207emb|AJ001416.1|NTAQUAPOR Nicotiana tabacum mRNA for aquaporin 1 50 0.006
208gb|BT000670.1| Arabidopsis thaliana clone RAFL07-09-N03 (R10758)... 50 0.006
209emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrins... 50 0.006
210gb|AY062981.1| Arabidopsis thaliana putative aquaporin/MIP prote... 50 0.006
211gb|AF370351.1| Arabidopsis thaliana putative aquaporin/MIP prote... 50 0.006
212emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative pl... 50 0.006
213emb|AJ289695.1|POC289695 Posidonia oceanica partial aq2 gene for... 50 0.006
214emb|AJ222973.1|LAAJ2973 Lupinus albus mRNA for aquaporin, partial 50 0.006
215gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, ... 50 0.006
216emb|BX822631.1|CNS0A61A Arabidopsis thaliana Full-length cDNA Co... 50 0.006
217gb|AY084843.1| Arabidopsis thaliana clone 11929 mRNA, complete s... 50 0.006
218emb|AJ605574.1| Ricinus communis mRNA for aquaporin (Pip1-1 gene... 50 0.006
219gb|AF024511.1|AF024511 Nicotiana tabacum aquaporin 1 mRNA, compl... 50 0.006
220dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane ... 50 0.006
221ref|NM_116008.2| Arabidopsis thaliana PIP1A; water channel AT3G6... 48 0.023
222ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G0... 48 0.023
223gb|BT013307.1| Lycopersicon esculentum clone 134975R, mRNA sequence 48 0.023
224emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel... 48 0.023
225emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B 48 0.023
226emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, ... 48 0.023
227emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, B... 48 0.023
228emb|AJ289701.1|VFA289701 Vicia faba mRNA for aquaporin (aq1 gene) 48 0.023
229gb|AY097398.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, com... 48 0.023
230gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic pr... 48 0.023
231gb|AY058113.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, com... 48 0.023
232gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative pl... 48 0.023
233emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Co... 48 0.023
234emb|BX824874.1|CNS0A5T5 Arabidopsis thaliana Full-length cDNA Co... 48 0.023
235emb|BX823595.1|CNS0A5AA Arabidopsis thaliana Full-length cDNA Co... 48 0.023
236dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane in... 48 0.023
237gb|AY088439.1| Arabidopsis thaliana clone 6690 mRNA, complete se... 48 0.023
238gb|AF266760.1|AF266760 Vicia faba plasma membrane aquaporin mRNA... 48 0.023
239gb|AF255795.1|AF255795 Allium cepa aquaporin 1 (Aqp1) mRNA, comp... 48 0.023
240emb|AJ605565.1| Ricinus communis partial mRNA for putative aquap... 48 0.023
241gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic pr... 48 0.023
242ref|NM_119676.2| Arabidopsis thaliana PIP3 (PLASMA MEMBRANE INTR... 46 0.092
243gb|DQ226873.1| Boechera divaricarpa isolate SLW-C-G04 mRNA sequence 46 0.092
244gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, ... 46 0.092
245emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic... 46 0.092
246emb|AL132962.1|ATF2A19 Arabidopsis thaliana DNA chromosome 3, BA... 46 0.092
247gb|AF367458.1| Prunus persica clone Mip2 membrane intrinsic prot... 46 0.092
248gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map ... 46 0.092
249gb|AY081580.1| Arabidopsis thaliana plasma membrane intrinsic pr... 46 0.092
250gb|AY062803.1| Arabidopsis thaliana plasma membrane intrinsic pr... 46 0.092
251gb|AF412110.1|AF412110 Arabidopsis thaliana AT4g35100/M4E13_150 ... 46 0.092
252gb|AF003728.1|AF003728 Arabidopsis thaliana plasma membrane intr... 46 0.092
253emb|BX826680.1|CNS0A37C Arabidopsis thaliana Full-length cDNA Co... 46 0.092
254emb|BX826294.1|CNS0A39S Arabidopsis thaliana Full-length cDNA Co... 46 0.092
255emb|BX827919.1|CNS0A2ZT Arabidopsis thaliana Full-length cDNA Co... 46 0.092
256emb|BX827124.1|CNS0A2UI Arabidopsis thaliana Full-length cDNA Co... 46 0.092
257gb|AY995195.1| Phaseolus vulgaris putative aquaporin (PIP2;1) mR... 46 0.092
258dbj|AB206100.1| Mimosa pudica pip2;2 mRNA for plasma membrane in... 46 0.092
259dbj|AB206099.1| Mimosa pudica pip2;1 mRNA for plasma membrane in... 46 0.092
260gb|AY088485.1| Arabidopsis thaliana clone 7108 mRNA, complete se... 46 0.092
261emb|AJ605568.1| Ricinus communis partial mRNA for putative aquap... 46 0.092
262dbj|D85193.1| Arabidopsis thaliana mRNA, partial cds 46 0.092
263dbj|AB091106.2| Lilium longiflorum PIP1 mRNA for plasma membrane... 46 0.092
264gb|AF051202.1|AF051202 Picea mariana probable aquaporin (Sb01) m... 46 0.092
265gb|U78297.1|ATU78297 Arabidopsis thaliana plasma membrane intrin... 46 0.092
266gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, com... 46 0.092
267ref|NM_202760.1| Arabidopsis thaliana TMP-C AT4G00430 (TMP-C) tr... 44 0.36
268ref|NM_116268.2| Arabidopsis thaliana TMP-C; water channel AT4G0... 44 0.36
269gb|AY961922.1| Picea abies probable aquaporin (Aqp) mRNA, partia... 44 0.36
270gb|AY189973.1| Juglans regia plasma intrinsic protein 2,1 mRNA, ... 44 0.36
271gb|AY333929.1| Pringlea antiscorbutica putative transmembrane pr... 44 0.36
272emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic... 44 0.36
273gb|BT000330.1| Arabidopsis thaliana probable plasma membrane int... 44 0.36
274emb|AJ005869.1|CAR005869 Cicer arietinum mRNA for putative trans... 44 0.36
275gb|AY120785.1| Arabidopsis thaliana probable plasma membrane int... 44 0.36
276gb|AY099825.1| Arabidopsis thaliana probable plasma membrane int... 44 0.36
277gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putat... 44 0.36
278gb|U22658.1|BMU22658 Bufo marinus urinary bladder aquaporin mRNA... 44 0.36
279gb|AF386739.1|AF386739 Medicago truncatula aquaporin protein PIP... 44 0.36
280gb|BT006313.1| Arabidopsis thaliana At4g00430 mRNA, complete cds 44 0.36
281emb|BX827573.1|CNS0A3MW Arabidopsis thaliana Full-length cDNA Co... 44 0.36
282emb|BX829233.1|CNS0A3FQ Arabidopsis thaliana Full-length cDNA Co... 44 0.36
283gb|AF188844.1|AF188844 Vitis vinifera cultivar Pinot Noir plasma... 44 0.36
284emb|AJ605575.1| Ricinus communis mRNA for aquaporin (Pip2-1 gene... 44 0.36
285dbj|D85192.1| Arabidopsis thaliana mRNA for transmembrane protei... 44 0.36
286dbj|AB005246.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 44 0.36
287emb|AJ699398.2| Chenopodium rubrum mRNA for aquaporin PIP1 (PIP1... 44 0.36
288dbj|D26609.1|ATHTMP Arabidopsis thaliana mRNA for transmembrane ... 44 0.36
289gb|L36095.1|CIPMIPA Mesembryanthemum crystallinum mipA mRNA, com... 44 0.36
290dbj|AB002148.1| Nicotiana excelsior mRNA for water channel prote... 44 0.36
291ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G4... 42 1.4
292gb|AY781788.1| Glycyrrhiza uralensis plasma membrane intrinsic p... 42 1.4
293gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 42 1.4
294gb|AY663794.1| Fraxinus excelsior plasma membrane intrinsic prot... 42 1.4
295gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 42 1.4
296gb|DQ018114.1| Physcomitrella patens plasma membrane aquaporin (... 42 1.4
297gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 42 1.4
298emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein 42 1.4
299emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel... 42 1.4
300gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (... 42 1.4
301emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A 42 1.4
302gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma m... 42 1.4
303ref|NM_001005829.1| Xenopus tropicalis aquaporin 1 (channel-form... 42 1.4
304emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 42 1.4
305emb|AJ849324.1| Populus tremula x Populus tremuloides mRNA for p... 42 1.4
306gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205),... 42 1.4
307gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, ... 42 1.4
308emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Co... 42 1.4
309emb|BX819664.1|CNS0A8JV Arabidopsis thaliana Full-length cDNA Co... 42 1.4
310emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Co... 42 1.4
311emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Co... 42 1.4
312dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 42 1.4
313gb|AF154641.1| Nicotiana tabacum clone PR16 mRNA sequence 42 1.4
314gb|AY084470.1| Arabidopsis thaliana clone 108944 mRNA, complete ... 42 1.4
315gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, comp... 42 1.4
316emb|AJ605569.1| Ricinus communis partial mRNA for putative aquap... 42 1.4
317gb|BC075384.1| Xenopus tropicalis aquaporin 1 (channel-forming i... 42 1.4
318gb|BC084131.1| Xenopus laevis hypothetical LOC495037, mRNA (cDNA... 42 1.4
319gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 42 1.4
320gb|U26537.1|MCU26537 Mesembryanthemum crystallinum major intrins... 42 1.4
321dbj|AP004484.1| Lotus japonicus genomic DNA, chromosome 1, clone... 42 1.4
322gb|U27347.1|GMU27347 Glycine max putative water channel protein ... 42 1.4
323gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 40 5.7
324gb|AY494191.1| Physcomitrella patens plasma membrane aquaporin (... 40 5.7
325gb|AE014075.1| Escherichia coli CFT073, complete genome 40 5.7
326gb|CP000272.1| Burkholderia xenovorans LB400 chromosome 3, compl... 40 5.7
327emb|X75881.1|ATPIP1A A.thaliana mRNA for plasma membrane intrins... 40 5.7
328emb|AL138650.1|ATT5N23 Arabidopsis thaliana DNA chromosome 3, BA... 40 5.7
329emb|AL049655.2|ATF28P10 Arabidopsis thaliana DNA chromosome 3, B... 40 5.7
330emb|AL596209.13| Mouse DNA sequence from clone RP23-278F12 on ch... 40 5.7
331gb|AC083943.8| Genomic sequence for Oryza sativa, Nipponbare str... 40 5.7
332gb|AC027088.8| Homo sapiens chromosome 15, clone RP11-809H16, co... 40 5.7
333gb|AF452013.1|AF452013 Petunia x hybrida aquaporin-like protein ... 40 5.7
334gb|AY059380.1| Medicago truncatula aquaporin (PIP2-1) mRNA, comp... 40 5.7
335emb|BX824209.1|CNS0A5OV Arabidopsis thaliana Full-length cDNA Co... 40 5.7
336gb|AF487998.1| Saccharopolyspora erythraea NRRL 2338 eryCI flank... 40 5.7
337gb|AF255796.1|AF255796 Allium cepa aquaporin 2 (Aqp2) mRNA, comp... 40 5.7
338dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 5.7
339emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 40 5.7
340emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 40 5.7
341gb|U97023.1|PVU97023 Phaseolus vulgaris putative aquaporin-1 (Mi... 40 5.7
342dbj|AB012044.1| Raphanus sativus mRNA for plasma membrane aquapo... 40 5.7

>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA,
            complete cds
          Length = 1283

 Score =  593 bits (299), Expect = e-166
 Identities = 403/431 (93%), Gaps = 10/431 (2%)
 Strand = Plus / Minus

                                                                        
Query: 1    aagacaagcgatcccatggaccgaattacaacacacggcacgcatgactgggc-acatac 59
            ||||||||||||||||||||||||||||||| |||||||||||||||| || | || |||
Sbjct: 1166 aagacaagcgatcccatggaccgaattacaagacacggcacgcatgaccggaccacgtac 1107

                                                                        
Query: 60   ---gcatatgcagctgccgacacataaataacacgaccattgcagcggcc-aactgaact 115
               |||||||||||||||||||||||| ||||||||||||||| |||||| |||||||||
Sbjct: 1106 tacgcatatgcagctgccgacacataa-taacacgaccattgcggcggccgaactgaact 1048

                                                                        
Query: 116  gtcgagaagttgcaaaagcggctttctctttggatggatggacacagcacaggtcgccat 175
            ||||||||||||||||||||  ||||||| |||||||||||||||| ||| |||||||||
Sbjct: 1047 gtcgagaagttgcaaaagcgcatttctctctggatggatggacacaacacgggtcgccat 988

                                                                        
Query: 176  tgcttcaatcttgcatgcacatcacatggat---aactcgttacgcgttgctcctgaagg 232
            ||||||| |||||||| || || ||||||||   |||| |||||||||||||||||||||
Sbjct: 987  tgcttcagtcttgcatacagatgacatggatgataacttgttacgcgttgctcctgaagg 928

                                                                        
Query: 233  agccgagggccttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcg 292
            ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 927  agccgagggccttgatggcgccggccctgaggatgtactggtggtagaaggccgcgatcg 868

                                                                        
Query: 293  ccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgt 352
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 867  ccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgt 808

                                                                        
Query: 353  tgtagatgacggcgg-ccccaggctcctggccgggttgatgccggtgccggtgatcggga 411
            ||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| ||||
Sbjct: 807  tgtagatgacggcggcccccaggctccgggccgggttgatgccggtgccggtgatgggga 748

                       
Query: 412  tggtggccagg 422
            |||||||||||
Sbjct: 747  tggtggccagg 737



to top

>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence
          Length = 1348

 Score =  272 bits (137), Expect = 9e-70
 Identities = 192/209 (91%), Gaps = 1/209 (0%)
 Strand = Plus / Minus

                                                                       
Query: 215 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 274
           |||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||
Sbjct: 924 acgcgttgctcctgaaggagccgagggccttgatggcgccagcccggaggatgtactggt 865

                                                                       
Query: 275 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 334
           |||||||||||||||| || ||||| |  | |||||| |||||||||||||| || || |
Sbjct: 864 ggtagaaggccgcgatggcagcgcccacgagggggcccacccagaagatccagtggtcgt 805

                                                                       
Query: 335 cccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttgatgc 393
           |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 804 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 745

                                        
Query: 394 cggtgccggtgatcgggatggtggccagg 422
           ||||||||||||  |||||||||||||||
Sbjct: 744 cggtgccggtgacggggatggtggccagg 716



to top

>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds
          Length = 1133

 Score =  264 bits (133), Expect = 2e-67
 Identities = 191/209 (91%), Gaps = 1/209 (0%)
 Strand = Plus / Minus

                                                                       
Query: 215 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 274
           |||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||
Sbjct: 872 acgcgttgctcctgaaggagccgagggccttgatggcgccagcccggaggatgtactggt 813

                                                                       
Query: 275 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 334
           |||||||||||||||| || ||||| |  |  ||||| |||||||||||||| || || |
Sbjct: 812 ggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatccagtggtcgt 753

                                                                       
Query: 335 cccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttgatgc 393
           |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 752 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 693

                                        
Query: 394 cggtgccggtgatcgggatggtggccagg 422
           ||||||||||||  |||||||||||||||
Sbjct: 692 cggtgccggtgacggggatggtggccagg 664



to top

>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete
           cds
          Length = 1171

 Score =  256 bits (129), Expect = 5e-65
 Identities = 190/209 (90%), Gaps = 1/209 (0%)
 Strand = Plus / Minus

                                                                       
Query: 215 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 274
           ||||||||||||||||||||||||||||||||||||| || |||| ||| ||||||||||
Sbjct: 943 acgcgttgctcctgaaggagccgagggccttgatggccccagcccggaggatgtactggt 884

                                                                       
Query: 275 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 334
           |||||||||||||||| || ||||| |  |  ||||| |||||||||||||| || || |
Sbjct: 883 ggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatccagtggtcgt 824

                                                                       
Query: 335 cccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttgatgc 393
           |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 823 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 764

                                        
Query: 394 cggtgccggtgatcgggatggtggccagg 422
           ||||||||||||  |||||||||||||||
Sbjct: 763 cggtgccggtgacggggatggtggccagg 735



to top

>gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein ZmPIP2-2 mRNA, complete
           cds
          Length = 1268

 Score =  240 bits (121), Expect = 3e-60
 Identities = 188/209 (89%), Gaps = 1/209 (0%)
 Strand = Plus / Minus

                                                                       
Query: 215 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 274
           ||||||||||||||||||||||||| |||||||||||||| |||| ||| ||||||||||
Sbjct: 996 acgcgttgctcctgaaggagccgagagccttgatggcgcccgcccggaggatgtactggt 937

                                                                       
Query: 275 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 334
           |||||||||||||||| || ||||| |  |  ||||| |||||||| ||||| || ||||
Sbjct: 936 ggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatccagtggtcat 877

                                                                       
Query: 335 cccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttgatgc 393
           |||| | ||||||||||||||||| ||||||||| |||||||||||||||||||||||||
Sbjct: 876 cccatggcttgtccttgttgtagacgacggcggcgcccaggctcctggccgggttgatgc 817

                                        
Query: 394 cggtgccggtgatcgggatggtggccagg 422
           ||||||||||||  |||||||||||||||
Sbjct: 816 cggtgccggtgacggggatggtggccagg 788



to top

>gb|AY109332.1| Zea mays CL502_5 mRNA sequence
          Length = 1969

 Score =  240 bits (121), Expect = 3e-60
 Identities = 188/209 (89%), Gaps = 1/209 (0%)
 Strand = Plus / Minus

                                                                        
Query: 215  acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 274
            ||||||||||||||||||||||||| |||||||||||||| |||| ||| ||||||||||
Sbjct: 1646 acgcgttgctcctgaaggagccgagagccttgatggcgcccgcccggaggatgtactggt 1587

                                                                        
Query: 275  ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 334
            |||||||||||||||| || ||||| |  |  ||||| |||||||| ||||| || ||||
Sbjct: 1586 ggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatccagtggtcat 1527

                                                                        
Query: 335  cccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttgatgc 393
            |||| | ||||||||||||||||| ||||||||| |||||||||||||||||||||||||
Sbjct: 1526 cccatggcttgtccttgttgtagacgacggcggcgcccaggctcctggccgggttgatgc 1467

                                         
Query: 394  cggtgccggtgatcgggatggtggccagg 422
            ||||||||||||  |||||||||||||||
Sbjct: 1466 cggtgccggtgacggggatggtggccagg 1438



 Score =  176 bits (89), Expect = 4e-41
 Identities = 141/157 (89%), Gaps = 1/157 (0%)
 Strand = Plus / Minus

                                                                       
Query: 267 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 326
           |||||||||||||  ||| ||||| || ||||||||||  ||||| ||||||||||||||
Sbjct: 321 gtactggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatcca 262

                                                                       
Query: 327 ctgatcatcccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgg 385
            || || ||||||||||||||||||||||||||||| ||||| |||| |||||| |||||
Sbjct: 261 ttggtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaagctcctcgccgg 202

                                                
Query: 386 gttgatgccggtgccggtgatcgggatggtggccagg 422
           ||||||||||||||||||||| |||||||||||||||
Sbjct: 201 gttgatgccggtgccggtgatggggatggtggccagg 165



to top

>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds
          Length = 1328

 Score =  216 bits (109), Expect = 4e-53
 Identities = 185/209 (88%), Gaps = 1/209 (0%)
 Strand = Plus / Minus

                                                                       
Query: 215 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 274
           ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||
Sbjct: 968 acgcgttgctcctgaaggagccgagggccttgatggcgccggcccggaggatgtactggt 909

                                                                       
Query: 275 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 334
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 908 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 849

                                                                       
Query: 335 cccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttgatgc 393
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 848 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 789

                                        
Query: 394 cggtgccggtgatcgggatggtggccagg 422
           ||||||||||||||||||| || ||||||
Sbjct: 788 cggtgccggtgatcgggatcgtcgccagg 760



to top

>ref|NM_187092.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1242

 Score =  208 bits (105), Expect = 1e-50
 Identities = 184/209 (88%), Gaps = 1/209 (0%)
 Strand = Plus / Minus

                                                                       
Query: 215 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 274
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 275 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 334
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                                                       
Query: 335 cccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttgatgc 393
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799

                                        
Query: 394 cggtgccggtgatcgggatggtggccagg 422
           ||||||||||||||||||| || ||||||
Sbjct: 798 cggtgccggtgatcgggatcgtcgccagg 770



to top

>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1257

 Score =  208 bits (105), Expect = 1e-50
 Identities = 184/209 (88%), Gaps = 1/209 (0%)
 Strand = Plus / Minus

                                                                       
Query: 215 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 274
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 980 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 921

                                                                       
Query: 275 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 334
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 920 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 861

                                                                       
Query: 335 cccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttgatgc 393
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 860 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 801

                                        
Query: 394 cggtgccggtgatcgggatggtggccagg 422
           ||||||||||||||||||| || ||||||
Sbjct: 800 cggtgccggtgatcgggatcgtcgccagg 772



to top

>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1298

 Score =  208 bits (105), Expect = 1e-50
 Identities = 184/209 (88%), Gaps = 1/209 (0%)
 Strand = Plus / Minus

                                                                       
Query: 215 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 274
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 981 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 922

                                                                       
Query: 275 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 334
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 921 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 862

                                                                       
Query: 335 cccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttgatgc 393
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 861 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 802

                                        
Query: 394 cggtgccggtgatcgggatggtggccagg 422
           ||||||||||||||||||| || ||||||
Sbjct: 801 cggtgccggtgatcgggatcgtcgccagg 773



to top

>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full
           insert sequence
          Length = 1216

 Score =  208 bits (105), Expect = 1e-50
 Identities = 184/209 (88%), Gaps = 1/209 (0%)
 Strand = Plus / Minus

                                                                       
Query: 215 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 274
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 275 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 334
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                                                       
Query: 335 cccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttgatgc 393
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799

                                        
Query: 394 cggtgccggtgatcgggatggtggccagg 422
           ||||||||||||||||||| || ||||||
Sbjct: 798 cggtgccggtgatcgggatcgtcgccagg 770



to top

>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full
           insert sequence
          Length = 1451

 Score =  208 bits (105), Expect = 1e-50
 Identities = 184/209 (88%), Gaps = 1/209 (0%)
 Strand = Plus / Minus

                                                                       
Query: 215 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 274
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 572 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 513

                                                                       
Query: 275 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 334
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 512 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 453

                                                                       
Query: 335 cccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttgatgc 393
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 452 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 393

                                        
Query: 394 cggtgccggtgatcgggatggtggccagg 422
           ||||||||||||||||||| || ||||||
Sbjct: 392 cggtgccggtgatcgggatcgtcgccagg 364



to top

>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full
           insert sequence
          Length = 1242

 Score =  208 bits (105), Expect = 1e-50
 Identities = 184/209 (88%), Gaps = 1/209 (0%)
 Strand = Plus / Minus

                                                                       
Query: 215 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 274
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 275 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 334
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                                                       
Query: 335 cccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttgatgc 393
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799

                                        
Query: 394 cggtgccggtgatcgggatggtggccagg 422
           ||||||||||||||||||| || ||||||
Sbjct: 798 cggtgccggtgatcgggatcgtcgccagg 770



to top

>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full
           insert sequence
          Length = 1298

 Score =  208 bits (105), Expect = 1e-50
 Identities = 184/209 (88%), Gaps = 1/209 (0%)
 Strand = Plus / Minus

                                                                       
Query: 215 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 274
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 981 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 922

                                                                       
Query: 275 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 334
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 921 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 862

                                                                       
Query: 335 cccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttgatgc 393
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 861 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 802

                                        
Query: 394 cggtgccggtgatcgggatggtggccagg 422
           ||||||||||||||||||| || ||||||
Sbjct: 801 cggtgccggtgatcgggatcgtcgccagg 773



to top

>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full
           insert sequence
          Length = 1257

 Score =  200 bits (101), Expect = 3e-48
 Identities = 183/209 (87%), Gaps = 1/209 (0%)
 Strand = Plus / Minus

                                                                       
Query: 215 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 274
           ||||||||||||||| |||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 980 acgcgttgctcctgagggagccgagggctttgatggcgccggcccggaggatgtactggt 921

                                                                       
Query: 275 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 334
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 920 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 861

                                                                       
Query: 335 cccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttgatgc 393
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 860 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 801

                                        
Query: 394 cggtgccggtgatcgggatggtggccagg 422
           ||||||||||||||||||| || ||||||
Sbjct: 800 cggtgccggtgatcgggatcgtcgccagg 772



to top

>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel
           protein, partial cds
          Length = 880

 Score =  198 bits (100), Expect = 1e-47
 Identities = 182/208 (87%), Gaps = 1/208 (0%)
 Strand = Plus / Minus

                                                                       
Query: 215 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 274
           |||||||||||||||||||||||||||||||||||| |||||||| ||| ||||||||||
Sbjct: 544 acgcgttgctcctgaaggagccgagggccttgatggggccggcccggaggatgtactggt 485

                                                                       
Query: 275 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 334
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 484 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccattggttgt 425

                                                                       
Query: 335 cccaggccttgtccttgttgtagatgacgg-cggccccaggctcctggccgggttgatgc 393
            ||||||||| || |||||| ||||||||| ||| ||   | ||||||||||||||||||
Sbjct: 424 gccaggccttctcgttgttgaagatgacggccggtccggtggtcctggccgggttgatgc 365

                                       
Query: 394 cggtgccggtgatcgggatggtggccag 421
           ||||||||||||||||||| || |||||
Sbjct: 364 cggtgccggtgatcgggatcgtcgccag 337



to top

>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete
           cds
          Length = 1171

 Score =  184 bits (93), Expect = 2e-43
 Identities = 160/181 (88%), Gaps = 1/181 (0%)
 Strand = Plus / Minus

                                                                       
Query: 243 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 302
           |||| |||||| |||||| || | |||||||||||||  ||| ||||| || ||||| ||
Sbjct: 927 cttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccaat 868

                                                                       
Query: 303 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 362
           ||  ||||| |||||||||||||| || || |||||||||||||||||||||||||||||
Sbjct: 867 cagtgggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgac 808

                                                                       
Query: 363 ggcggc-cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 421
            ||||| ||||||||||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 807 cgcggctcccaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccag 748

            
Query: 422 g 422
           |
Sbjct: 747 g 747



to top

>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete
           cds
          Length = 1156

 Score =  176 bits (89), Expect = 4e-41
 Identities = 141/157 (89%), Gaps = 1/157 (0%)
 Strand = Plus / Minus

                                                                       
Query: 267 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 326
           |||||||||||||  ||| ||||| || ||||||||||  ||||| ||||||||||||||
Sbjct: 893 gtactggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatcca 834

                                                                       
Query: 327 ctgatcatcccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgg 385
            || || ||||||||||||||||||||||||||||| ||||| |||| |||||| |||||
Sbjct: 833 ttggtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaagctcctcgccgg 774

                                                
Query: 386 gttgatgccggtgccggtgatcgggatggtggccagg 422
           ||||||||||||||||||||| |||||||||||||||
Sbjct: 773 gttgatgccggtgccggtgatggggatggtggccagg 737



to top

>ref|XM_466869.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1214

 Score =  170 bits (86), Expect = 2e-39
 Identities = 153/174 (87%), Gaps = 1/174 (0%)
 Strand = Plus / Minus

                                                                       
Query: 249 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 308
           ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 901 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 842

                                                                       
Query: 309 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcgg- 367
           ||| |||||||||||||| || ||||||||||||||||||||||||||||| || |||| 
Sbjct: 841 gcccacccagaagatccattggtcatcccaggccttgtccttgttgtagataaccgcggt 782

                                                                 
Query: 368 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 421
            |||| |||||| |||||||| ||||||||||||||||| ||||||||||||||
Sbjct: 781 tcccaagctcctcgccgggttaatgccggtgccggtgatggggatggtggccag 728



to top

>dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E03, full
           insert sequence
          Length = 1214

 Score =  170 bits (86), Expect = 2e-39
 Identities = 153/174 (87%), Gaps = 1/174 (0%)
 Strand = Plus / Minus

                                                                       
Query: 249 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 308
           ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 901 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 842

                                                                       
Query: 309 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcgg- 367
           ||| |||||||||||||| || ||||||||||||||||||||||||||||| || |||| 
Sbjct: 841 gcccacccagaagatccattggtcatcccaggccttgtccttgttgtagataaccgcggt 782

                                                                 
Query: 368 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 421
            |||| |||||| |||||||| ||||||||||||||||| ||||||||||||||
Sbjct: 781 tcccaagctcctcgccgggttaatgccggtgccggtgatggggatggtggccag 728



to top

>gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence
          Length = 1215

 Score =  153 bits (77), Expect = 5e-34
 Identities = 156/181 (86%), Gaps = 1/181 (0%)
 Strand = Plus / Minus

                                                                       
Query: 243 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 302
           |||| |||||| |||||| || | |||||||||||||  ||| ||||| || ||||| ||
Sbjct: 935 cttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccaat 876

                                                                       
Query: 303 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 362
           ||  || || |||||||||||||| || || |||||||||||||||||||||||||||||
Sbjct: 875 cagtggacccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgac 816

                                                                       
Query: 363 ggcggc-cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 421
            ||||| |||||| |||| ||||||||||||||||||||||||||  |||||||| ||||
Sbjct: 815 cgcggctcccaggatcctcgccgggttgatgccggtgccggtgatgcggatggtgtccag 756

            
Query: 422 g 422
           |
Sbjct: 755 g 755



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  149 bits (75), Expect = 9e-33
 Identities = 105/115 (91%)
 Strand = Plus / Minus

                                                                            
Query: 215      acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 274
                |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 15355852 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 15355793

                                                                       
Query: 275      ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
                ||||||| |||||||| || |||||||  |  |||||||||||||||||||||||
Sbjct: 15355792 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccactg 15355738



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 86/97 (88%), Gaps = 1/97 (1%)
 Strand = Plus / Minus

                                                                            
Query: 327      ctgatcatcccaggccttgtccttgttgtagatgacggcggcccc-aggctcctggccgg 385
                |||||||  |||||||||||  ||||||||||  |||||| | || ||||||||||||||
Sbjct: 15306327 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 15306268

                                                     
Query: 386      gttgatgccggtgccggtgatcgggatggtggccagg 422
                ||||||||||||||||||||||||||| || ||||||
Sbjct: 15306267 gttgatgccggtgccggtgatcgggatcgtcgccagg 15306231



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 69/75 (92%), Gaps = 1/75 (1%)
 Strand = Plus / Minus

                                                                            
Query: 349      ttgttgtagatgacggcggcccc-aggctcctggccgggttgatgccggtgccggtgatc 407
                |||||||| ||||||||||| || |||||||| |||||||||||||||||||||||||||
Sbjct: 15316356 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatc 15316297

                               
Query: 408      gggatggtggccagg 422
                ||||| || ||||||
Sbjct: 15316296 gggatcgtcgccagg 15316282



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 75/84 (89%), Gaps = 1/84 (1%)
 Strand = Plus / Minus

                                                                            
Query: 340      gccttgtccttgttgtagatgacggcggcccc-aggctcctggccgggttgatgccggtg 398
                ||||| || |||||| |||||||||| || || | |||||||||||||||||||||||||
Sbjct: 15355603 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtg 15355544

                                        
Query: 399      ccggtgatcgggatggtggccagg 422
                |||||||||||||| || ||||||
Sbjct: 15355543 ccggtgatcgggatcgtcgccagg 15355520



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 68/75 (90%), Gaps = 1/75 (1%)
 Strand = Plus / Minus

                                                                            
Query: 349      ttgttgtagatgacggcggcccc-aggctcctggccgggttgatgccggtgccggtgatc 407
                |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||||  
Sbjct: 15324236 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacg 15324177

                               
Query: 408      gggatggtggccagg 422
                |||||||| ||||||
Sbjct: 15324176 gggatggtcgccagg 15324162



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 270      ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
                ||||||||| |  |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 15316534 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 15316475



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 270      ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
                ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 15306498 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 15306439



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                            
Query: 286      gcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
                ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 15324431 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 15324388



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 214      tacgcgttgctcctgaaggagccg 237
                ||||||||||||| ||||||||||
Sbjct: 15306551 tacgcgttgctccggaaggagccg 15306528



to top

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score =  149 bits (75), Expect = 9e-33
 Identities = 105/115 (91%)
 Strand = Plus / Minus

                                                                         
Query: 215   acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 274
             |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 62851 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 62792

                                                                    
Query: 275   ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
             ||||||| |||||||| || |||||||  |  |||||||||||||||||||||||
Sbjct: 62791 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccactg 62737



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 86/97 (88%), Gaps = 1/97 (1%)
 Strand = Plus / Minus

                                                                         
Query: 327   ctgatcatcccaggccttgtccttgttgtagatgacggcggcccc-aggctcctggccgg 385
             |||||||  |||||||||||  ||||||||||  |||||| | || ||||||||||||||
Sbjct: 13326 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 13267

                                                  
Query: 386   gttgatgccggtgccggtgatcgggatggtggccagg 422
             ||||||||||||||||||||||||||| || ||||||
Sbjct: 13266 gttgatgccggtgccggtgatcgggatcgtcgccagg 13230



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 69/75 (92%), Gaps = 1/75 (1%)
 Strand = Plus / Minus

                                                                         
Query: 349   ttgttgtagatgacggcggcccc-aggctcctggccgggttgatgccggtgccggtgatc 407
             |||||||| ||||||||||| || |||||||| |||||||||||||||||||||||||||
Sbjct: 23355 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatc 23296

                            
Query: 408   gggatggtggccagg 422
             ||||| || ||||||
Sbjct: 23295 gggatcgtcgccagg 23281



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 75/84 (89%), Gaps = 1/84 (1%)
 Strand = Plus / Minus

                                                                         
Query: 340   gccttgtccttgttgtagatgacggcggcccc-aggctcctggccgggttgatgccggtg 398
             ||||| || |||||| |||||||||| || || | |||||||||||||||||||||||||
Sbjct: 62602 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtg 62543

                                     
Query: 399   ccggtgatcgggatggtggccagg 422
             |||||||||||||| || ||||||
Sbjct: 62542 ccggtgatcgggatcgtcgccagg 62519



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 68/75 (90%), Gaps = 1/75 (1%)
 Strand = Plus / Minus

                                                                         
Query: 349   ttgttgtagatgacggcggcccc-aggctcctggccgggttgatgccggtgccggtgatc 407
             |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||||  
Sbjct: 31235 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacg 31176

                            
Query: 408   gggatggtggccagg 422
             |||||||| ||||||
Sbjct: 31175 gggatggtcgccagg 31161



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 270   ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
             ||||||||| |  |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 23533 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 23474



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 270   ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
             ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 13497 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 13438



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                         
Query: 286   gcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
             ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 31430 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 31387



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 214   tacgcgttgctcctgaaggagccg 237
             ||||||||||||| ||||||||||
Sbjct: 13550 tacgcgttgctccggaaggagccg 13527



to top

>gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           complete cds
          Length = 1235

 Score =  149 bits (75), Expect = 9e-33
 Identities = 148/171 (86%), Gaps = 1/171 (0%)
 Strand = Plus / Minus

                                                                       
Query: 249 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 308
           ||||| |||||| || | |||||||||||||  ||| ||||| || ||||||||||  ||
Sbjct: 875 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagcgg 816

                                                                       
Query: 309 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 368
            || |||||||||||||| || ||||||||||||||||| |||||||||||||| || ||
Sbjct: 815 ccccacccagaagatccattggtcatcccaggccttgtctttgttgtagatgacagcagc 756

                                                              
Query: 369 -cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 418
            |||| ||| || |||||||||||||||||||||||||| |||||||||||
Sbjct: 755 tcccaagcttctcgccgggttgatgccggtgccggtgatggggatggtggc 705



to top

>ref|NM_187081.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1215

 Score =  147 bits (74), Expect = 3e-32
 Identities = 135/154 (87%), Gaps = 1/154 (0%)
 Strand = Plus / Minus

                                                                       
Query: 270 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
           ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 901 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 842

                                                                       
Query: 330 atcatcccaggccttgtccttgttgtagatgacggcggcccc-aggctcctggccgggtt 388
           ||||  |||||||||||  ||||||||||  |||||| | || |||||||||||||||||
Sbjct: 841 atcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggtt 782

                                             
Query: 389 gatgccggtgccggtgatcgggatggtggccagg 422
           |||||||||||||||||||||||| || ||||||
Sbjct: 781 gatgccggtgccggtgatcgggatcgtcgccagg 748



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 214 tacgcgttgctcctgaaggagccg 237
           ||||||||||||| ||||||||||
Sbjct: 954 tacgcgttgctccggaaggagccg 931



to top

>dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132K03, full
           insert sequence
          Length = 1215

 Score =  147 bits (74), Expect = 3e-32
 Identities = 135/154 (87%), Gaps = 1/154 (0%)
 Strand = Plus / Minus

                                                                       
Query: 270 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
           ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 901 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 842

                                                                       
Query: 330 atcatcccaggccttgtccttgttgtagatgacggcggcccc-aggctcctggccgggtt 388
           ||||  |||||||||||  ||||||||||  |||||| | || |||||||||||||||||
Sbjct: 841 atcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggtt 782

                                             
Query: 389 gatgccggtgccggtgatcgggatggtggccagg 422
           |||||||||||||||||||||||| || ||||||
Sbjct: 781 gatgccggtgccggtgatcgggatcgtcgccagg 748



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 214 tacgcgttgctcctgaaggagccg 237
           ||||||||||||| ||||||||||
Sbjct: 954 tacgcgttgctccggaaggagccg 931



to top

>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds
          Length = 1104

 Score =  139 bits (70), Expect = 8e-30
 Identities = 149/174 (85%), Gaps = 1/174 (0%)
 Strand = Plus / Minus

                                                                       
Query: 249 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 308
           ||||| |||||| || | ||||||||||||    || ||||| || |||||||| |  ||
Sbjct: 825 ggcgctggccctcagcacgtactggtggtacgccgcggcgatggcggcgccgatgaatgg 766

                                                                       
Query: 309 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 368
            || |||||||||||||| || ||||||||||||||||| |||||||||||||| || ||
Sbjct: 765 acccacccagaagatccagtggtcatcccaggccttgtcgttgttgtagatgacagcagc 706

                                                                 
Query: 369 -cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 421
            |||| ||||||||||||||||||||||||||||||||| ||||| ||||||||
Sbjct: 705 gcccaagctcctggccgggttgatgccggtgccggtgatggggatcgtggccag 652



to top

>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete
           cds
          Length = 1207

 Score =  139 bits (70), Expect = 8e-30
 Identities = 149/174 (85%), Gaps = 1/174 (0%)
 Strand = Plus / Minus

                                                                       
Query: 249 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 308
           ||||| |||||| || | ||||||||||||    || ||||| || |||||||| |  ||
Sbjct: 880 ggcgctggccctcagcacgtactggtggtacgccgcggcgatggcggcgccgatgaatgg 821

                                                                       
Query: 309 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 368
            || |||||||||||||| || ||||||||||||||||| |||||||||||||| || ||
Sbjct: 820 acccacccagaagatccagtggtcatcccaggccttgtcgttgttgtagatgacagcagc 761

                                                                 
Query: 369 -cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 421
            |||| ||||||||||||||||||||||||||||||||| ||||| ||||||||
Sbjct: 760 gcccaagctcctggccgggttgatgccggtgccggtgatggggatcgtggccag 707



to top

>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete
           cds
          Length = 1343

 Score =  133 bits (67), Expect = 5e-28
 Identities = 152/179 (84%), Gaps = 1/179 (0%)
 Strand = Plus / Minus

                                                                       
Query: 243 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 302
           |||| |||||| |||||| || | |||||||||||| ||||| ||||| || || |||||
Sbjct: 913 cttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggccccgat 854

                                                                       
Query: 303 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 362
            |  || || |||||||| ||||| || |||||||||||||| || ||||||||||| ||
Sbjct: 853 gaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcac 794

                                                                      
Query: 363 ggcggc-cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           ||| || || | |||||| |||||||||||||||||||||||||||||||| |||||||
Sbjct: 793 ggcagctccgaagctcctcgccgggttgatgccggtgccggtgatcgggatagtggcca 735



to top

>ref|XM_473219.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 873

 Score =  129 bits (65), Expect = 8e-27
 Identities = 147/173 (84%), Gaps = 1/173 (0%)
 Strand = Plus / Minus

                                                                       
Query: 249 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 308
           ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||| | |||
Sbjct: 837 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 778

                                                                       
Query: 309 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 368
            || |||||||||||||| || |||| ||| ||||||| || ||||||||| || || ||
Sbjct: 777 ccccacccagaagatccagtggtcatgccatgccttgtgctggttgtagatcaccgcagc 718

                                                                
Query: 369 -cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
            |||| |||||| |||||||||||||||||||||||||||||||| |||||||
Sbjct: 717 tcccaagctccttgccgggttgatgccggtgccggtgatcgggatcgtggcca 665



to top

>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence
          Length = 698

 Score =  123 bits (62), Expect = 5e-25
 Identities = 132/154 (85%), Gaps = 1/154 (0%)
 Strand = Plus / Minus

                                                                       
Query: 270 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 397 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 338

                                                                       
Query: 330 atcatcccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggtt 388
            ||| ||||||| | || || |||||| || |||||||| || |||||||  || |||||
Sbjct: 337 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 278

                                             
Query: 389 gatgccggtgccggtgatcgggatggtggccagg 422
           |||||||||||||||||| |||||||||||||||
Sbjct: 277 gatgccggtgccggtgatagggatggtggccagg 244



to top

>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score =  123 bits (62), Expect = 5e-25
 Identities = 132/154 (85%), Gaps = 1/154 (0%)
 Strand = Plus / Minus

                                                                       
Query: 270 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 828 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 769

                                                                       
Query: 330 atcatcccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggtt 388
            ||| ||||||| | || || |||||| || |||||||| || |||||||  || |||||
Sbjct: 768 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 709

                                             
Query: 389 gatgccggtgccggtgatcgggatggtggccagg 422
           |||||||||||||||||| |||||||||||||||
Sbjct: 708 gatgccggtgccggtgatagggatggtggccagg 675



to top

>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score =  123 bits (62), Expect = 5e-25
 Identities = 132/154 (85%), Gaps = 1/154 (0%)
 Strand = Plus / Minus

                                                                       
Query: 270 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 898 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 839

                                                                       
Query: 330 atcatcccaggccttgtccttgttgtagatgacggcggcccc-aggctcctggccgggtt 388
            ||   |||||| |  ||| |||||||||||| ||| || || |||||||| ||||||||
Sbjct: 838 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 779

                                             
Query: 389 gatgccggtgccggtgatcgggatggtggccagg 422
           |||||||||||||||||| |||||||||||||||
Sbjct: 778 gatgccggtgccggtgatggggatggtggccagg 745



to top

>dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin, complete cds
          Length = 1318

 Score =  123 bits (62), Expect = 5e-25
 Identities = 132/154 (85%), Gaps = 1/154 (0%)
 Strand = Plus / Minus

                                                                       
Query: 268 tactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccac 327
           ||||||||||||  ||| || || || ||||||||||  || || |||||||||||||| 
Sbjct: 944 tactggtggtaggcggcggcaatggcggcgccgatcagtggccccacccagaagatccat 885

                                                                       
Query: 328 tgatcatcccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccggg 386
           || |||||||||||||||||  ||||||||||||| || || |||| ||| || || |||
Sbjct: 884 tggtcatcccaggccttgtcagtgttgtagatgacagcagctcccaagcttctcgcgggg 825

                                             
Query: 387 ttgatgccggtgccggtgatcgggatggtggcca 420
           |||||||||||||||||||| |||||||||||||
Sbjct: 824 ttgatgccggtgccggtgatggggatggtggcca 791



to top

>dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd
          Length = 1251

 Score =  123 bits (62), Expect = 5e-25
 Identities = 132/154 (85%), Gaps = 1/154 (0%)
 Strand = Plus / Minus

                                                                       
Query: 268 tactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccac 327
           ||||||||||||  ||| || || || ||||||||||  || || |||||||||||||| 
Sbjct: 864 tactggtggtaggcggcggcaatggcggcgccgatcagtggccccacccagaagatccat 805

                                                                       
Query: 328 tgatcatcccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccggg 386
           || |||||||||||||||||  ||||||||||||| || || |||| ||| || || |||
Sbjct: 804 tggtcatcccaggccttgtcagtgttgtagatgacagcagctcccaagcttctcgcgggg 745

                                             
Query: 387 ttgatgccggtgccggtgatcgggatggtggcca 420
           |||||||||||||||||||| |||||||||||||
Sbjct: 744 ttgatgccggtgccggtgatggggatggtggcca 711



to top

>ref|NM_187084.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 852

 Score =  115 bits (58), Expect = 1e-22
 Identities = 119/138 (86%), Gaps = 1/138 (0%)
 Strand = Plus / Minus

                                                                       
Query: 286 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 345
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 782 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 723

                                                                       
Query: 346 tccttgttgtagatgacggcggcccc-aggctcctggccgggttgatgccggtgccggtg 404
              |||||||||| ||||||||| || |||||||| ||||||||||||||||||||||||
Sbjct: 722 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtg 663

                             
Query: 405 atcgggatggtggccagg 422
           |  |||||||| ||||||
Sbjct: 662 acggggatggtcgccagg 645



to top

>ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group), P0475E07.134 mRNA
          Length = 619

 Score =  115 bits (58), Expect = 1e-22
 Identities = 119/138 (86%), Gaps = 1/138 (0%)
 Strand = Plus / Minus

                                                                       
Query: 286 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 345
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 340 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 281

                                                                       
Query: 346 tccttgttgtagatgacggcggcccc-aggctcctggccgggttgatgccggtgccggtg 404
              |||||||||| ||||||||| || |||||||| ||||||||||||||||||||||||
Sbjct: 280 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtg 221

                             
Query: 405 atcgggatggtggccagg 422
           |  |||||||| ||||||
Sbjct: 220 acggggatggtcgccagg 203



to top

>ref|XM_473480.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score =  115 bits (58), Expect = 1e-22
 Identities = 104/118 (88%), Gaps = 1/118 (0%)
 Strand = Plus / Minus

                                                                       
Query: 306 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 365
           |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 774 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 715

                                                                     
Query: 366 ggcccca-ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
            || ||| ||||||| || ||||||||||||||||||||||| |||||||||||||||
Sbjct: 714 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggccagg 657



to top

>gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-2
           (PIP2-2) mRNA, complete cds
          Length = 1171

 Score =  115 bits (58), Expect = 1e-22
 Identities = 98/110 (89%), Gaps = 1/110 (0%)
 Strand = Plus / Minus

                                                                       
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 369
           |||||||||||||||||||| || |||||  | || || |||||||||||||||||||| 
Sbjct: 787 ccgacccagaagatccactggtcgtcccaaactttttcattgttgtagatgacggcggcg 728

                                                             
Query: 370 cc-aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 418
           || | ||||||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 727 ccgaagctcctggcggggttgatgccggtgccggtgatggggatggtggc 678



to top

>dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-132-C10, full
           insert sequence
          Length = 618

 Score =  115 bits (58), Expect = 1e-22
 Identities = 119/138 (86%), Gaps = 1/138 (0%)
 Strand = Plus / Minus

                                                                       
Query: 286 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 345
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 339 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 280

                                                                       
Query: 346 tccttgttgtagatgacggcggcccc-aggctcctggccgggttgatgccggtgccggtg 404
              |||||||||| ||||||||| || |||||||| ||||||||||||||||||||||||
Sbjct: 279 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtg 220

                             
Query: 405 atcgggatggtggccagg 422
           |  |||||||| ||||||
Sbjct: 219 acggggatggtcgccagg 202



to top

>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full
           insert sequence
          Length = 1163

 Score =  115 bits (58), Expect = 1e-22
 Identities = 104/118 (88%), Gaps = 1/118 (0%)
 Strand = Plus / Minus

                                                                       
Query: 306 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 365
           |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 851 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 792

                                                                     
Query: 366 ggcccca-ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
            || ||| ||||||| || ||||||||||||||||||||||| |||||||||||||||
Sbjct: 791 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggccagg 734



to top

>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full
           insert sequence
          Length = 1164

 Score =  115 bits (58), Expect = 1e-22
 Identities = 131/154 (85%), Gaps = 1/154 (0%)
 Strand = Plus / Minus

                                                                       
Query: 270 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
           ||||||||||| ||| || |  || ||||| || | |||||| |||||||||||||| ||
Sbjct: 888 ctggtggtagatggcagcaagggcagcgccaatgaaggggccaacccagaagatccaatg 829

                                                                       
Query: 330 atcatcccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggtt 388
            ||||||||||| | | || |||||||||||| ||| || || |||||||| || |||||
Sbjct: 828 gtcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggtt 769

                                             
Query: 389 gatgccggtgccggtgatcgggatggtggccagg 422
           |||||||||||||||||| |||||||||||||||
Sbjct: 768 gatgccggtgccggtgatggggatggtggccagg 735



to top

>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full
           insert sequence
          Length = 1167

 Score =  115 bits (58), Expect = 1e-22
 Identities = 104/118 (88%), Gaps = 1/118 (0%)
 Strand = Plus / Minus

                                                                       
Query: 306 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 365
           |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 854 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 795

                                                                     
Query: 366 ggcccca-ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
            || ||| ||||||| || ||||||||||||||||||||||| |||||||||||||||
Sbjct: 794 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggccagg 737



to top

>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full
            insert sequence
          Length = 1462

 Score =  115 bits (58), Expect = 1e-22
 Identities = 104/118 (88%), Gaps = 1/118 (0%)
 Strand = Plus / Minus

                                                                        
Query: 306  ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 365
            |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 1150 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 1091

                                                                      
Query: 366  ggcccca-ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
             || ||| ||||||| || ||||||||||||||||||||||| |||||||||||||||
Sbjct: 1090 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggccagg 1033



to top

>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds
          Length = 1147

 Score =  115 bits (58), Expect = 1e-22
 Identities = 104/118 (88%), Gaps = 1/118 (0%)
 Strand = Plus / Minus

                                                                       
Query: 306 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 365
           |||||| |||||||||||||| || |||| |||||| | |||| |||||||||||| |||
Sbjct: 877 ggggcccacccagaagatccaatggtcattccaggcatggtccctgttgtagatgatggc 818

                                                                     
Query: 366 ggcccca-ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
            |||||| ||||||| || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 817 agccccaaggctcctagctgggttgatgccggtgccggtgatgggaatggtggccagg 760



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  111 bits (56), Expect = 2e-21
 Identities = 84/92 (91%), Gaps = 1/92 (1%)
 Strand = Plus / Minus

                                                                            
Query: 331      tcatcccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttg 389
                ||||||||||||||||||||||||||||| || ||||  |||| |||||| |||||||| 
Sbjct: 25184038 tcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggtta 25183979

                                                
Query: 390      atgccggtgccggtgatcgggatggtggccag 421
                ||||||||||||||||| ||||||||||||||
Sbjct: 25183978 atgccggtgccggtgatggggatggtggccag 25183947



 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                            
Query: 331      tcatcccaggccttgtccttgttgtagatgacggcggcccca-ggctcctggccgggttg 389
                |||| |||||| | ||||||||||||||||| ||| || ||| |||||||||| ||||||
Sbjct: 27065064 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 27065005

                                                 
Query: 390      atgccggtgccggtgatcgggatggtggccagg 422
                ||||| || |||||||| |||||||||||||||
Sbjct: 27065004 atgccagtaccggtgatggggatggtggccagg 27064972



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 71/82 (86%)
 Strand = Plus / Minus

                                                                            
Query: 249      ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 308
                ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 25184682 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 25184623

                                      
Query: 309      gccgacccagaagatccactga 330
                ||| ||||||||||||||||||
Sbjct: 25184622 gcccacccagaagatccactga 25184601



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                                   
Query: 384      gggttgatgccggtgccggtgatcgggatggtggc 418
                ||||||||||||||||||||||| |||||||||||
Sbjct: 35369027 gggttgatgccggtgccggtgatggggatggtggc 35368993



to top

>dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1469H02
          Length = 136602

 Score =  111 bits (56), Expect = 2e-21
 Identities = 84/92 (91%), Gaps = 1/92 (1%)
 Strand = Plus / Minus

                                                                         
Query: 331   tcatcccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttg 389
             ||||||||||||||||||||||||||||| || ||||  |||| |||||| |||||||| 
Sbjct: 84431 tcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggtta 84372

                                             
Query: 390   atgccggtgccggtgatcgggatggtggccag 421
             ||||||||||||||||| ||||||||||||||
Sbjct: 84371 atgccggtgccggtgatggggatggtggccag 84340



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 71/82 (86%)
 Strand = Plus / Minus

                                                                         
Query: 249   ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 308
             ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 85075 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 85016

                                   
Query: 309   gccgacccagaagatccactga 330
             ||| ||||||||||||||||||
Sbjct: 85015 gcccacccagaagatccactga 84994



to top

>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS
          Length = 1139

 Score =  109 bits (55), Expect = 7e-21
 Identities = 98/111 (88%), Gaps = 1/111 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccca 372
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || |||
Sbjct: 812 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 753

                                                              
Query: 373 -ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
            |||||||||| ||||||||||| || |||||||| |||||||||||||||
Sbjct: 752 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccagg 702



to top

>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full
           insert sequence
          Length = 1128

 Score =  109 bits (55), Expect = 7e-21
 Identities = 98/111 (88%), Gaps = 1/111 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccca 372
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || |||
Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786

                                                              
Query: 373 -ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
            |||||||||| ||||||||||| || |||||||| |||||||||||||||
Sbjct: 785 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccagg 735



to top

>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full
           insert sequence
          Length = 1205

 Score =  109 bits (55), Expect = 7e-21
 Identities = 98/111 (88%), Gaps = 1/111 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccca 372
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || |||
Sbjct: 900 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 841

                                                              
Query: 373 -ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
            |||||||||| ||||||||||| || |||||||| |||||||||||||||
Sbjct: 840 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccagg 790



to top

>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full
           insert sequence
          Length = 1136

 Score =  109 bits (55), Expect = 7e-21
 Identities = 98/111 (88%), Gaps = 1/111 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccca 372
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || |||
Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786

                                                              
Query: 373 -ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
            |||||||||| ||||||||||| || |||||||| |||||||||||||||
Sbjct: 785 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccagg 735



to top

>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1140

 Score =  109 bits (55), Expect = 7e-21
 Identities = 98/111 (88%), Gaps = 1/111 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccca 372
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || |||
Sbjct: 840 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 781

                                                              
Query: 373 -ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
            |||||||||| ||||||||||| || |||||||| |||||||||||||||
Sbjct: 780 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccagg 730



to top

>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel
           protein, complete cds
          Length = 1116

 Score =  109 bits (55), Expect = 7e-21
 Identities = 98/111 (88%), Gaps = 1/111 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccca 372
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || |||
Sbjct: 843 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 784

                                                              
Query: 373 -ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
            |||||||||| ||||||||||| || |||||||| |||||||||||||||
Sbjct: 783 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccagg 733



to top

>ref|XM_475029.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 96/110 (87%), Gaps = 1/110 (0%)
 Strand = Plus / Minus

                                                                       
Query: 314 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc-a 372
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 742 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 683

                                                             
Query: 373 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
            ||||| ||| ||||||||||| ||||||||||| |||||||||||||||
Sbjct: 682 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccagg 633



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 219 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 275
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 837 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 781



to top

>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 117/138 (84%), Gaps = 1/138 (0%)
 Strand = Plus / Minus

                                                                       
Query: 270 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 885 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 826

                                                                       
Query: 330 atcatcccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggtt 388
            ||| ||||||| | || || |||||| || |||||||| || |||||||  || |||||
Sbjct: 825 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 766

                             
Query: 389 gatgccggtgccggtgat 406
           ||||||||||||||||||
Sbjct: 765 gatgccggtgccggtgat 748



to top

>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete
           cds
          Length = 1153

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 126/150 (84%), Gaps = 1/150 (0%)
 Strand = Plus / Minus

                                                                       
Query: 270 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||| ||
Sbjct: 940 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 881

                                                                       
Query: 330 atcatcccaggccttgtccttgttgtagatgacggcggcccca-ggctcctggccgggtt 388
            ||   ||| || |  |||  ||||||||||| |||||| ||| ||||||| ||||||||
Sbjct: 880 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 821

                                         
Query: 389 gatgccggtgccggtgatcgggatggtggc 418
           |||||||||||||||||| |||||||||||
Sbjct: 820 gatgccggtgccggtgatggggatggtggc 791



to top

>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete
           cds
          Length = 1296

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 126/150 (84%), Gaps = 1/150 (0%)
 Strand = Plus / Minus

                                                                       
Query: 270 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||| ||
Sbjct: 935 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 876

                                                                       
Query: 330 atcatcccaggccttgtccttgttgtagatgacggcggcccca-ggctcctggccgggtt 388
            ||   ||| || |  |||  ||||||||||| |||||| ||| ||||||| ||||||||
Sbjct: 875 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 816

                                         
Query: 389 gatgccggtgccggtgatcgggatggtggc 418
           |||||||||||||||||| |||||||||||
Sbjct: 815 gatgccggtgccggtgatggggatggtggc 786



to top

>dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-B01, full
           insert sequence
          Length = 1067

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 96/110 (87%), Gaps = 1/110 (0%)
 Strand = Plus / Minus

                                                                       
Query: 314 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc-a 372
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 728 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 669

                                                             
Query: 373 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
            ||||| ||| ||||||||||| ||||||||||| |||||||||||||||
Sbjct: 668 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccagg 619



 Score = 46.1 bits (23), Expect = 0.092
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 221 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 275
           |||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 821 tgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 767



to top

>dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086E18, full
           insert sequence
          Length = 1308

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 96/110 (87%), Gaps = 1/110 (0%)
 Strand = Plus / Minus

                                                                       
Query: 314 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc-a 372
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 841 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 782

                                                             
Query: 373 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
            ||||| ||| ||||||||||| ||||||||||| |||||||||||||||
Sbjct: 781 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccagg 732



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 219 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 275
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 936 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 880



to top

>dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-B05, full
           insert sequence
          Length = 1309

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 96/110 (87%), Gaps = 1/110 (0%)
 Strand = Plus / Minus

                                                                       
Query: 314 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc-a 372
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 835 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 776

                                                             
Query: 373 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
            ||||| ||| ||||||||||| ||||||||||| |||||||||||||||
Sbjct: 775 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccagg 726



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 219 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 275
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 930 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 874



to top

>dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-B10, full
           insert sequence
          Length = 1296

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 96/110 (87%), Gaps = 1/110 (0%)
 Strand = Plus / Minus

                                                                       
Query: 314 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc-a 372
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 829 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 770

                                                             
Query: 373 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
            ||||| ||| ||||||||||| ||||||||||| |||||||||||||||
Sbjct: 769 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccagg 720



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 219 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 275
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 924 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 868



to top

>gb|AY103580.1| Zea mays PCO072544 mRNA sequence
          Length = 1633

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 126/150 (84%), Gaps = 1/150 (0%)
 Strand = Plus / Minus

                                                                        
Query: 270  ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
            ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||| ||
Sbjct: 1264 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 1205

                                                                        
Query: 330  atcatcccaggccttgtccttgttgtagatgacggcggcccca-ggctcctggccgggtt 388
             ||   ||| || |  |||  ||||||||||| |||||| ||| ||||||| ||||||||
Sbjct: 1204 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 1145

                                          
Query: 389  gatgccggtgccggtgatcgggatggtggc 418
            |||||||||||||||||| |||||||||||
Sbjct: 1144 gatgccggtgccggtgatggggatggtggc 1115



to top

>gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-1
           (PIP2-1) mRNA, complete cds
          Length = 1300

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 164/201 (81%), Gaps = 1/201 (0%)
 Strand = Plus / Minus

                                                                       
Query: 221 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtaga 280
           |||||||||| || || || |||||||| || || || || | |||| ||||||||||||
Sbjct: 912 tgctcctgaatgacccaagagccttgatagctccagctctcaatatgaactggtggtaga 853

                                                                       
Query: 281 aggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccagg 340
           |||| || || || || || || | ||| || ||||| ||||||||||| ||||||||||
Sbjct: 852 aggctgcaatggctgcaccaatgaagggtccaacccaaaagatccactggtcatcccagg 793

                                                                       
Query: 341 ccttgtccttgttgtagatgacggc-ggccccaggctcctggccgggttgatgccggtgc 399
           |||| || ||||||||||| || || | |||||  |||||||| |||||||| |||||||
Sbjct: 792 ccttctcattgttgtagataacagcagcccccaaactcctggcagggttgataccggtgc 733

                                
Query: 400 cggtgatcgggatggtggcca 420
           | ||||| || || |||||||
Sbjct: 732 cagtgataggaatagtggcca 712



to top

>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0475E07
          Length = 139961

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 86/97 (88%), Gaps = 1/97 (1%)
 Strand = Plus / Minus

                                                                         
Query: 327   ctgatcatcccaggccttgtccttgttgtagatgacggcggcccc-aggctcctggccgg 385
             |||||||  |||||||||||  ||||||||||  |||||| | || ||||||||||||||
Sbjct: 92340 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 92281

                                                  
Query: 386   gttgatgccggtgccggtgatcgggatggtggccagg 422
             ||||||||||||||||||||||||||| || ||||||
Sbjct: 92280 gttgatgccggtgccggtgatcgggatcgtcgccagg 92244



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 69/75 (92%), Gaps = 1/75 (1%)
 Strand = Plus / Minus

                                                                          
Query: 349    ttgttgtagatgacggcggcccc-aggctcctggccgggttgatgccggtgccggtgatc 407
              |||||||| ||||||||||| || |||||||| |||||||||||||||||||||||||||
Sbjct: 102369 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatc 102310

                             
Query: 408    gggatggtggccagg 422
              ||||| || ||||||
Sbjct: 102309 gggatcgtcgccagg 102295



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 68/75 (90%), Gaps = 1/75 (1%)
 Strand = Plus / Minus

                                                                          
Query: 349    ttgttgtagatgacggcggcccc-aggctcctggccgggttgatgccggtgccggtgatc 407
              |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||||  
Sbjct: 110249 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacg 110190

                             
Query: 408    gggatggtggccagg 422
              |||||||| ||||||
Sbjct: 110189 gggatggtcgccagg 110175



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                          
Query: 270    ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
              ||||||||| |  |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 102547 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 102488



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 270   ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
             ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 92511 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 92452



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                          
Query: 286    gcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
              ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 110444 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 110401



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 214   tacgcgttgctcctgaaggagccg 237
             ||||||||||||| ||||||||||
Sbjct: 92564 tacgcgttgctccggaaggagccg 92541



to top

>gb|AY107589.1| Zea mays PCO085320 mRNA sequence
          Length = 569

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 101/117 (86%), Gaps = 1/117 (0%)
 Strand = Plus / Minus

                                                                       
Query: 307 gggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc- 365
           |||||||||||||| ||||| ||||| ||||| |||||   || |||||| |  ||||| 
Sbjct: 194 gggccgacccagaatatccagtgatcctcccacgcctttcgctggttgtacacaacggcc 135

                                                                    
Query: 366 ggccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
           |||||||||||||| |||||||||||||| ||||||||||  |||||||||||||||
Sbjct: 134 ggccccaggctccttgccgggttgatgcccgtgccggtgacggggatggtggccagg 78



to top

>ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative aquaporin
           (OSJNBa0093B11.9), mRNA
          Length = 729

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 93/107 (86%), Gaps = 1/107 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||||||||||||||| | ||| || |||  || |||||||| ||||||||| || 
Sbjct: 626 acccagaagatccactgatcgtgccaagcattgggctggttgtagacgacggcggcgccg 567

                                                          
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 418
           | |||||| ||||| |||||||| |||||||||||||||||||||||
Sbjct: 566 aagctcctcgccggattgatgcccgtgccggtgatcgggatggtggc 520



to top

>gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds
          Length = 1070

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 93/107 (86%), Gaps = 1/107 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc-ccc 371
           |||||||| ||||| ||||||||||| || ||||| ||||||||||| |||||||| || 
Sbjct: 746 acccagaaaatccattgatcatcccaagctttgtctttgttgtagattacggcggctccg 687

                                                          
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 418
           | ||| ||||| ||||| || ||||||||||||||||| ||||||||
Sbjct: 686 aagcttctggcggggttaattccggtgccggtgatcggaatggtggc 640



to top

>dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-C02, full
           insert sequence
          Length = 1232

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 93/107 (86%), Gaps = 1/107 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||||||||||||||| | ||| || |||  || |||||||| ||||||||| || 
Sbjct: 808 acccagaagatccactgatcgtgccaagcattgggctggttgtagacgacggcggcgccg 749

                                                          
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 418
           | |||||| ||||| |||||||| |||||||||||||||||||||||
Sbjct: 748 aagctcctcgccggattgatgcccgtgccggtgatcgggatggtggc 702



to top

>gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds
          Length = 1216

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 131/158 (82%), Gaps = 1/158 (0%)
 Strand = Plus / Minus

                                                                       
Query: 264 tatgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagat 323
           |||| |||||||||||||||| || || || || || || | ||| || ||||| |||||
Sbjct: 873 tatgaactggtggtagaaggctgcaatggctgcaccaatgaagggtccaacccaaaagat 814

                                                                       
Query: 324 ccactgatcatcccaggccttgtccttgttgtagatgacggc-ggccccaggctcctggc 382
           |||||| |||||||||||||| || ||||||||||| || || | |||||  ||||||||
Sbjct: 813 ccactggtcatcccaggccttctcattgttgtagataacagcagcccccaaactcctggc 754

                                                 
Query: 383 cgggttgatgccggtgccggtgatcgggatggtggcca 420
            |||||||| |||||||| ||||| || || |||||||
Sbjct: 753 agggttgataccggtgccagtgataggaatagtggcca 716



to top

>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin
          Length = 1291

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 68/74 (91%), Gaps = 1/74 (1%)
 Strand = Plus / Minus

                                                                       
Query: 350 tgttgtagatgacggcggcccc-aggctcctggccgggttgatgccggtgccggtgatcg 408
           |||||||||||| ||| || || |||||||| |||||||||||||||||||||||||| |
Sbjct: 657 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 598

                         
Query: 409 ggatggtggccagg 422
           ||||||||||||||
Sbjct: 597 ggatggtggccagg 584



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                        
Query: 270  ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
            ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||||||
Sbjct: 1291 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccactg 1232



to top

>gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein ZmPIP2-6 mRNA, complete
           cds
          Length = 1257

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 116/138 (84%), Gaps = 1/138 (0%)
 Strand = Plus / Minus

                                                                       
Query: 286 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 345
           ||||||||||| ||||| |  ||||| ||||||||||||||||| ||   |||||| |||
Sbjct: 884 gcgatcgccgctccgatgaacgggcccacccagaagatccactggtcgctccaggctttg 825

                                                                       
Query: 346 tccttgttgtagatgacggcggcccc-aggctcctggccgggttgatgccggtgccggtg 404
              |||||||| | ||||||||| || |||||||| ||||||||||| |||||||| |||
Sbjct: 824 ctgttgttgtacacgacggcggcgccgaggctcctcgccgggttgataccggtgccagtg 765

                             
Query: 405 atcgggatggtggccagg 422
           |||||||| || ||||||
Sbjct: 764 atcgggatcgtcgccagg 747



to top

>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11,
             complete sequence
          Length = 147806

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                         
Query: 331   tcatcccaggccttgtccttgttgtagatgacggcggcccca-ggctcctggccgggttg 389
             ||||||||||| | | || |||||||||||| ||| || ||| ||||||| || ||||||
Sbjct: 28019 tcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggttg 27960

                                              
Query: 390   atgccggtgccggtgatcgggatggtggccagg 422
             ||||||||||||||||| |||||||||||||||
Sbjct: 27959 atgccggtgccggtgatggggatggtggccagg 27927



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 306   ggggccgacccagaagatccactg 329
             |||||| |||||||||||||||||
Sbjct: 28605 ggggccaacccagaagatccactg 28582



to top

>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1
           (PIP1-1) mRNA, complete cds
          Length = 1115

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 94/109 (86%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc-ccc 371
           |||||||||||||| || || ||||| || | ||||||||||||||||| ||| || |||
Sbjct: 810 acccagaagatccagtggtcgtcccatgcgtggtccttgttgtagatgatggccgcaccc 751

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |||||||  || |||||||||||||| ||||| || |||||||||||||
Sbjct: 750 aggctccgagctgggttgatgccggttccggttatggggatggtggcca 702



to top

>gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds
          Length = 534

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 94/109 (86%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccca 372
           |||||||| ||||| || ||||||||||| |  ||||||||||||||||  ||||| |||
Sbjct: 458 acccagaatatccaatgttcatcccaggcttgatccttgttgtagatgattgcggcacca 399

                                                            
Query: 373 -ggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
            |||||||||| |||||||| ||||| || ||||| |||||||||||||
Sbjct: 398 aggctcctggcggggttgataccggtacctgtgattgggatggtggcca 350



to top

>gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, complete cds
          Length = 867

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 94/109 (86%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccca 372
           |||||||| ||||| || ||||||||||| |  ||||||||||||||||  ||||| |||
Sbjct: 788 acccagaatatccaatgttcatcccaggcttgatccttgttgtagatgattgcggcacca 729

                                                            
Query: 373 -ggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
            |||||||||| |||||||| ||||| || ||||| |||||||||||||
Sbjct: 728 aggctcctggcggggttgataccggtacctgtgattgggatggtggcca 680



to top

>gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           partial cds
          Length = 411

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 331 tcatcccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttg 389
           |||| ||||||| |||| |||||||||||||| || || |||| ||| || |||||||||
Sbjct: 407 tcattccaggccctgtctttgttgtagatgacagcagctcccaagcttctcgccgggttg 348

                                        
Query: 390 atgccggtgccggtgatcgggatggtggc 418
           ||||||||||||||||| |||||||||||
Sbjct: 347 atgccggtgccggtgatggggatggtggc 319



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                            
Query: 331      tcatcccaggccttgtccttgttgtagatgacggcggcccca-ggctcctggccgggttg 389
                ||||||||||| | | || |||||||||||| ||| || ||| ||||||| || ||||||
Sbjct: 28020793 tcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggttg 28020734

                                                 
Query: 390      atgccggtgccggtgatcgggatggtggccagg 422
                ||||||||||||||||| |||||||||||||||
Sbjct: 28020733 atgccggtgccggtgatggggatggtggccagg 28020701



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 80/91 (87%), Gaps = 1/91 (1%)
 Strand = Plus / Minus

                                                                            
Query: 331      tcatcccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttg 389
                |||| ||| ||||||| || ||||||||| || || || |||| |||||| |||||||||
Sbjct: 26074238 tcatgccatgccttgtgctggttgtagatcaccgcagctcccaagctccttgccgggttg 26074179

                                               
Query: 390      atgccggtgccggtgatcgggatggtggcca 420
                ||||||||||||||||||||||| |||||||
Sbjct: 26074178 atgccggtgccggtgatcgggatcgtggcca 26074148



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 79/90 (87%), Gaps = 1/90 (1%)
 Strand = Plus / Plus

                                                                           
Query: 334     tcccaggccttgtccttgttgtagatgacggcggcccc-aggctcctggccgggttgatg 392
               ||||| ||||| | || |||||||||||||||||| || | ||||| ||| |||||||||
Sbjct: 8906901 tcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagggttgatg 8906960

                                             
Query: 393     ccggtgccggtgatcgggatggtggccagg 422
               || ||||||||||| |||||||||||||||
Sbjct: 8906961 cccgtgccggtgatggggatggtggccagg 8906990



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                            
Query: 249      ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 308
                ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||| | |||
Sbjct: 26074829 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 26074770

                                    
Query: 309      gccgacccagaagatccact 328
                 || ||||||||||||||||
Sbjct: 26074769 ccccacccagaagatccact 26074750



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                        
Query: 219     gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 275
               |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 8906703 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 8906759



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 306      ggggccgacccagaagatccactg 329
                |||||| |||||||||||||||||
Sbjct: 28021379 ggggccaacccagaagatccactg 28021356



to top

>gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1) mRNA, complete
           cds
          Length = 480

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 163/201 (81%), Gaps = 1/201 (0%)
 Strand = Plus / Minus

                                                                       
Query: 221 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtaga 280
           |||||||||| || || || |||||||| || || || || | |||| ||||||||||||
Sbjct: 466 tgctcctgaatgacccaagagccttgatagctccagctctcaatatgaactggtggtaga 407

                                                                       
Query: 281 aggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccagg 340
           |||| || || || || || || | ||| || ||||| ||||||||||| ||||||||||
Sbjct: 406 aggctgcaatggctgcaccaatgaagggtccaacccaaaagatccactggtcatcccagg 347

                                                                       
Query: 341 ccttgtccttgttgtagatgacggc-ggccccaggctcctggccgggttgatgccggtgc 399
           |||| || ||||||||||| || || | |||||  |||||||| |||||||| ||||| |
Sbjct: 346 ccttctcattgttgtagataacagcagcccccaaactcctggcagggttgataccggtac 287

                                
Query: 400 cggtgatcgggatggtggcca 420
           | ||||| || || |||||||
Sbjct: 286 cagtgataggaatagtggcca 266



to top

>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1486_E07
          Length = 110494

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                         
Query: 331   tcatcccaggccttgtccttgttgtagatgacggcggcccca-ggctcctggccgggttg 389
             |||| |||||| | ||||||||||||||||| ||| || ||| |||||||||| ||||||
Sbjct: 36713 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 36654

                                              
Query: 390   atgccggtgccggtgatcgggatggtggccagg 422
             ||||| || |||||||| |||||||||||||||
Sbjct: 36653 atgccagtaccggtgatggggatggtggccagg 36621



to top

>dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0461B08
          Length = 153743

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                          
Query: 331    tcatcccaggccttgtccttgttgtagatgacggcggcccca-ggctcctggccgggttg 389
              |||| |||||| | ||||||||||||||||| ||| || ||| |||||||||| ||||||
Sbjct: 118266 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 118207

                                               
Query: 390    atgccggtgccggtgatcgggatggtggccagg 422
              ||||| || |||||||| |||||||||||||||
Sbjct: 118206 atgccagtaccggtgatggggatggtggccagg 118174



to top

>gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasma membrane
           intrinsic protein mRNA, complete cds
          Length = 1120

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 94/109 (86%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc-ccc 371
           ||||||||||||||||| |||||||| ||||||||||||||||| || || || || || 
Sbjct: 746 acccagaagatccactggtcatcccatgccttgtccttgttgtaaattacagcagctccg 687

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |  |||||||| |||||||| ||||||||||| || ||||| |||||||
Sbjct: 686 aaactcctggctgggttgataccggtgccggtaattgggatagtggcca 638



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 220 ttgctcctgaaggagccgagggccttgatggc 251
           |||||||||||||| ||||| |||||||||||
Sbjct: 839 ttgctcctgaaggatccgagagccttgatggc 808



to top

>gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein ZmPIP1-6 mRNA, complete
           cds
          Length = 1325

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 65/71 (91%), Gaps = 1/71 (1%)
 Strand = Plus / Minus

                                                                       
Query: 349 ttgttgtagatgacggcggcccc-aggctcctggccgggttgatgccggtgccggtgatc 407
           |||| |||||||| |||||| || ||||||||||| ||||||||||||||||||||||| 
Sbjct: 968 ttgtcgtagatgatggcggcgccgaggctcctggcggggttgatgccggtgccggtgatg 909

                      
Query: 408 gggatggtggc 418
           |||||||||||
Sbjct: 908 gggatggtggc 898



to top

>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 125/151 (82%), Gaps = 1/151 (0%)
 Strand = Plus / Minus

                                                                       
Query: 273 gtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatc 332
           ||||||||  ||||| | |||||||||||| |  || || |||||||||||||| || ||
Sbjct: 914 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 855

                                                                       
Query: 333 atcccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttgat 391
            ||||| ||||  | |||||||||||||| |||||| || |||  ||| |||||||||||
Sbjct: 854 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 795

                                          
Query: 392 gccggtgccggtgatcgggatggtggccagg 422
           ||||||||| ||||| ||||| || ||||||
Sbjct: 794 gccggtgcccgtgatggggatcgtcgccagg 764



to top

>emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019D11,
              complete sequence
          Length = 163039

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 80/91 (87%), Gaps = 1/91 (1%)
 Strand = Plus / Minus

                                                                          
Query: 331    tcatcccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttg 389
              |||| ||| ||||||| || ||||||||| || || || |||| |||||| |||||||||
Sbjct: 108565 tcatgccatgccttgtgctggttgtagatcaccgcagctcccaagctccttgccgggttg 108506

                                             
Query: 390    atgccggtgccggtgatcgggatggtggcca 420
              ||||||||||||||||||||||| |||||||
Sbjct: 108505 atgccggtgccggtgatcgggatcgtggcca 108475



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                          
Query: 249    ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 308
              ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||| | |||
Sbjct: 109156 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 109097

                                  
Query: 309    gccgacccagaagatccact 328
               || ||||||||||||||||
Sbjct: 109096 ccccacccagaagatccact 109077



to top

>emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0093G06,
             complete sequence
          Length = 127420

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 79/90 (87%), Gaps = 1/90 (1%)
 Strand = Plus / Plus

                                                                         
Query: 334   tcccaggccttgtccttgttgtagatgacggcggcccc-aggctcctggccgggttgatg 392
             ||||| ||||| | || |||||||||||||||||| || | ||||| ||| |||||||||
Sbjct: 91210 tcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagggttgatg 91269

                                           
Query: 393   ccggtgccggtgatcgggatggtggccagg 422
             || ||||||||||| |||||||||||||||
Sbjct: 91270 cccgtgccggtgatggggatggtggccagg 91299



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 219   gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 275
             |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 91012 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 91068



to top

>emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB75ZE10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1128

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 85/98 (86%), Gaps = 1/98 (1%)
 Strand = Plus / Minus

                                                                       
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc- 368
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 819 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 760

                                                 
Query: 369 cccaggctcctggccgggttgatgccggtgccggtgat 406
           || |  ||||| |||||||| || |||||||| |||||
Sbjct: 759 ccaaaactcctagccgggtttattccggtgccagtgat 722



to top

>gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, complete cds
          Length = 901

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 85/98 (86%), Gaps = 1/98 (1%)
 Strand = Plus / Minus

                                                                       
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc- 368
           ||||||||||| ||||| || ||||||||||||||||| ||||| |||||||| || || 
Sbjct: 771 ccgacccagaacatccaatggtcatcccaggccttgtcgttgttatagatgacagcagct 712

                                                 
Query: 369 cccaggctcctggccgggttgatgccggtgccggtgat 406
           || | ||| || ||||||||||| ||||||||||||||
Sbjct: 711 ccgaagcttctagccgggttgataccggtgccggtgat 674



to top

>gb|AY170841.1| Axonopus compressus plasma membrane MIP protein mRNA, partial cds
          Length = 423

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 124/150 (82%), Gaps = 1/150 (0%)
 Strand = Plus / Minus

                                                                       
Query: 270 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
           ||||||||||| ||| || |  || ||||| || | ||||||||||||||||||||| ||
Sbjct: 384 ctggtggtagatggcggctagggcagcgccaatgaaggggccgacccagaagatccaatg 325

                                                                       
Query: 330 atcatcccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggtt 388
            |||| |||||| |  ||| |||||||||||| ||| || || |||||||| || |||||
Sbjct: 324 gtcattccaggcgtgctccctgttgtagatgatggcagcgccaaggctcctagctgggtt 265

                                         
Query: 389 gatgccggtgccggtgatcgggatggtggc 418
           |||||| ||||| || || |||||||||||
Sbjct: 264 gatgccagtgccagtaatggggatggtggc 235



to top

>emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.4 gene)
          Length = 1135

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc-ccc 371
           |||||||||||||| || |  |||||||||||||| | ||||||||| || ||||| |||
Sbjct: 771 acccagaagatccagtggtggtcccaggccttgtcttggttgtagataacagcggctccc 712

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           || ||||| || ||||||||||| || || ||||| |||||||||||||
Sbjct: 711 agactcctagcagggttgatgccagttccagtgatggggatggtggcca 663



to top

>gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water channel protein MipH (MipH)
           mRNA, complete cds
          Length = 1347

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 129/157 (82%), Gaps = 1/157 (0%)
 Strand = Plus / Minus

                                                                       
Query: 265 atgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatc 324
           ||||| |||||||||| ||| ||||| || || || || |  || ||||||||||| |||
Sbjct: 890 atgtattggtggtagatggcggcgatggcagccccaatgaacggtccgacccagaaaatc 831

                                                                       
Query: 325 cactgatcatcccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggcc 383
           ||||||||||||||||||||||  ||||||||||| || || || || || || |  || 
Sbjct: 830 cactgatcatcccaggccttgttgttgttgtagatcacagcagcaccaagactacgagca 771

                                                
Query: 384 gggttgatgccggtgccggtgatcgggatggtggcca 420
           |||||||| || |||||||| || |||||||||||||
Sbjct: 770 gggttgatacctgtgccggtaattgggatggtggcca 734



to top

>gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, complete cds
          Length = 1201

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||||||||| || ||||||||||| || |  | |||| |||| || || || || 
Sbjct: 814 acccagaagatccaatggtcatcccaggctttctgttggttgaagataacagcagctccg 755

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           || |||||||||||||||||||||||||||||||  |||||||||||||
Sbjct: 754 agactcctggccgggttgatgccggtgccggtgactgggatggtggcca 706



to top

>dbj|AB002149.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1064

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccca 372
           |||||||||||||| ||||||||||| |||| ||| | |||| ||||||  || || |||
Sbjct: 815 acccagaagatccagtgatcatcccatgcctggtcgtggttgaagatgatagcagctcca 756

                                                            
Query: 373 -ggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
            |||||| ||| |||||||||||||| || ||||| |||||||||||||
Sbjct: 755 aggctccgggcggggttgatgccggttccagtgatagggatggtggcca 707



to top

>ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channel AT2G39010
           (PIP2;6/PIP2E) mRNA, complete cds
          Length = 1245

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                   
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 365
           ||||||||||||||||||||||||||||| ||||| |  |||||||||||||||||
Sbjct: 845 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggc 790



to top

>gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 1201

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                   
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 365
           ||||||||||||||||||||||||||||| ||||| |  |||||||||||||||||
Sbjct: 840 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggc 785



to top

>gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 870

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                   
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 365
           ||||||||||||||||||||||||||||| ||||| |  |||||||||||||||||
Sbjct: 758 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggc 703



to top

>gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds
          Length = 740

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 92/108 (85%), Gaps = 1/108 (0%)
 Strand = Plus / Minus

                                                                       
Query: 314 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc-ccca 372
           ||||||| ||||||||||||||||| | ||| |  ||||||||||| || ||||| ||||
Sbjct: 481 cccagaaaatccactgatcatcccatgtcttttttttgttgtagatcacagcggctccca 422

                                                           
Query: 373 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
            ||| | ||||||||| ||||| || |||||||||||||| |||||||
Sbjct: 421 agctacgggccgggttaatgccagttccggtgatcgggatcgtggcca 374



to top

>gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 1169

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                   
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 365
           ||||||||||||||||||||||||||||| ||||| |  |||||||||||||||||
Sbjct: 842 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggc 787



to top

>emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS74ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1160

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                   
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 365
           ||||||||||||||||||||||||||||| ||||| |  |||||||||||||||||
Sbjct: 829 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggc 774



to top

>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 59/64 (92%), Gaps = 1/64 (1%)
 Strand = Plus / Minus

                                                                       
Query: 350 tgttgtagatgacggcggc-cccaggctcctggccgggttgatgccggtgccggtgatcg 408
           |||||||||||| ||| || ||||||||||| || |||||||||||||||||||||||||
Sbjct: 830 tgttgtagatgatggcagctcccaggctccttgcagggttgatgccggtgccggtgatcg 771

               
Query: 409 ggat 412
           ||||
Sbjct: 770 ggat 767



to top

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 124/151 (82%), Gaps = 1/151 (0%)
 Strand = Plus / Minus

                                                                       
Query: 273 gtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatc 332
           |||||||| |||||| | |||||| ||||| |  || || |||||||||||||| || ||
Sbjct: 899 gtggtagatggccgccagcgccgcaccgatgaacggaccaacccagaagatccagtggtc 840

                                                                       
Query: 333 atcccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttgat 391
            ||||| ||||  | |||||||||||||| |||||| || |||  ||| |||||||||||
Sbjct: 839 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 780

                                          
Query: 392 gccggtgccggtgatcgggatggtggccagg 422
           |||||| || ||||| ||||| || ||||||
Sbjct: 779 gccggtccccgtgatggggatcgtcgccagg 749



to top

>dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membrane intrinsic protein
           2-2, complete cds
          Length = 1051

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 124/151 (82%), Gaps = 1/151 (0%)
 Strand = Plus / Minus

                                                                       
Query: 271 tggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactga 330
           |||||||||||||| || || || || || || | ||| || |||||||| ||||| || 
Sbjct: 874 tggtggtagaaggctgcaattgctgctccaatgaagggtcctacccagaaaatccattgg 815

                                                                       
Query: 331 tcatcccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttg 389
           |||||||| |||||||| ||||||||||| || || || || || || || || ||||||
Sbjct: 814 tcatcccaagccttgtctttgttgtagataacagcagctccaagacttctagcggggttg 755

                                          
Query: 390 atgccggtgccggtgatcgggatggtggcca 420
           ||||| ||||| ||||| |||||||||||||
Sbjct: 754 atgccagtgccagtgattgggatggtggcca 724



to top

>gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence
          Length = 1154

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 123/150 (82%), Gaps = 1/150 (0%)
 Strand = Plus / Minus

                                                                       
Query: 270 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||| ||
Sbjct: 790 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 731

                                                                       
Query: 330 atcatcccaggccttgtccttgttgtagatgacggcggcccca-ggctcctggccgggtt 388
            ||   ||| || |  |||  ||||||||||| |||||| ||| |||||||    |||||
Sbjct: 730 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctaaaggggtt 671

                                         
Query: 389 gatgccggtgccggtgatcgggatggtggc 418
           |||||||||||||||||| |||||||||||
Sbjct: 670 gatgccggtgccggtgatggggatggtggc 641



to top

>emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.5 gene)
          Length = 1094

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 96/114 (84%), Gaps = 1/114 (0%)
 Strand = Plus / Minus

                                                                       
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc- 368
           ||||||||||||||||| || |||||||| |||||||| | |||||| || || || || 
Sbjct: 809 ccgacccagaagatccaatggtcatcccatgccttgtcttcgttgtatatcacagcagct 750

                                                                 
Query: 369 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
           || | |||||| ||||||||||| || || |||||||| ||||| |||||||||
Sbjct: 749 ccaaagctcctagccgggttgataccagttccggtgattgggatagtggccagg 696



to top

>gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1a) mRNA, complete cds
          Length = 1129

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 93/110 (84%), Gaps = 1/110 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||| ||||||   ||||||||||| |  ||  |||||||||||| ||||||||| 
Sbjct: 833 acccagaaaatccacatgtcatcccaggcatgctctctgttgtagatgatggcggccccc 774

                                                             
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 421
           || ||||| || |||||||||||||| |||||||| |||||||| |||||
Sbjct: 773 agactcctagcagggttgatgccggttccggtgatggggatggttgccag 724



to top

>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds
          Length = 1280

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 96/114 (84%), Gaps = 1/114 (0%)
 Strand = Plus / Minus

                                                                       
Query: 306 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 365
           ||||||||||||||||||||| || || | |||||| |  ||| |||||||||||| |||
Sbjct: 855 ggggccgacccagaagatccaatggtcgttccaggcgtgatccctgttgtagatgatggc 796

                                                                 
Query: 366 ggc-cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 418
            || || |||||||| || ||||||||||| ||||| || || |||||||||||
Sbjct: 795 agcgccaaggctcctagctgggttgatgccagtgccagtaatggggatggtggc 742



to top

>gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1086

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 92/109 (84%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccca 372
           |||||||| ||||| || |||||||| |||| ||| |||||||||||||  || || |||
Sbjct: 815 acccagaaaatccagtggtcatcccatgcctcgtctttgttgtagatgatagcagctcca 756

                                                            
Query: 373 gg-ctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
            | |||||||| |||||||| || || |||||||| |||||||||||||
Sbjct: 755 agactcctggcagggttgataccagttccggtgattgggatggtggcca 707



to top

>gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 genomic sequence, complete
             sequence
          Length = 178692

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 62/69 (89%), Gaps = 1/69 (1%)
 Strand = Plus / Plus

                                                                         
Query: 351   gttgtagatgacggcggcccc-aggctcctggccgggttgatgccggtgccggtgatcgg 409
             |||||||| ||||||||| || | |||||| ||||| |||||||| ||||||||||||||
Sbjct: 47653 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 47712

                      
Query: 410   gatggtggc 418
             |||||||||
Sbjct: 47713 gatggtggc 47721



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 62/69 (89%), Gaps = 1/69 (1%)
 Strand = Plus / Minus

                                                                            
Query: 351      gttgtagatgacggcggcccc-aggctcctggccgggttgatgccggtgccggtgatcgg 409
                |||||||| ||||||||| || | |||||| ||||| |||||||| ||||||||||||||
Sbjct: 17626978 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 17626919

                         
Query: 410      gatggtggc 418
                |||||||||
Sbjct: 17626918 gatggtggc 17626910



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 278      agaaggccgcgatcgccgcg 297
                ||||||||||||||||||||
Sbjct: 13136748 agaaggccgcgatcgccgcg 13136767



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 62/69 (89%), Gaps = 1/69 (1%)
 Strand = Plus / Minus

                                                                            
Query: 351      gttgtagatgacggcggcccc-aggctcctggccgggttgatgccggtgccggtgatcgg 409
                |||||||| ||||||||| || | |||||| ||||| |||||||| ||||||||||||||
Sbjct: 17636018 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 17635959

                         
Query: 410      gatggtggc 418
                |||||||||
Sbjct: 17635958 gatggtggc 17635950



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 278      agaaggccgcgatcgccgcg 297
                ||||||||||||||||||||
Sbjct: 13144088 agaaggccgcgatcgccgcg 13144107



to top

>gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1153

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 92/109 (84%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccca 372
           |||||||||||||| || |||| ||| |||| ||| |||||||||||||  || || |||
Sbjct: 825 acccagaagatccagtggtcattccatgcctcgtctttgttgtagatgatagcagctcca 766

                                                            
Query: 373 gg-ctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
            | |||||||| |||||||| || || |||||||| |||||||||||||
Sbjct: 765 agactcctggcagggttgataccagttccggtgattgggatggtggcca 717



to top

>gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel protein MipC mRNA,
           complete cds
          Length = 1066

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 92/109 (84%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||| ||||| ||||||||||||||||| |  | ||||||||| ||||| || || 
Sbjct: 838 acccagaaaatccaatgatcatcccaggccttctgttggttgtagatcacggcagctccg 779

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |  || || || ||||||||||| ||||||||||| |||||||||||||
Sbjct: 778 aaacttctagctgggttgatgccagtgccggtgattgggatggtggcca 730



to top

>gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA
          Length = 582

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 92/109 (84%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||| ||||| ||||||||||||||||| |  | ||||||||| ||||| || || 
Sbjct: 354 acccagaaaatccaatgatcatcccaggccttctgttggttgtagatcacggcagctccg 295

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |  || || || ||||||||||| ||||||||||| |||||||||||||
Sbjct: 294 aaacttctagctgggttgatgccagtgccggtgattgggatggtggcca 246



to top

>ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channel AT4G23400
           (PIP1;5/PIP1D) mRNA, complete cds
          Length = 1128

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 94/112 (83%), Gaps = 1/112 (0%)
 Strand = Plus / Minus

                                                                       
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc- 368
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 834 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 775

                                                               
Query: 369 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           || || |||||||||||||| ||||| || || || || |||||||| ||||
Sbjct: 774 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagcca 723



to top

>gb|AY081593.1| Arabidopsis thaliana water channel-like protein (At4g23400) mRNA,
           complete cds
          Length = 956

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 94/112 (83%), Gaps = 1/112 (0%)
 Strand = Plus / Minus

                                                                       
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc- 368
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 785 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 726

                                                               
Query: 369 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           || || |||||||||||||| ||||| || || || || |||||||| ||||
Sbjct: 725 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagcca 674



to top

>gb|AY059948.1| Arabidopsis thaliana water channel - like protein (At4g23400;
           F16G20.100) mRNA, complete cds
          Length = 1125

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 94/112 (83%), Gaps = 1/112 (0%)
 Strand = Plus / Minus

                                                                       
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc- 368
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 834 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 775

                                                               
Query: 369 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           || || |||||||||||||| ||||| || || || || |||||||| ||||
Sbjct: 774 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagcca 723



to top

>emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB41ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 454

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 94/112 (83%), Gaps = 1/112 (0%)
 Strand = Plus / Minus

                                                                       
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc- 368
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 158 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 99

                                                               
Query: 369 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           || || |||||||||||||| ||||| || || || || |||||||| ||||
Sbjct: 98  ccgagactcctggccgggttaatgccagttccagtaattgggatggtagcca 47



to top

>emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB51ZF11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 710

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 94/112 (83%), Gaps = 1/112 (0%)
 Strand = Plus / Minus

                                                                       
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc- 368
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 417 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 358

                                                               
Query: 369 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           || || |||||||||||||| ||||| || || || || |||||||| ||||
Sbjct: 357 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagcca 306



to top

>emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS16ZB08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1066

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 94/112 (83%), Gaps = 1/112 (0%)
 Strand = Plus / Minus

                                                                       
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc- 368
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 823 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 764

                                                               
Query: 369 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           || || |||||||||||||| ||||| || || || || |||||||| ||||
Sbjct: 763 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagcca 712



to top

>emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS21ZB06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 94/112 (83%), Gaps = 1/112 (0%)
 Strand = Plus / Minus

                                                                       
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc- 368
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 798 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 739

                                                               
Query: 369 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           || || |||||||||||||| ||||| || || || || |||||||| ||||
Sbjct: 738 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagcca 687



to top

>gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete sequence
          Length = 1089

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 94/112 (83%), Gaps = 1/112 (0%)
 Strand = Plus / Minus

                                                                       
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc- 368
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 832 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 773

                                                               
Query: 369 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           || || |||||||||||||| ||||| || || || || |||||||| ||||
Sbjct: 772 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagcca 721



to top

>gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (pip2) mRNA,
           complete cds
          Length = 1260

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 90/107 (84%), Gaps = 1/107 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccca 372
           ||||| || ||||| || |||||||||| |||||| | |||||||||||| || || |||
Sbjct: 843 acccaaaaaatccaatggtcatcccagggcttgtcttcgttgtagatgacagcagctcca 784

                                                          
Query: 373 g-gctcctggccgggttgatgccggtgccggtgatcgggatggtggc 418
             |||||| || ||||||||||| || |||||||| |||||||||||
Sbjct: 783 aagctcctagcagggttgatgccagttccggtgatggggatggtggc 737



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 241 gccttgatggcgccggccctgagtatgtactggtggtaga 280
           ||||||||||| || ||||| || ||||| ||||||||||
Sbjct: 915 gccttgatggctcctgcccttaggatgtattggtggtaga 876



to top

>gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-2
           (PIP1-2) mRNA, complete cds
          Length = 1154

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 92/110 (83%), Gaps = 1/110 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||| ||||||   ||||||||||| |  || |||||||||| || ||||||||| 
Sbjct: 841 acccagaaaatccacatgtcatcccaggcatgctctttgttgtagacgatggcggccccc 782

                                                             
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 421
           || ||||| || |||||||||||||| || ||||| |||||||| |||||
Sbjct: 781 agactcctagcagggttgatgccggttccagtgatggggatggttgccag 732



to top

>dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - like protein, partial
           cds, clone: RAFL24-17-A12
          Length = 392

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 74/86 (86%), Gaps = 1/86 (1%)
 Strand = Plus / Minus

                                                                       
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc- 368
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 90  ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 31

                                     
Query: 369 cccaggctcctggccgggttgatgcc 394
           || || |||||||||||||| |||||
Sbjct: 30  ccgagactcctggccgggttaatgcc 5



to top

>gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, complete cds
          Length = 1192

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 95/114 (83%), Gaps = 1/114 (0%)
 Strand = Plus / Minus

                                                                       
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 369
           |||||||| || ||||| |||||||||||||||||    ||||||||||| || || || 
Sbjct: 816 ccgacccaaaatatccattgatcatcccaggccttagaattgttgtagataaccgcagct 757

                                                                 
Query: 370 cc-aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
           || | ||| || || |||||||| |||||||| ||||| |||||||||||||||
Sbjct: 756 ccgaagcttctagcggggttgattccggtgcctgtgattgggatggtggccagg 703



to top

>gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein (Mip1) mRNA, partial cds
          Length = 539

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 95/114 (83%), Gaps = 1/114 (0%)
 Strand = Plus / Minus

                                                                       
Query: 306 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 365
           ||||||||||||||||||||| || ||   |||||| |  ||| |||||||||||| |||
Sbjct: 280 ggggccgacccagaagatccaatggtcgctccaggcatgatccctgttgtagatgatggc 221

                                                                 
Query: 366 ggcccca-ggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 418
            || ||| ||||||| || ||||||||||| ||||| || || |||||||||||
Sbjct: 220 agcgccaaggctcctagctgggttgatgccagtgccagtaatggggatggtggc 167



to top

>ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G37170 (PIP2B) mRNA,
           complete cds
          Length = 1143

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 91/109 (83%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 815 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 756

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||
Sbjct: 755 aaactcctagccgggttgatgccggttccggtgatcggaatagtggcca 707



to top

>gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (pip1) mRNA,
           complete cds
          Length = 1152

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 361
           |||||||| ||||| ||||||||||| |||||||| |||||||||||||
Sbjct: 799 acccagaatatccagtgatcatcccatgccttgtctttgttgtagatga 751



to top

>emb|AJ249384.1|SOL249384 Spinacia oleracea mRNA for PM28B protein (pm28b gene)
          Length = 913

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 91/109 (83%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc-ccc 371
           |||||||| ||||| |||| |||||| || | |||||||||| |||| |  || || |||
Sbjct: 809 acccagaaaatccaatgatgatcccaagcatggtccttgttgaagataatagcagcaccc 750

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           || |||||||| |||||||| ||||| || ||||| |||||||||||||
Sbjct: 749 agactcctggctgggttgattccggtacctgtgatggggatggtggcca 701



to top

>gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic protein 1-like
           protein mRNA, partial cds
          Length = 474

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           ||||||||||| ||||||||||| ||||||||||| || ||||||||||
Sbjct: 380 aggctcctggcagggttgatgccagtgccggtgataggtatggtggcca 332



to top

>emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.3 gene)
          Length = 1187

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 91/109 (83%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc-ccc 371
           |||||||| ||||| || |||||||| ||||| |||||||||||||| || || || || 
Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagatcaccgcagctccg 741

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           | |||||| || |||||||| || || |||||||| || ||||||||||
Sbjct: 740 aagctcctagcagggttgataccagtaccggtgattggaatggtggcca 692



to top

>emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.2 gene)
          Length = 978

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 91/109 (83%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc-ccc 371
           |||||||| ||||| |||||||||||||| || || |||||| ||||||| || || || 
Sbjct: 826 acccagaaaatccaatgatcatcccaggctttttcattgttgaagatgacagcagcgcca 767

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           | ||||||||| ||||||||||| || || || || ||||| |||||||
Sbjct: 766 aagctcctggcagggttgatgccagttccagttatagggattgtggcca 718



to top

>emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides mRNA for major intrinsic
           protein 1 (mip1 gene)
          Length = 1187

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 91/109 (83%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc-ccc 371
           |||||||| ||||| || |||||||| ||||| |||||||||||||| || || || || 
Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagatcaccgcagctccg 741

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           | |||||| || |||||||| || || |||||||| || ||||||||||
Sbjct: 740 aagctcctagcagggttgataccagtaccggtgattggaatggtggcca 692



to top

>emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB17ZB02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1041

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 91/109 (83%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||
Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggcca 692



to top

>emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH65ZF08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1079

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 91/109 (83%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||
Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggcca 692



to top

>emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZA12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 91/109 (83%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 791 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 732

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||
Sbjct: 731 aaactcctagccgggttgatgccggttccggtgatcggaatagtggcca 683



to top

>emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH49ZD05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1074

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 91/109 (83%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||
Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggcca 692



to top

>emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH47ZD11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1095

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 91/109 (83%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||
Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggcca 692



to top

>emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS38ZC08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 821

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 91/109 (83%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 492 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 433

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||
Sbjct: 432 aaactcctagccgggttgatgccggttccggtgatcggaatagtggcca 384



to top

>emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH30ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1083

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 91/109 (83%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 801 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 742

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||
Sbjct: 741 aaactcctagccgggttgatgccggttccggtgatcggaatagtggcca 693



to top

>gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete sequence
          Length = 1104

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 91/109 (83%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 816 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 757

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||
Sbjct: 756 aaactcctagccgggttgatgccggttccggtgatcggaatagtggcca 708



to top

>dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1223

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 91/109 (83%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||| ||||| || ||||||||||| |    |||||||||||||| ||| || || 
Sbjct: 874 acccagaatatccagtggtcatcccaggcatgccgcttgttgtagatgatggcagcgccg 815

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           || |||||||| ||||||||||| || |||||||  |||||||||||||
Sbjct: 814 agactcctggctgggttgatgccagttccggtgacggggatggtggcca 766



to top

>gb|U62280.1|NTU62280 Nicotiana tabacum aquaporin (NT2) mRNA, complete cds
          Length = 1049

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 91/109 (83%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccca 372
           |||||||||||||| ||||||||||| |||  ||| | |||| ||||||  || || |||
Sbjct: 797 acccagaagatccagtgatcatcccatgcccggtcttggttgaagatgatagcagctcca 738

                                                            
Query: 373 -ggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
            |||||| ||| ||| |||| ||||| |||||||| |||||||||||||
Sbjct: 737 aggctccgggcgggggtgataccggttccggtgattgggatggtggcca 689



to top

>dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membrane intrinsic protein
            1-1, complete cds
          Length = 1351

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 91/109 (83%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                        
Query: 313  acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccca 372
            |||||||| | ||| || ||||||||||| |  | |||||||||||||| ||| || |||
Sbjct: 1015 acccagaaaacccagtggtcatcccaggcatgctgcttgttgtagatgatggcagcgcca 956

                                                             
Query: 373  gg-ctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
             | |||||||| ||||||||||| || |||||||  |||||||||||||
Sbjct: 955  agactcctggctgggttgatgccagttccggtgacggggatggtggcca 907



to top

>emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein
          Length = 1179

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 66/76 (86%), Gaps = 1/76 (1%)
 Strand = Plus / Minus

                                                                       
Query: 347 ccttgttgtagatgacggcggccccaggctcctggccgggttgatgccggtgccggtgat 406
           ||||||||||||||| ||| |||||| | || | |  |||||||| ||||||||||||||
Sbjct: 814 ccttgttgtagatgatggcagccccaagttcttcgt-gggttgattccggtgccggtgat 756

                           
Query: 407 cgggatggtggccagg 422
            |||||||||||||||
Sbjct: 755 ggggatggtggccagg 740



to top

>emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.1 gene)
          Length = 943

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 306 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 361
           |||||| |||||||| ||||| ||||||||||||||  ||||||||||| ||||||
Sbjct: 883 ggggccaacccagaaaatccagtgatcatcccaggcgctgtccttgttgaagatga 828



to top

>gb|AF290620.1|AF290620 Nicotiana glauca putative PIP2 (MIP4) mRNA, complete cds
          Length = 1108

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 375 ctcctggccgggttgatgccggtgccggtgatcgggatggtggc 418
           ||||| ||||||||||| ||||||||||||||||| ||||||||
Sbjct: 717 ctcctagccgggttgattccggtgccggtgatcggaatggtggc 674



to top

>gb|AY671950.1| Aegiceras corniculatum aquaporin 2 (PIP2) mRNA, complete cds
          Length = 855

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 90/108 (83%), Gaps = 1/108 (0%)
 Strand = Plus / Minus

                                                                       
Query: 314 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc-ccca 372
           ||||||| ||||||||||||||||| | ||| |  |||  |||||| || ||||| ||||
Sbjct: 754 cccagaaaatccactgatcatcccatgtcttttttttgccgtagatcacagcggctccca 695

                                                           
Query: 373 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
            ||| | ||||||||| ||||| || |||||||||||||| |||||||
Sbjct: 694 agctacgggccgggttaatgccagttccggtgatcgggatcgtggcca 647



to top

>gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1179

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 66/76 (86%), Gaps = 1/76 (1%)
 Strand = Plus / Minus

                                                                       
Query: 347 ccttgttgtagatgacggcggccccaggctcctggccgggttgatgccggtgccggtgat 406
           ||||||||||||||| ||| |||||| | || | |  |||||||| ||||||||||||||
Sbjct: 814 ccttgttgtagatgatggcagccccaagttcttcgt-gggttgattccggtgccggtgat 756

                           
Query: 407 cgggatggtggccagg 422
            |||||||||||||||
Sbjct: 755 ggggatggtggccagg 740



to top

>ref|XM_468463.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1319

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 384 gggttgatgccggtgccggtgatcgggatggtggc 418
           ||||||||||||||||||||||| |||||||||||
Sbjct: 865 gggttgatgccggtgccggtgatggggatggtggc 831



to top

>emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.2 gene)
          Length = 1124

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 95/115 (82%), Gaps = 1/115 (0%)
 Strand = Plus / Minus

                                                                       
Query: 307 gggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcg 366
           ||||| |||||||||||||| || |||||||| || | ||| |||||| |||||| ||||
Sbjct: 866 gggccaacccagaagatccagtggtcatcccatgcatggtctttgttgaagatgatggcg 807

                                                                  
Query: 367 gc-cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           || || || ||||| |||||||| ||||| || || || || |||||||| ||||
Sbjct: 806 gctccaagactccttgccgggttaatgccagttccagttatggggatggtagcca 752



to top

>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene)
          Length = 1364

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 384 gggttgatgccggtgccggtgatcgggatggtggccagg 422
           ||||||||||||||||||||||| |||||||| ||||||
Sbjct: 794 gggttgatgccggtgccggtgatggggatggtcgccagg 756



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                                   
Query: 372      aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
                |||||||| |||||||||||||| |||||||||||||| || || ||||||
Sbjct: 21009476 aggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgccagg 21009426



to top

>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete
           cds
          Length = 1338

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 384 gggttgatgccggtgccggtgatcgggatggtggccagg 422
           ||||||||||||||||||||||| |||||||| ||||||
Sbjct: 785 gggttgatgccggtgccggtgatggggatggtcgccagg 747



to top

>dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:B1274F11
          Length = 171257

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                                 
Query: 372    aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
              |||||||| |||||||||||||| |||||||||||||| || || ||||||
Sbjct: 101565 aggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgccagg 101515



to top

>dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1136_C04
          Length = 103194

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                                
Query: 384   gggttgatgccggtgccggtgatcgggatggtggc 418
             ||||||||||||||||||||||| |||||||||||
Sbjct: 29575 gggttgatgccggtgccggtgatggggatggtggc 29541



to top

>dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-H08, full
           insert sequence
          Length = 1247

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
           |||||||| |||||||||||||| |||||||||||||| || || ||||||
Sbjct: 738 aggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgccagg 688



to top

>dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-G06, full
           insert sequence
          Length = 1066

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
           |||||||| |||||||||||||| |||||||||||||| || || ||||||
Sbjct: 636 aggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgccagg 586



to top

>dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D11, full
           insert sequence
          Length = 1249

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
           |||||||| |||||||||||||| |||||||||||||| || || ||||||
Sbjct: 736 aggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgccagg 686



to top

>dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086K14, full
           insert sequence
          Length = 1318

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 384 gggttgatgccggtgccggtgatcgggatggtggc 418
           ||||||||||||||||||||||| |||||||||||
Sbjct: 864 gggttgatgccggtgccggtgatggggatggtggc 830



to top

>dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013118N06, full
           insert sequence
          Length = 1302

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
           |||||||| |||||||||||||| |||||||||||||| || || ||||||
Sbjct: 731 aggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgccagg 681



to top

>gb|AY107675.1| Zea mays PCO112712 mRNA sequence
          Length = 791

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 384 gggttgatgccggtgccggtgatcgggatggtggccagg 422
           ||||||||||||||||||||||| |||||||| ||||||
Sbjct: 218 gggttgatgccggtgccggtgatggggatggtcgccagg 180



to top

>dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone: P0478E02
          Length = 140715

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                                
Query: 372   aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccagg 422
             |||||||| |||||||||||||| |||||||||||||| || || ||||||
Sbjct: 30776 aggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgccagg 30726



to top

>dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3, promoter region and
            complete cds
          Length = 5325

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 384  gggttgatgccggtgccggtgatcgggatggtggc 418
            ||||||||||||||||||||||| |||||||||||
Sbjct: 4529 gggttgatgccggtgccggtgatggggatggtggc 4495



to top

>dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds
          Length = 1403

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 384 gggttgatgccggtgccggtgatcgggatggtggc 418
           ||||||||||||||||||||||| |||||||||||
Sbjct: 842 gggttgatgccggtgccggtgatggggatggtggc 808



to top

>dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membrane intrinsic protein
           2-1, complete cds
          Length = 1311

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 115/143 (80%)
 Strand = Plus / Minus

                                                                       
Query: 220 ttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtag 279
           ||||| ||||| || || || ||||||||||| || || || || ||||| |||||||||
Sbjct: 907 ttgcttctgaaagatcccagagccttgatggctcctgctctcagaatgtattggtggtag 848

                                                                       
Query: 280 aaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccag 339
           ||||| || || || || || || |  || || | |||||||||||| || |||||||| 
Sbjct: 847 aaggcagcaatggcagctccaatgaaaggtccaagccagaagatccattggtcatcccaa 788

                                  
Query: 340 gccttgtccttgttgtagatgac 362
           || ||||||||||| ||||||||
Sbjct: 787 gctttgtccttgttatagatgac 765



to top

>gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic protein 2-like mRNA,
           complete cds
          Length = 1277

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 91/110 (82%), Gaps = 1/110 (0%)
 Strand = Plus / Minus

                                                                       
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 369
           ||||||||||| ||||| || |||||||| ||||||||   |||| | || ||||| |||
Sbjct: 828 ccgacccagaaaatccagtgttcatcccacgccttgtcgccgttgaaaatcacggccgcc 769

                                                             
Query: 370 cc-aggctcctggccgggttgatgccggtgccggtgatcgggatggtggc 418
           || |  ||||| ||||||||||| ||||| ||||||||||| || |||||
Sbjct: 768 ccgaaactcctcgccgggttgattccggtaccggtgatcggaatagtggc 719



to top

>gb|DQ228343.1| Solanum tuberosum clone 148A12 unknown mRNA
          Length = 1082

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 375 ctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |||||||| ||||||||||| || |||||||| |||||||||||||
Sbjct: 775 ctcctggcggggttgatgccagttccggtgatggggatggtggcca 730



to top

>gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence
          Length = 1159

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 375 ctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |||||||| ||||||||||| || |||||||| |||||||||||||
Sbjct: 791 ctcctggcggggttgatgccagttccggtgatggggatggtggcca 746



to top

>emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrinsic protein 2b
          Length = 1095

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 375 ctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           ||||| ||||||||||||||||| ||||||||||| || |||||||
Sbjct: 704 ctcctagccgggttgatgccggttccggtgatcggaatagtggcca 659



to top

>emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening membrane protein, clone
           pNY507
          Length = 1107

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 375 ctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |||||||| ||||||||||| || |||||||| |||||||||||||
Sbjct: 731 ctcctggcggggttgatgccagttccggtgatggggatggtggcca 686



to top

>emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening membrane protein, clone
           pTOM75
          Length = 859

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 375 ctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |||||||| ||||||||||| || |||||||| |||||||||||||
Sbjct: 542 ctcctggcggggttgatgccagttccggtgatggggatggtggcca 497



to top

>emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major intrinsic protein PIPc
          Length = 800

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 82/98 (83%), Gaps = 1/98 (1%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||| ||||| || |||||||| || ||  | |||||| |||| |||||||| || 
Sbjct: 501 acccagaaaatccaatggtcatcccaagcttttccgttgttgaagatcacggcggcgccg 442

                                                 
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgg 409
           | |||||| |||||||| || |||||||||||||||||
Sbjct: 441 aagctcctcgccgggttaatcccggtgccggtgatcgg 404



to top

>gb|AC006260.4| Arabidopsis thaliana chromosome 2 clone T2N18 map ve018, complete
             sequence
          Length = 80736

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                           
Query: 375   ctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
             ||||| ||||||||||||||||| ||||||||||| || |||||||
Sbjct: 25068 ctcctagccgggttgatgccggttccggtgatcggaatagtggcca 25023



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                           
Query: 375   ctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
             ||||| ||||||||||| ||||| ||||||||||| || |||||||
Sbjct: 20280 ctcctagccgggttgataccggttccggtgatcggaatagtggcca 20325



to top

>dbj|AB206101.1| Mimosa pudica pip2;3 mRNA for plasma membrane intrinsic protein
           2;3, complete cds
          Length = 1218

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 375 ctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |||||||||||||| |||||||| |||||||  |||||||||||||
Sbjct: 790 ctcctggccgggttaatgccggtaccggtgactgggatggtggcca 745



to top

>gb|U73467.1|MCU73467 Mesembryanthemum crystallinum water channel protein MipE mRNA,
           complete cds
          Length = 1179

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 375 ctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           ||||| || ||||||||||||||||| ||||| |||||||||||||
Sbjct: 808 ctcctagcagggttgatgccggtgccagtgatggggatggtggcca 763



to top

>gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel protein-like mRNA,
           complete cds
          Length = 1172

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 92/110 (83%), Gaps = 2/110 (1%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc-ccc 371
           |||||||||||||| || |||| ||| |||| ||| |||||||||||||  || || || 
Sbjct: 815 acccagaagatccagtggtcattccatgcctcgtctttgttgtagatgatagcagctcca 756

                                                             
Query: 372 aggctcctggc-cgggttgatgccggtgccggtgatcgggatggtggcca 420
           || ||||||||  |||||||| || || |||||||| |||||||||||||
Sbjct: 755 agactcctggcaggggttgataccagttccggtgattgggatggtggcca 706



to top

>gb|U26538.1|MCU26538 Mesembryanthemum crystallinum major intrinsic protein homolog
           (mipE) mRNA, partial cds
          Length = 963

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 375 ctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           ||||| || ||||||||||||||||| ||||| |||||||||||||
Sbjct: 592 ctcctagcagggttgatgccggtgccagtgatggggatggtggcca 547



to top

>ref|NM_129274.2| Arabidopsis thaliana RD28; water channel AT2G37180 (RD28) mRNA,
           complete cds
          Length = 1143

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 90/109 (82%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 819 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 760

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |  ||||| ||||||||||| ||||| ||||||||||| || |||||||
Sbjct: 759 aaactcctagccgggttgataccggttccggtgatcggaatagtggcca 711



to top

>gb|AY096701.1| Arabidopsis thaliana putative aquaporin protein (At2g37180) mRNA,
           complete cds
          Length = 889

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 90/109 (82%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 752 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 693

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |  ||||| ||||||||||| ||||| ||||||||||| || |||||||
Sbjct: 692 aaactcctagccgggttgataccggttccggtgatcggaatagtggcca 644



to top

>gb|AY064029.1| Arabidopsis thaliana putative aquaporin, plasma membrane intrinsic
           protein 2C (At2g37180) mRNA, complete cds
          Length = 1151

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 90/109 (82%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 819 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 760

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |  ||||| ||||||||||| ||||| ||||||||||| || |||||||
Sbjct: 759 aaactcctagccgggttgataccggttccggtgatcggaatagtggcca 711



to top

>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 361
           |||||||||||||| || ||||||||||| | |||| ||||||||||||
Sbjct: 770 acccagaagatccagtggtcatcccaggcgtggtccctgttgtagatga 722



to top

>dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds
          Length = 1278

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 315 ccagaagatccactgatcatcccaggccttgtccttgttgtagat 359
           |||||||||||| || |||||||| || |||||||||||||||||
Sbjct: 768 ccagaagatccattggtcatcccaagctttgtccttgttgtagat 724



to top

>gb|AY084875.1| Arabidopsis thaliana clone 11998 mRNA, complete sequence
          Length = 1060

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 90/109 (82%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 819 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 760

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |  ||||| ||||||||||| ||||| ||||||||||| || |||||||
Sbjct: 759 aaactcctagccgggttgataccggttccggtgatcggaatagtggcca 711



to top

>gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, complete cds
          Length = 1189

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 90/109 (82%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc-ccc 371
           |||||||||||||| ||||||| ||| || |  || ||||||||||||| ||| || || 
Sbjct: 867 acccagaagatccaatgatcattccatgcgtgttcattgttgtagatgatggctgcaccg 808

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           || || | ||||||||| || || |||||||||||||| ||||| ||||
Sbjct: 807 agacttcgggccgggttaatacccgtgccggtgatcggaatggtagcca 759



to top

>dbj|D13254.1|ATHRD28 Arabidopsis thaliana mRNA for putative transmenbrane channel
           protein
          Length = 1121

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 90/109 (82%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 802 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 743

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |  ||||| ||||||||||| ||||| ||||||||||| || |||||||
Sbjct: 742 aaactcctagccgggttgataccggttccggtgatcggaatagtggcca 694



to top

>dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1260

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 90/109 (82%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc-ccc 371
           |||||||| ||||| || ||||||||||| |  | |||||||||||||| ||| || || 
Sbjct: 878 acccagaatatccagtggtcatcccaggcatgcttcttgttgtagatgatggcagcgcca 819

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           || || || || ||||||||||| || |||||||  |||||||||||||
Sbjct: 818 agacttcttgctgggttgatgccagttccggtgacggggatggtggcca 770



to top

>gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, complete cds
          Length = 1298

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 384 gggttgatgccggtgccggtgatcgggatggtggcca 420
           |||||||||||||| |||||||| |||||||||||||
Sbjct: 774 gggttgatgccggttccggtgatggggatggtggcca 738



to top

>gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mipB) mRNA, complete cds
          Length = 1217

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 90/109 (82%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||| ||||| ||||||||||| || | | |||||||| ||||||  || || || 
Sbjct: 805 acccagaaaatccagtgatcatcccaagcgtggcccttgttgaagatgatagcagcaccg 746

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           || ||||| || |||||||||||||| || ||||| |||||||| ||||
Sbjct: 745 agactccttgctgggttgatgccggttccagtgattgggatggttgcca 697



to top

>dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane aquaporin 2c,
           complete cds
          Length = 1065

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 90/109 (82%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccc- 371
           |||||||| ||||| || |||||||| | ||||  || ||||||||| || ||||| || 
Sbjct: 788 acccagaatatccagtggtcatcccacggcttggactcgttgtagataaccgcggctccg 729

                                                            
Query: 372 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           |  |||||||||||||| || ||||| ||||||||||| || |||||||
Sbjct: 728 aaactcctggccgggttaataccggttccggtgatcggaatagtggcca 680



to top

>gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker
          Length = 824

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 270 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||||||
Sbjct: 288 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccactg 347



to top

>gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker
          Length = 763

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                       
Query: 270 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 329
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||||||
Sbjct: 489 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccactg 430



to top

>gb|AF452014.1|AF452014 Petunia x hybrida aquaporin-like protein (PIP2;3) mRNA, complete
           cds
          Length = 1279

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 375 ctcctggccgggttgatgccggtgccggtgatcgggatggtggc 418
           ||||| || |||||||||||||||||||| ||||| ||||||||
Sbjct: 734 ctccttgctgggttgatgccggtgccggtaatcggaatggtggc 691



to top

>ref|XM_470514.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 843

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 384 gggttgatgccggtgccggtgatcgggatggtggc 418
           ||||||||||| ||||||||||| |||||||||||
Sbjct: 656 gggttgatgccagtgccggtgatggggatggtggc 622



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                   
Query: 384      gggttgatgccggtgccggtgatcgggatggtggc 418
                ||||||||||| ||||||||||| |||||||||||
Sbjct: 36057500 gggttgatgccagtgccggtgatggggatggtggc 36057466



to top

>gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genomic sequence, complete
              sequence
          Length = 164179

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                 
Query: 384    gggttgatgccggtgccggtgatcgggatggtggc 418
              ||||||||||| ||||||||||| |||||||||||
Sbjct: 119011 gggttgatgccagtgccggtgatggggatggtggc 118977



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                   
Query: 384      gggttgatgccggtgccggtgatcgggatggtggc 418
                ||||||||||| ||||||||||| |||||||||||
Sbjct: 36147574 gggttgatgccagtgccggtgatggggatggtggc 36147540



to top

>gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, complete cds
          Length = 909

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 359
           |||||||||||||| || |||||||| ||||| || |||||||||||
Sbjct: 740 acccagaagatccaatggtcatcccacgccttctcgttgttgtagat 694



to top

>dbj|AK109024.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-154-B04, full
           insert sequence
          Length = 1099

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 384 gggttgatgccggtgccggtgatcgggatggtggc 418
           ||||||||||| ||||||||||| |||||||||||
Sbjct: 744 gggttgatgccagtgccggtgatggggatggtggc 710



to top

>ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channel AT5G60660
           (PIP2;4/PIP2F) mRNA, complete cds
          Length = 1139

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 99/122 (81%), Gaps = 1/122 (0%)
 Strand = Plus / Minus

                                                                       
Query: 298 ccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtag 357
           |||||||| || || ||||| || ||||| || || ||||||||||| || |||||||| 
Sbjct: 823 ccgatcatcggtccaacccaaaaaatccattggtcgtcccaggccttttcgttgttgtaa 764

                                                                       
Query: 358 atgacggcggccccag-gctcctggccgggttgatgccggtgccggtgatcgggatggtg 416
           || ||||| || |||  ||| |  ||||||||||| ||||| |||||||| || ||||||
Sbjct: 763 ataacggcagctccaaagctacgagccgggttgataccggttccggtgatgggaatggtg 704

             
Query: 417 gc 418
           ||
Sbjct: 703 gc 702



to top

>gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds
          Length = 1248

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 375 ctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
           ||||| || |||||||| ||||||||||| || |||||||||||||
Sbjct: 758 ctcctagcagggttgataccggtgccggtaatggggatggtggcca 713



to top

>gb|AF367460.1| Prunus persica clone Mip3 membrane intrinsic protein (mip3) mRNA,
           partial cds
          Length = 495

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 72/86 (83%), Gaps = 1/86 (1%)
 Strand = Plus / Minus

                                                                       
Query: 334 tcccaggccttgtccttgttgtagatgacggcggc-cccaggctcctggccgggttgatg 392
           |||||||||||||| ||||||||||| || || || || ||||| || || ||||| |||
Sbjct: 485 tcccaggccttgtcattgttgtagatcactgcagctccaaggcttcttgctgggtttatg 426

                                     
Query: 393 ccggtgccggtgatcgggatggtggc 418
           || ||||| ||||| ||||| |||||
Sbjct: 425 ccagtgccagtgattgggattgtggc 400



to top

>gb|U56603.1|BMU56603 Bufo marinus vasopressin-insensitive water channel AQP-t1 mRNA,
           complete cds
          Length = 939

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 298 ccgatcatggggccgacccagaagatccactgat 331
           ||||||||||| ||||||||||||||||| ||||
Sbjct: 761 ccgatcatgggaccgacccagaagatccagtgat 728



to top

>dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane intrinsic protein
           2;4, complete cds
          Length = 1263

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 60/70 (85%), Gaps = 1/70 (1%)
 Strand = Plus / Minus

                                                                       
Query: 349 ttgttgtagatgacggcggccccag-gctcctggccgggttgatgccggtgccggtgatc 407
           |||||||| ||||| || ||||||  |||||||||||||||||| || ||||| ||||| 
Sbjct: 759 ttgttgtacatgactgcagccccaaagctcctggccgggttgataccagtgccagtgatg 700

                     
Query: 408 gggatggtgg 417
           || |||||||
Sbjct: 699 ggaatggtgg 690



to top

>gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete sequence
          Length = 1120

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 99/122 (81%), Gaps = 1/122 (0%)
 Strand = Plus / Minus

                                                                       
Query: 298 ccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtag 357
           |||||||| || || ||||| || ||||| || || ||||||||||| || |||||||| 
Sbjct: 823 ccgatcatcggtccaacccaaaaaatccattggtcgtcccaggccttttcgttgttgtaa 764

                                                                       
Query: 358 atgacggcggccccag-gctcctggccgggttgatgccggtgccggtgatcgggatggtg 416
           || ||||| || |||  ||| |  ||||||||||| ||||| |||||||| || ||||||
Sbjct: 763 ataacggcagctccaaagctacgagccgggttgataccggttccggtgatgggaatggtg 704

             
Query: 417 gc 418
           ||
Sbjct: 703 gc 702



to top

>gb|AF020620.1| Bufo marinus aquaporin-1 homolog (AQP-t1) mRNA, complete cds
          Length = 939

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 298 ccgatcatggggccgacccagaagatccactgat 331
           ||||||||||| ||||||||||||||||| ||||
Sbjct: 761 ccgatcatgggaccgacccagaagatccagtgat 728



to top

>ref|NM_115339.2| Arabidopsis thaliana PIP2;5/PIP2D; water channel AT3G54820
           (PIP2;5/PIP2D) mRNA, complete cds
          Length = 1229

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 361
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 851 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 803



to top

>emb|AJ001416.1|NTAQUAPOR Nicotiana tabacum mRNA for aquaporin 1
          Length = 1204

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 89/109 (81%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccca 372
           ||||| |||||||| || || ||||| |||| |||  ||||||||||||  || || |||
Sbjct: 854 acccaaaagatccagtggtcgtcccatgcctggtctgtgttgtagatgatcgcagctcca 795

                                                            
Query: 373 gg-ctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
            | ||||| || ||||||||||| || |||||||| || ||||||||||
Sbjct: 794 agactcctagcggggttgatgccagttccggtgatgggaatggtggcca 746



to top

>gb|BT000670.1| Arabidopsis thaliana clone RAFL07-09-N03 (R10758) putative
           aquaporin/plasma membrane intrinsic protein (At3g54820)
           mRNA, complete cds
          Length = 1143

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 361
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 771 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 723



to top

>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c
          Length = 986

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 86/105 (81%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc- 368
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||  || || 
Sbjct: 814 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 755

                                                        
Query: 369 cccaggctcctggccgggttgatgccggtgccggtgatcgggatg 413
           || || ||||| || |||||||| || || |||||||| ||||||
Sbjct: 754 ccaagactcctagctgggttgattcctgttccggtgattgggatg 710



to top

>gb|AY062981.1| Arabidopsis thaliana putative aquaporin/MIP protein (At3g54820)
           mRNA, complete cds
          Length = 892

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 361
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 755 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 707



to top

>gb|AF370351.1| Arabidopsis thaliana putative aquaporin/MIP protein (At3g54820)
           mRNA, complete cds
          Length = 1194

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 361
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 850 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 802



to top

>emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative plasma membrane intrinsic
           protein (pip1a gene)
          Length = 1139

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 378 ctggccgggttgatgccggtgccggtgatcgggatggtggc 418
           ||||| ||||||||||| ||||| ||||| |||||||||||
Sbjct: 732 ctggctgggttgatgccagtgccagtgatggggatggtggc 692



to top

>emb|AJ289695.1|POC289695 Posidonia oceanica partial aq2 gene for putative aquaporin, exon 1
          Length = 880

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 378 ctggccgggttgatgccggtgccggtgatcgggatggtggc 418
           ||||| ||||||||||| ||||| ||||| |||||||||||
Sbjct: 710 ctggctgggttgatgccagtgccagtgatggggatggtggc 670



to top

>emb|AJ222973.1|LAAJ2973 Lupinus albus mRNA for aquaporin, partial
          Length = 1051

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 384 gggttgatgccggtgccggtgatcgggatggtggcca 420
           |||||||| ||||| |||||||| |||||||||||||
Sbjct: 714 gggttgataccggttccggtgatggggatggtggcca 678



to top

>gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, complete cds
          Length = 1084

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 361
           |||||||||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 815 acccagaagacccaatggtcatcccaagcgttgtccttgttgaagatga 767



to top

>emb|BX822631.1|CNS0A61A Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB54ZF09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 897

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 361
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 571 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 523



to top

>gb|AY084843.1| Arabidopsis thaliana clone 11929 mRNA, complete sequence
          Length = 1222

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 361
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 852 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 804



to top

>emb|AJ605574.1| Ricinus communis mRNA for aquaporin (Pip1-1 gene), clone pP2L
          Length = 1095

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 361
           |||||||| ||||| |||||||||||| | | |||||||||| ||||||
Sbjct: 868 acccagaaaatccaatgatcatcccagccttggtccttgttgaagatga 820



to top

>gb|AF024511.1|AF024511 Nicotiana tabacum aquaporin 1 mRNA, complete cds
          Length = 1158

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 89/109 (81%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccca 372
           ||||| |||||||| || || ||||| |||| |||  ||||||||||||  || || |||
Sbjct: 854 acccaaaagatccagtggtcgtcccatgcctggtctgtgttgtagatgatcgcagctcca 795

                                                            
Query: 373 gg-ctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
            | ||||| || ||||||||||| || |||||||| || ||||||||||
Sbjct: 794 agactcctagcggggttgatgccagttccggtgatgggaatggtggcca 746



to top

>dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane aquaporin 2b,
           complete cds
          Length = 1087

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 89/109 (81%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccca 372
           |||||||| ||||| || |||||||| | ||||  || ||||||||| || ||||| |||
Sbjct: 789 acccagaaaatccagtggtcatcccacggcttggactcgttgtagataaccgcggctcca 730

                                                            
Query: 373 gg-ctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
              |||||||||||||| || ||||| |||||||| || || |||||||
Sbjct: 729 aaactcctggccgggttaatcccggttccggtgattggaatagtggcca 681



to top

>ref|NM_116008.2| Arabidopsis thaliana PIP1A; water channel AT3G61430 (PIP1A) mRNA,
           complete cds
          Length = 1254

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 94/116 (81%), Gaps = 1/116 (0%)
 Strand = Plus / Minus

                                                                       
Query: 306 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 365
           |||||| ||||| || | ||| || ||||||||||  | ||| |||||||||||||  ||
Sbjct: 969 ggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgc 910

                                                                   
Query: 366 ggcccca-ggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
            || ||| |||| || || ||||||||||| ||||| ||||| |||||||| ||||
Sbjct: 909 agctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggttgcca 854



to top

>ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G01620 (PIP1C) mRNA,
           complete cds
          Length = 1251

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 361
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 908 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 857



to top

>gb|BT013307.1| Lycopersicon esculentum clone 134975R, mRNA sequence
          Length = 1260

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 375 ctcctggccgggttgatgccggtgccggtgatcgggatggtggc 418
           ||||| ||||||||||| ||||| ||||||||||| || |||||
Sbjct: 791 ctcctcgccgggttgattccggtaccggtgatcggaatagtggc 748



to top

>emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel protein (mipB)
          Length = 1114

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 361
           |||||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 800 ccgacccaaaagacccaatggtcatcccaagcgttgtccttgttgaagatga 749



to top

>emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B
          Length = 1057

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 361
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 795 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 744



to top

>emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 59
          Length = 199199

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 64/76 (84%), Gaps = 1/76 (1%)
 Strand = Plus / Minus

                                                                         
Query: 346   tccttgttgtagatgacggcggcccc-aggctcctggccgggttgatgccggtgccggtg 404
             |||||||||||||||| ||| || || || |||||||||||||| ||||| || || || 
Sbjct: 75489 tccttgttgtagatgatggcagctccgagactcctggccgggttaatgccagttccagta 75430

                             
Query: 405   atcgggatggtggcca 420
             || |||||||| ||||
Sbjct: 75429 attgggatggtagcca 75414



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 310   ccgacccagaagatccactg 329
             ||||||||||||||||||||
Sbjct: 75658 ccgacccagaagatccactg 75639



to top

>emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, BAC clone F16G20 (ESSAII
             project)
          Length = 97006

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 64/76 (84%), Gaps = 1/76 (1%)
 Strand = Plus / Minus

                                                                         
Query: 346   tccttgttgtagatgacggcggcccc-aggctcctggccgggttgatgccggtgccggtg 404
             |||||||||||||||| ||| || || || |||||||||||||| ||||| || || || 
Sbjct: 33957 tccttgttgtagatgatggcagctccgagactcctggccgggttaatgccagttccagta 33898

                             
Query: 405   atcgggatggtggcca 420
             || |||||||| ||||
Sbjct: 33897 attgggatggtagcca 33882



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 310   ccgacccagaagatccactg 329
             ||||||||||||||||||||
Sbjct: 34126 ccgacccagaagatccactg 34107



to top

>emb|AJ289701.1|VFA289701 Vicia faba mRNA for aquaporin (aq1 gene)
          Length = 995

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 94/116 (81%), Gaps = 1/116 (0%)
 Strand = Plus / Minus

                                                                       
Query: 306 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 365
           |||||| ||||| || | ||| || ||||||||||  | ||| |||||||||||||  ||
Sbjct: 873 ggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgc 814

                                                                   
Query: 366 ggcccca-ggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
            || ||| |||| || || ||||||||||| ||||| ||||| |||||||| ||||
Sbjct: 813 agctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggttgcca 758



to top

>gb|AY097398.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, complete cds
          Length = 861

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 94/116 (81%), Gaps = 1/116 (0%)
 Strand = Plus / Minus

                                                                       
Query: 306 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 365
           |||||| ||||| || | ||| || ||||||||||  | ||| |||||||||||||  ||
Sbjct: 786 ggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgc 727

                                                                   
Query: 366 ggcccca-ggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
            || ||| |||| || || ||||||||||| ||||| ||||| |||||||| ||||
Sbjct: 726 agctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggttgcca 671



to top

>gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (F22L4.16) mRNA, complete cds
          Length = 1031

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 361
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 836 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 785



to top

>gb|AY058113.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, complete cds
          Length = 1092

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 94/116 (81%), Gaps = 1/116 (0%)
 Strand = Plus / Minus

                                                                       
Query: 306 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 365
           |||||| ||||| || | ||| || ||||||||||  | ||| |||||||||||||  ||
Sbjct: 853 ggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgc 794

                                                                   
Query: 366 ggcccca-ggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
            || ||| |||| || || ||||||||||| ||||| ||||| |||||||| ||||
Sbjct: 793 agctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggttgcca 738



to top

>gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative plasma membrane
           intrinsic protein 1c (At1g01620) mRNA, complete cds
          Length = 861

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 361
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 782 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 731



to top

>emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZE08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 963

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 361
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 826 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 775



to top

>emb|BX824874.1|CNS0A5T5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH79ZH01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 946

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 94/116 (81%), Gaps = 1/116 (0%)
 Strand = Plus / Minus

                                                                       
Query: 306 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 365
           |||||| ||||| || | ||| || ||||||||||  | ||| |||||||||||||  ||
Sbjct: 724 ggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgc 665

                                                                   
Query: 366 ggcccca-ggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
            || ||| |||| || || ||||||||||| ||||| ||||| |||||||| ||||
Sbjct: 664 agctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggttgcca 609



to top

>emb|BX823595.1|CNS0A5AA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS55ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1059

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 94/116 (81%), Gaps = 1/116 (0%)
 Strand = Plus / Minus

                                                                       
Query: 306 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 365
           |||||| ||||| || | ||| || ||||||||||  | ||| |||||||||||||  ||
Sbjct: 832 ggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgc 773

                                                                   
Query: 366 ggcccca-ggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
            || ||| |||| || || ||||||||||| ||||| ||||| |||||||| ||||
Sbjct: 772 agctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggttgcca 717



to top

>dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane intrinsic protein
           2;5, complete cds
          Length = 1126

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgta 356
           |||||||||||||| || |||||||| |||||| | ||||||||
Sbjct: 786 acccagaagatccaatggtcatcccaagccttgccattgttgta 743



to top

>gb|AY088439.1| Arabidopsis thaliana clone 6690 mRNA, complete sequence
          Length = 1234

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 94/116 (81%), Gaps = 1/116 (0%)
 Strand = Plus / Minus

                                                                       
Query: 306 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 365
           |||||| ||||| || | ||| || ||||||||||  | ||| |||||||||||||  ||
Sbjct: 969 ggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgc 910

                                                                   
Query: 366 ggcccca-ggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
            || ||| |||| || || ||||||||||| ||||| ||||| |||||||| ||||
Sbjct: 909 agctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggttgcca 854



to top

>gb|AF266760.1|AF266760 Vicia faba plasma membrane aquaporin mRNA, complete cds
          Length = 920

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 94/116 (81%), Gaps = 1/116 (0%)
 Strand = Plus / Minus

                                                                       
Query: 306 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 365
           |||||| ||||| || | ||| || ||||||||||  | ||| |||||||||||||  ||
Sbjct: 832 ggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgc 773

                                                                   
Query: 366 ggcccca-ggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 420
            || ||| |||| || || ||||||||||| ||||| ||||| |||||||| ||||
Sbjct: 772 agctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggttgcca 717



to top

>gb|AF255795.1|AF255795 Allium cepa aquaporin 1 (Aqp1) mRNA, complete cds
          Length = 1237

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgta 356
           |||||||| ||||||||||| ||||| || || |||||||||||
Sbjct: 816 acccagaatatccactgatcgtcccaagctttatccttgttgta 773



to top

>emb|AJ605565.1| Ricinus communis partial mRNA for putative aquaporin (Pip2-2 gene),
           clone pR450-3
          Length = 452

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 324 ccactgatcatcccaggccttgtccttgttgtagat 359
           |||||| |||||||| ||||| ||||||||||||||
Sbjct: 435 ccactggtcatcccatgccttctccttgttgtagat 400



to top

>gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (At1g01620) mRNA, complete cds
          Length = 903

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 310 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 361
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 782 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 731



to top

>ref|NM_119676.2| Arabidopsis thaliana PIP3 (PLASMA MEMBRANE INTRINSIC PROTEIN 3);
           water channel AT4G35100 (PIP3) mRNA, complete cds
          Length = 1182

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 359
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 786 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 740



to top

>gb|DQ226873.1| Boechera divaricarpa isolate SLW-C-G04 mRNA sequence
          Length = 514

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 359
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 163 acccaaaagatccaatggtcatcccaagccttctcgttgttgtagat 117



to top

>gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, complete cds
          Length = 1278

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 265 atgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatc 324
           ||||||||||| ||||| || || || || || || || | ||| ||||||||||| |||
Sbjct: 937 atgtactggtgatagaatgcagctattgcggcaccaatgaagggtccgacccagaaaatc 878

                                      
Query: 325 cactgatcatcccaggccttgtccttg 351
           || || |||||||| ||||| ||||||
Sbjct: 877 cattggtcatcccatgccttatccttg 851



to top

>emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic protein 1
          Length = 1108

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 359
           |||||||||||||| || |||||||| |||| ||| | |||||||||
Sbjct: 863 acccagaagatccagtggtcatcccatgcctggtcttggttgtagat 817



to top

>emb|AL132962.1|ATF2A19 Arabidopsis thaliana DNA chromosome 3, BAC clone F2A19
          Length = 95993

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 75/91 (82%), Gaps = 1/91 (1%)
 Strand = Plus / Minus

                                                                         
Query: 331   tcatcccaggccttgtccttgttgtagatgacggcggcccca-ggctcctggccgggttg 389
             ||||||||||  | ||| |||||||||||||  || || ||| |||| || || ||||||
Sbjct: 29060 tcatcccaggaatggtctttgttgtagatgattgcagctccaaggcttctagctgggttg 29001

                                            
Query: 390   atgccggtgccggtgatcgggatggtggcca 420
             ||||| ||||| ||||| |||||||| ||||
Sbjct: 29000 atgcctgtgccagtgattgggatggttgcca 28970



to top

>gb|AF367458.1| Prunus persica clone Mip2 membrane intrinsic protein (mip2) mRNA,
           partial cds
          Length = 495

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 329 gatcatcccaggccttgtccttgttgtagat 359
           |||| |||||||| |||||||||||||||||
Sbjct: 490 gatcgtcccaggctttgtccttgttgtagat 460



to top

>gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map CIC10A06, complete
             sequence
          Length = 96827

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                    
Query: 327   ctgatcatcccaggccttgtccttgttgtagatgacggc 365
             |||||||||||| ||||| |  |||||||||||||||||
Sbjct: 65646 ctgatcatcccaagccttttgattgttgtagatgacggc 65608



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 310   ccgacccagaagatccactg 329
             ||||||||||||||||||||
Sbjct: 65741 ccgacccagaagatccactg 65722



to top

>gb|AY081580.1| Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           (At4g35100) mRNA, complete cds
          Length = 946

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 359
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 737 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 691



to top

>gb|AY062803.1| Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           (At4g35100; M4E13.150) mRNA, complete cds
          Length = 1036

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 313 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 359
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 784 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 738


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,292,499
Number of Sequences: 3902068
Number of extensions: 3292499
Number of successful extensions: 62377
Number of sequences better than 10.0: 342
Number of HSP's better than 10.0 without gapping: 331
Number of HSP's successfully gapped in prelim test: 15
Number of HSP's that attempted gapping in prelim test: 60480
Number of HSP's gapped (non-prelim): 1757
length of query: 422
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 400
effective length of database: 17,147,199,772
effective search space: 6858879908800
effective search space used: 6858879908800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top