ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart09f12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein 613 e-172
2gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence 123 4e-25
3gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker 123 4e-25
4gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker 123 4e-25
5gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein... 123 4e-25
6gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein... 123 4e-25
7gb|AY103580.1| Zea mays PCO072544 mRNA sequence 123 4e-25
8gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence 115 9e-23
9gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-... 115 9e-23
10emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein 115 9e-23
11gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRN... 115 9e-23
12emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for p... 100 6e-18
13gb|AY170841.1| Axonopus compressus plasma membrane MIP protein m... 98 2e-17
14gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein ... 98 2e-17
15emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet... 94 3e-16
16dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 94 3e-16
17dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic D... 94 3e-16
18dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic D... 94 3e-16
19dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 3e-16
20dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 3e-16
21dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 3e-16
22gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, ... 94 3e-16
23dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ... 94 3e-16
24ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predic... 84 3e-13
25emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4,... 84 3e-13
26dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 84 3e-13
27dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 3e-13
28dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 3e-13
29dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 3e-13
30dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 3e-13
31dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds 72 1e-09
32dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 68 2e-08
33ref|XM_468463.1| Oryza sativa (japonica cultivar-group), mRNA 60 5e-06
34dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic D... 60 5e-06
35dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 5e-06
36gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com... 60 5e-06
37dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3... 60 5e-06
38dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds 60 5e-06
39emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative pl... 56 7e-05
40emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intri... 54 3e-04
41gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putat... 54 3e-04
42gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein... 54 3e-04
43gb|AY107675.1| Zea mays PCO112712 mRNA sequence 54 3e-04
44gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma... 50 0.005
45gb|AY611006.1| Xerophyta humilis isolate HC398 PIP1 aquaporin mR... 48 0.018
46gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, c... 48 0.018
47gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds 48 0.018
48dbj|AB002149.1| Nicotiana excelsior mRNA for water channel prote... 48 0.018
49gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 46 0.071
50emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp... 46 0.071
51emb|AL772318.6| Mouse DNA sequence from clone RP23-77I17 on chro... 46 0.071
52emb|AL031227.1|DMC66A1 Drosophila melanogaster cosmid 66A1 44 0.28
53emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for p... 44 0.28
54gb|AC023747.4| Drosophila melanogaster X BAC RP98-38L1 (Roswell ... 44 0.28
55ref|NM_131946.3| Drosophila melanogaster CG12184-RA (CG12184), mRNA 44 0.28
56gb|AY051507.1| Drosophila melanogaster GH15731 full length cDNA 44 0.28
57gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrins... 44 0.28
58emb|AJ699398.2| Chenopodium rubrum mRNA for aquaporin PIP1 (PIP1... 44 0.28
59gb|AE003431.5| Drosophila melanogaster chromosome X, section 15 ... 44 0.28
60gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putat... 42 1.1
61gb|AC153823.5| Mus musculus 10 BAC RP23-11M21 (Roswell Park Canc... 42 1.1
62gb|AY957387.1| Pseudomonas stutzeri DnrE (dnrE) gene, complete c... 42 1.1
63gb|AC153943.3| Mus musculus 10 BAC RP24-408O23 (Roswell Park Can... 42 1.1
64gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 4.4
65ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G4... 40 4.4
66ref|XM_550604.1| Oryza sativa (japonica cultivar-group), mRNA 40 4.4
67ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA 40 4.4
68ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group... 40 4.4
69ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group... 40 4.4
70gb|AF488413.1| Oryza sativa chromosome 6 BAC 134P10, complete se... 40 4.4
71gb|AF499725.1| Thellungiella halophila plasma membrane intrinsic... 40 4.4
72emb|CR339052.6| Zebrafish DNA sequence from clone CH211-218E6 in... 40 4.4
73gb|AC007528.5| Homo sapiens 12 BAC RP11-473N11 (Roswell Park Can... 40 4.4
74emb|AL117377.18|HSJ1037B9 Human DNA sequence from clone RP5-1037... 40 4.4
75emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein 40 4.4
76emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel... 40 4.4
77emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel... 40 4.4
78gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (... 40 4.4
79emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A 40 4.4
80gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma m... 40 4.4
81gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 40 4.4
82gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome 40 4.4
83gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 40 4.4
84gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 40 4.4
85gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map... 40 4.4
86gb|AC016493.14| Homo sapiens chromosome 18, clone RP11-58G13, co... 40 4.4
87gb|AC079064.6| Homo sapiens chromosome 11, clone RP11-485O14, co... 40 4.4
88gb|AC023577.6| Homo sapiens chromosome 18, clone RP11-645D5, com... 40 4.4
89dbj|AK222086.1| Arabidopsis thaliana mRNA for aquaporin, partial... 40 4.4
90gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205),... 40 4.4
91gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, ... 40 4.4
92gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, ... 40 4.4
93dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.4
94dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.4
95emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Co... 40 4.4
96emb|BX819664.1|CNS0A8JV Arabidopsis thaliana Full-length cDNA Co... 40 4.4
97emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Co... 40 4.4
98emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Co... 40 4.4
99dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA ... 40 4.4
100gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, comp... 40 4.4
101dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D... 40 4.4
102dbj|AP002542.2| Oryza sativa (japonica cultivar-group) genomic D... 40 4.4
103emb|AJ243257.1|SNA243257 Streptomyces natalensis plasmid pSNA1 i... 40 4.4
104dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.4
105emb|Z17399.1|ATORFB Arabidopsis thaliana PIP1b gene 40 4.4
106dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.4
107dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.4
108dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.4
109dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.4
110gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, comp... 40 4.4
111gb|AY107589.1| Zea mays PCO085320 mRNA sequence 40 4.4
112gb|AF004293.1|AF004293 Brassica rapa aquaporin (MOD) mRNA, compl... 40 4.4
113gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, com... 40 4.4
114dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane ... 40 4.4

>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score =  613 bits (309), Expect = e-172
 Identities = 327/333 (98%)
 Strand = Plus / Minus

                                                                        
Query: 1    gcacaacaacgagcaggactacgcaacaactgagcactgatgagattacatacaagtcct 60
            |||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 1181 gcacaacaacgagcagtactacacaacaactgagcactgatgagattacatacaagtcct 1122

                                                                        
Query: 61   ctgtctgggttcaggtgaatacagagcaagagcaagagtagcacatcaaacttggaagac 120
            ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 1121 ctgtctgggttcaggtgaatacagagcaagagcaagagtagtacatcaaacttggaagac 1062

                                                                        
Query: 121  aaattggaattccacggtaacacggacgatgggaagagagggccgcccccatcagaaaga 180
            |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 1061 aaattggaattccacggtaacagggacgatgggaagagagggccgcccccatcagaaaga 1002

                                                                        
Query: 181  aattcactcagaacacgcagtttgctcttcgggttgggatggcatctttctttgtaacag 240
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 1001 aattcactcagaacacgcagtttgctcttcgggttgggatggcatctttctttgtagcag 942

                                                                        
Query: 241  cagcttaagacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcgg 300
            ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 941  cagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcgg 882

                                             
Query: 301  ccagcgcggcgccgatgaaggggccgacccaga 333
            |||||||||||||||||||||||||||||||||
Sbjct: 881  ccagcgcggcgccgatgaaggggccgacccaga 849



to top

>gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence
          Length = 1154

 Score =  123 bits (62), Expect = 4e-25
 Identities = 86/94 (91%)
 Strand = Plus / Minus

                                                                       
Query: 240 gcagcttaagacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 299
           |||||||||||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 834 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 775

                                             
Query: 300 gccagcgcggcgccgatgaaggggccgacccaga 333
           ||||| ||||||||||||||||||||||||||||
Sbjct: 774 gccagggcggcgccgatgaaggggccgacccaga 741



to top

>gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker
          Length = 824

 Score =  123 bits (62), Expect = 4e-25
 Identities = 86/94 (91%)
 Strand = Plus / Plus

                                                                       
Query: 240 gcagcttaagacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 299
           |||||||||||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 244 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 303

                                             
Query: 300 gccagcgcggcgccgatgaaggggccgacccaga 333
           ||||| ||||||||||||||||||||||||||||
Sbjct: 304 gccagggcggcgccgatgaaggggccgacccaga 337



to top

>gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker
          Length = 763

 Score =  123 bits (62), Expect = 4e-25
 Identities = 86/94 (91%)
 Strand = Plus / Minus

                                                                       
Query: 240 gcagcttaagacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 299
           |||||||||||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 533 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 474

                                             
Query: 300 gccagcgcggcgccgatgaaggggccgacccaga 333
           ||||| ||||||||||||||||||||||||||||
Sbjct: 473 gccagggcggcgccgatgaaggggccgacccaga 440



to top

>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete
           cds
          Length = 1153

 Score =  123 bits (62), Expect = 4e-25
 Identities = 86/94 (91%)
 Strand = Plus / Minus

                                                                       
Query: 240 gcagcttaagacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 299
           |||||||||||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 984 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 925

                                             
Query: 300 gccagcgcggcgccgatgaaggggccgacccaga 333
           ||||| ||||||||||||||||||||||||||||
Sbjct: 924 gccagggcggcgccgatgaaggggccgacccaga 891



to top

>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete
           cds
          Length = 1296

 Score =  123 bits (62), Expect = 4e-25
 Identities = 86/94 (91%)
 Strand = Plus / Minus

                                                                       
Query: 240 gcagcttaagacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 299
           |||||||||||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 979 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 920

                                             
Query: 300 gccagcgcggcgccgatgaaggggccgacccaga 333
           ||||| ||||||||||||||||||||||||||||
Sbjct: 919 gccagggcggcgccgatgaaggggccgacccaga 886



to top

>gb|AY103580.1| Zea mays PCO072544 mRNA sequence
          Length = 1633

 Score =  123 bits (62), Expect = 4e-25
 Identities = 86/94 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  gcagcttaagacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 299
            |||||||||||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 1308 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 1249

                                              
Query: 300  gccagcgcggcgccgatgaaggggccgacccaga 333
            ||||| ||||||||||||||||||||||||||||
Sbjct: 1248 gccagggcggcgccgatgaaggggccgacccaga 1215



to top

>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence
          Length = 698

 Score =  115 bits (58), Expect = 9e-23
 Identities = 73/78 (93%)
 Strand = Plus / Minus

                                                                       
Query: 256 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 315
           ||||||| |||||||| ||||||| |||||||||||||||||| |||||||| |||||||
Sbjct: 425 tcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccga 366

                             
Query: 316 tgaaggggccgacccaga 333
           ||||||||||||||||||
Sbjct: 365 tgaaggggccgacccaga 348



to top

>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score =  115 bits (58), Expect = 9e-23
 Identities = 73/78 (93%)
 Strand = Plus / Minus

                                                                       
Query: 256 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 315
           ||||||| |||||||| ||||||| |||||||||||||||||| |||||||| |||||||
Sbjct: 856 tcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccga 797

                             
Query: 316 tgaaggggccgacccaga 333
           ||||||||||||||||||
Sbjct: 796 tgaaggggccgacccaga 779



to top

>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score =  115 bits (58), Expect = 9e-23
 Identities = 73/78 (93%)
 Strand = Plus / Minus

                                                                       
Query: 256 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 315
           ||||||| |||||||| ||||||| |||||||||||||||||| |||||||| |||||||
Sbjct: 913 tcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccga 854

                             
Query: 316 tgaaggggccgacccaga 333
           ||||||||||||||||||
Sbjct: 853 tgaaggggccgacccaga 836



to top

>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds
          Length = 1280

 Score =  115 bits (58), Expect = 9e-23
 Identities = 85/94 (90%)
 Strand = Plus / Minus

                                                                       
Query: 240 gcagcttaagacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 299
           |||||||||||| || ||||||| ||||| |||||||||| |||||||||||||||||| 
Sbjct: 935 gcagcttaagacctgctcttgaacgggatggctctgatgatcacctggtggtagatggca 876

                                             
Query: 300 gccagcgcggcgccgatgaaggggccgacccaga 333
           ||||| || ||||| |||||||||||||||||||
Sbjct: 875 gccagggcagcgccaatgaaggggccgacccaga 842



to top

>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin
          Length = 1291

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 50/50 (100%)
 Strand = Plus / Minus

                                                              
Query: 284  ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccaga 333
            ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1291 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccaga 1242



to top

>gb|AY170841.1| Axonopus compressus plasma membrane MIP protein mRNA, partial cds
          Length = 423

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 79/89 (88%)
 Strand = Plus / Minus

                                                                       
Query: 245 ttaagacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccag 304
           ||||||| || ||||||| ||||| || ||||||| ||||||||||||||||||||| ||
Sbjct: 423 ttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggcggctag 364

                                        
Query: 305 cgcggcgccgatgaaggggccgacccaga 333
            || ||||| |||||||||||||||||||
Sbjct: 363 ggcagcgccaatgaaggggccgacccaga 335



to top

>gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein (Mip1) mRNA, partial cds
          Length = 539

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 82/93 (88%)
 Strand = Plus / Minus

                                                                       
Query: 241 cagcttaagacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcgg 300
           ||||||||||| || ||||||| ||||| || ||||||| |||||||||||||||||| |
Sbjct: 359 cagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggcag 300

                                            
Query: 301 ccagcgcggcgccgatgaaggggccgacccaga 333
           |||| || || || |||||||||||||||||||
Sbjct: 299 ccagggcagcaccaatgaaggggccgacccaga 267



to top

>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS
          Length = 1139

 Score = 93.7 bits (47), Expect = 3e-16
 Identities = 80/91 (87%)
 Strand = Plus / Minus

                                                                       
Query: 243 gcttaagacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 302
           ||||||||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 896 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 837

                                          
Query: 303 agcgcggcgccgatgaaggggccgacccaga 333
           || || ||||| | |||||| || |||||||
Sbjct: 836 agggcagcgccaacgaagggaccaacccaga 806



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 93.7 bits (47), Expect = 3e-16
 Identities = 80/91 (87%)
 Strand = Plus / Minus

                                                                            
Query: 243      gcttaagacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 302
                ||||||||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 27065653 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 27065594

                                               
Query: 303      agcgcggcgccgatgaaggggccgacccaga 333
                || || ||||| | |||||| || |||||||
Sbjct: 27065593 agggcagcgccaacgaagggaccaacccaga 27065563



 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 66/78 (84%)
 Strand = Plus / Minus

                                                                            
Query: 256      tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 315
                ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 35369403 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 35369344

                                  
Query: 316      tgaaggggccgacccaga 333
                |||| || || |||||||
Sbjct: 35369343 tgaacggaccaacccaga 35369326



to top

>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1486_E07
          Length = 110494

 Score = 93.7 bits (47), Expect = 3e-16
 Identities = 80/91 (87%)
 Strand = Plus / Minus

                                                                         
Query: 243   gcttaagacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 302
             ||||||||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 37302 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 37243

                                            
Query: 303   agcgcggcgccgatgaaggggccgacccaga 333
             || || ||||| | |||||| || |||||||
Sbjct: 37242 agggcagcgccaacgaagggaccaacccaga 37212



to top

>dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0461B08
          Length = 153743

 Score = 93.7 bits (47), Expect = 3e-16
 Identities = 80/91 (87%)
 Strand = Plus / Minus

                                                                          
Query: 243    gcttaagacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 302
              ||||||||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 118855 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 118796

                                             
Query: 303    agcgcggcgccgatgaaggggccgacccaga 333
              || || ||||| | |||||| || |||||||
Sbjct: 118795 agggcagcgccaacgaagggaccaacccaga 118765



to top

>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full
           insert sequence
          Length = 1128

 Score = 93.7 bits (47), Expect = 3e-16
 Identities = 80/91 (87%)
 Strand = Plus / Minus

                                                                       
Query: 243 gcttaagacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 302
           ||||||||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 929 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 870

                                          
Query: 303 agcgcggcgccgatgaaggggccgacccaga 333
           || || ||||| | |||||| || |||||||
Sbjct: 869 agggcagcgccaacgaagggaccaacccaga 839



to top

>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full
           insert sequence
          Length = 1205

 Score = 93.7 bits (47), Expect = 3e-16
 Identities = 80/91 (87%)
 Strand = Plus / Minus

                                                                       
Query: 243 gcttaagacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 302
           ||||||||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 984 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 925

                                          
Query: 303 agcgcggcgccgatgaaggggccgacccaga 333
           || || ||||| | |||||| || |||||||
Sbjct: 924 agggcagcgccaacgaagggaccaacccaga 894



to top

>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full
           insert sequence
          Length = 1136

 Score = 93.7 bits (47), Expect = 3e-16
 Identities = 80/91 (87%)
 Strand = Plus / Minus

                                                                       
Query: 243 gcttaagacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 302
           ||||||||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 929 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 870

                                          
Query: 303 agcgcggcgccgatgaaggggccgacccaga 333
           || || ||||| | |||||| || |||||||
Sbjct: 869 agggcagcgccaacgaagggaccaacccaga 839



to top

>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1140

 Score = 93.7 bits (47), Expect = 3e-16
 Identities = 80/91 (87%)
 Strand = Plus / Minus

                                                                       
Query: 243 gcttaagacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 302
           ||||||||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 924 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 865

                                          
Query: 303 agcgcggcgccgatgaaggggccgacccaga 333
           || || ||||| | |||||| || |||||||
Sbjct: 864 agggcagcgccaacgaagggaccaacccaga 834



to top

>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel
           protein, complete cds
          Length = 1116

 Score = 93.7 bits (47), Expect = 3e-16
 Identities = 80/91 (87%)
 Strand = Plus / Minus

                                                                       
Query: 243 gcttaagacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 302
           ||||||||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 927 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 868

                                          
Query: 303 agcgcggcgccgatgaaggggccgacccaga 333
           || || ||||| | |||||| || |||||||
Sbjct: 867 agggcagcgccaacgaagggaccaacccaga 837



to top

>ref|XM_473480.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 69/78 (88%)
 Strand = Plus / Minus

                                                                       
Query: 256 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 315
           |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 838 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 779

                             
Query: 316 tgaaggggccgacccaga 333
           |||||||||| |||||||
Sbjct: 778 tgaaggggccaacccaga 761



to top

>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11,
             complete sequence
          Length = 147806

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 69/78 (88%)
 Strand = Plus / Minus

                                                                         
Query: 256   tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 315
             |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 28669 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 28610

                               
Query: 316   tgaaggggccgacccaga 333
             |||||||||| |||||||
Sbjct: 28609 tgaaggggccaacccaga 28592



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 69/78 (88%)
 Strand = Plus / Minus

                                                                            
Query: 256      tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 315
                |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 28021443 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 28021384

                                  
Query: 316      tgaaggggccgacccaga 333
                |||||||||| |||||||
Sbjct: 28021383 tgaaggggccaacccaga 28021366



to top

>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full
           insert sequence
          Length = 1163

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 69/78 (88%)
 Strand = Plus / Minus

                                                                       
Query: 256 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 315
           |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 915 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 856

                             
Query: 316 tgaaggggccgacccaga 333
           |||||||||| |||||||
Sbjct: 855 tgaaggggccaacccaga 838



to top

>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full
           insert sequence
          Length = 1164

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 69/78 (88%)
 Strand = Plus / Minus

                                                                       
Query: 256 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 315
           |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 916 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 857

                             
Query: 316 tgaaggggccgacccaga 333
           |||||||||| |||||||
Sbjct: 856 tgaaggggccaacccaga 839



to top

>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full
           insert sequence
          Length = 1167

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 69/78 (88%)
 Strand = Plus / Minus

                                                                       
Query: 256 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 315
           |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 918 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 859

                             
Query: 316 tgaaggggccgacccaga 333
           |||||||||| |||||||
Sbjct: 858 tgaaggggccaacccaga 841



to top

>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full
            insert sequence
          Length = 1462

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 69/78 (88%)
 Strand = Plus / Minus

                                                                        
Query: 256  tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 315
            |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 1214 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 1155

                              
Query: 316  tgaaggggccgacccaga 333
            |||||||||| |||||||
Sbjct: 1154 tgaaggggccaacccaga 1137



to top

>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds
          Length = 1147

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                       
Query: 270 gctctgatgaccacctggtggtagatggcggccagcgcggcgccgatgaaggggccgacc 329
           |||||||||| |||||||||||||| ||| ||||| |||||||| | ||||||||| |||
Sbjct: 927 gctctgatgatcacctggtggtagacggctgccagggcggcgccaacgaaggggcccacc 868

               
Query: 330 caga 333
           ||||
Sbjct: 867 caga 864



to top

>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                       
Query: 256 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 315
           ||||||| |||||||| ||||| ||||||  ||||||||| || |||||||| |||||||
Sbjct: 945 tcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgccga 886

                             
Query: 316 tgaaggggccgacccaga 333
           |||| || || |||||||
Sbjct: 885 tgaacggtcccacccaga 868



to top

>ref|XM_468463.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1319

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 66/78 (84%)
 Strand = Plus / Minus

                                                                        
Query: 256  tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 315
            ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 1008 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 949

                              
Query: 316  tgaaggggccgacccaga 333
            |||| || || |||||||
Sbjct: 948  tgaacggaccaacccaga 931



to top

>dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1136_C04
          Length = 103194

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 66/78 (84%)
 Strand = Plus / Minus

                                                                         
Query: 256   tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 315
             ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 29951 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 29892

                               
Query: 316   tgaaggggccgacccaga 333
             |||| || || |||||||
Sbjct: 29891 tgaacggaccaacccaga 29874



to top

>dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086K14, full
            insert sequence
          Length = 1318

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 66/78 (84%)
 Strand = Plus / Minus

                                                                        
Query: 256  tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 315
            ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 1007 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 948

                              
Query: 316  tgaaggggccgacccaga 333
            |||| || || |||||||
Sbjct: 947  tgaacggaccaacccaga 930



to top

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 66/78 (84%)
 Strand = Plus / Minus

                                                                       
Query: 256 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 315
           ||||||| ||||| || ||||| ||||||  |||||||||||| |||||||| || ||||
Sbjct: 930 tcttgaaggggatggccctgatcaccaccacgtggtagatggccgccagcgccgcaccga 871

                             
Query: 316 tgaaggggccgacccaga 333
           |||| || || |||||||
Sbjct: 870 tgaacggaccaacccaga 853



to top

>dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3, promoter region and
            complete cds
          Length = 5325

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 66/78 (84%)
 Strand = Plus / Minus

                                                                        
Query: 256  tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 315
            ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 4906 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 4847

                              
Query: 316  tgaaggggccgacccaga 333
            |||| || || |||||||
Sbjct: 4846 tgaacggaccaacccaga 4829



to top

>dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds
          Length = 1403

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 66/78 (84%)
 Strand = Plus / Minus

                                                                       
Query: 256 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 315
           ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 985 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 926

                             
Query: 316 tgaaggggccgacccaga 333
           |||| || || |||||||
Sbjct: 925 tgaacggaccaacccaga 908



to top

>emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative plasma membrane intrinsic
           protein (pip1a gene)
          Length = 1139

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 254 ggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgcc 313
           |||||||||||| || ||||||||||| | |||||||||||| || || || || || ||
Sbjct: 874 ggtcttgaatggaattgctctgatgactatctggtggtagattgcagcaagggcagctcc 815

                               
Query: 314 gatgaaggggccgacccaga 333
            |||||||| || |||||||
Sbjct: 814 aatgaagggaccaacccaga 795



to top

>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene)
          Length = 1364

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 287 gtggtagatggcggccagcgcggcgccgatgaaggggccgacccaga 333
           ||||||||||||||| || || || |||||||||||||| |||||||
Sbjct: 906 gtggtagatggcggcaagagcagcaccgatgaaggggccaacccaga 860



to top

>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1
           (PIP1-1) mRNA, complete cds
          Length = 1115

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 250 acttggtcttgaatgggatcgctctgatgaccacctggtggta 292
           |||||| |||||| || || |||||||||||||||||||||||
Sbjct: 887 acttggacttgaagggaatggctctgatgaccacctggtggta 845



to top

>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete
           cds
          Length = 1338

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 287 gtggtagatggcggccagcgcggcgccgatgaaggggccgacccaga 333
           ||||||||||||||| || || || |||||||||||||| |||||||
Sbjct: 897 gtggtagatggcggcaagagcagcaccgatgaaggggccaacccaga 851



to top

>gb|AY107675.1| Zea mays PCO112712 mRNA sequence
          Length = 791

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 287 gtggtagatggcggccagcgcggcgccgatgaaggggccgacccaga 333
           ||||||||||||||| || || || |||||||||||||| |||||||
Sbjct: 330 gtggtagatggcggcaagagcagcaccgatgaaggggccaacccaga 284



to top

>gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1a) mRNA, complete cds
          Length = 1129

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 253 tggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgc 312
           |||||||||||||||| |||||||| || | ||||||||| | ||| || || || || |
Sbjct: 907 tggtcttgaatgggatggctctgattactatctggtggtacaaggcagcaagagcagctc 848

                                
Query: 313 cgatgaaggggccgacccaga 333
           | |||||||| || |||||||
Sbjct: 847 caatgaagggtcccacccaga 827



to top

>gb|AY611006.1| Xerophyta humilis isolate HC398 PIP1 aquaporin mRNA, partial cds
          Length = 502

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 258 ttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgatg 317
           ||||| ||||| ||||||||||| ||||||||||| |  || ||||| || || ||||||
Sbjct: 176 ttgaaggggattgctctgatgacgacctggtggtacagcgcagccagtgcagctccgatg 117

                           
Query: 318 aaggggccgacccaga 333
           || || || |||||||
Sbjct: 116 aatggcccaacccaga 101



to top

>gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, complete cds
          Length = 1189

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 257 cttgaatgggatcgctctgatgaccacctggtggta 292
           |||||||||||| |||||||| || |||||||||||
Sbjct: 937 cttgaatgggatggctctgatcacaacctggtggta 902



to top

>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 258 ttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgatg 317
           ||||| ||||| ||||||||||| ||||||||||| |  || ||||| || || ||||||
Sbjct: 936 ttgaaggggattgctctgatgacgacctggtggtacagcgcagccagtgcagctccgatg 877

                           
Query: 318 aaggggccgacccaga 333
           || || || |||||||
Sbjct: 876 aatggcccaacccaga 861



to top

>dbj|AB002149.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1064

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 245 ttaagacttggtcttgaatgggatcgctctgatgaccacctggtggta 292
           |||||| |||||||||||||| || ||||||||||  | |||||||||
Sbjct: 897 ttaagatttggtcttgaatggaatggctctgatgattatctggtggta 850



to top

>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 293    gatggcggccagcgcggcgccga 315
              |||||||||||||||||||||||
Sbjct: 310343 gatggcggccagcgcggcgccga 310365



to top

>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 250 acttggtcttgaatgggatcgctctgatgaccacc 284
           ||||| ||||||||||||| |||||||| ||||||
Sbjct: 847 acttgttcttgaatgggatagctctgatcaccacc 813



to top

>emb|AL772318.6| Mouse DNA sequence from clone RP23-77I17 on chromosome 4, complete
              sequence
          Length = 249534

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 60     tctgtctgggttcaggtgaatacagag 86
              ||||||||||| |||||||||||||||
Sbjct: 225070 tctgtctgggtacaggtgaatacagag 225044



to top

>emb|AL031227.1|DMC66A1 Drosophila melanogaster cosmid 66A1
          Length = 34127

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 277  tgaccacctggtggtagatggc 298
            ||||||||||||||||||||||
Sbjct: 9156 tgaccacctggtggtagatggc 9135



 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 277  tgaccacctggtggtagatggc 298
            ||||||||||||||||||||||
Sbjct: 5054 tgaccacctggtggtagatggc 5033



to top

>emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.2 gene)
          Length = 1124

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                       
Query: 256 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 315
           ||||||| || || ||||||||||| | |||||||||||  ||||| || || || || |
Sbjct: 931 tcttgaaaggaatggctctgatgactatctggtggtagacagcggcaagagcagctccaa 872

                             
Query: 316 tgaaggggccgacccaga 333
           |||| ||||| |||||||
Sbjct: 871 tgaaagggccaacccaga 854



to top

>gb|AC023747.4| Drosophila melanogaster X BAC RP98-38L1 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 167097

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 277   tgaccacctggtggtagatggc 298
             ||||||||||||||||||||||
Sbjct: 34675 tgaccacctggtggtagatggc 34654



to top

>ref|NM_131946.3| Drosophila melanogaster CG12184-RA (CG12184), mRNA
          Length = 3292

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 277  tgaccacctggtggtagatggc 298
            ||||||||||||||||||||||
Sbjct: 2313 tgaccacctggtggtagatggc 2292



to top

>gb|AY051507.1| Drosophila melanogaster GH15731 full length cDNA
          Length = 2897

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 277  tgaccacctggtggtagatggc 298
            ||||||||||||||||||||||
Sbjct: 1897 tgaccacctggtggtagatggc 1876



to top

>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA,
           complete cds
          Length = 1283

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 284 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccaga 333
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||
Sbjct: 890 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccaga 841



to top

>emb|AJ699398.2| Chenopodium rubrum mRNA for aquaporin PIP1 (PIP1 gene)
          Length = 1163

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 251 cttggtcttgaatgggatcgctctgatgaccacctggtggta 292
           ||||| |||||||||||| |||||||| || | |||||||||
Sbjct: 969 cttggacttgaatgggatggctctgataacaatctggtggta 928



to top

>gb|AE003431.5| Drosophila melanogaster chromosome X, section 15 of 74 of the complete
              sequence
          Length = 310993

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 277    tgaccacctggtggtagatggc 298
              ||||||||||||||||||||||
Sbjct: 239024 tgaccacctggtggtagatggc 239045



to top

>gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-2
           (PIP1-2) mRNA, complete cds
          Length = 1154

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 316
           |||||||||||| |||||||| || | ||||||||| | ||| || || || || || ||
Sbjct: 911 cttgaatgggatggctctgattactatctggtggtacaaggcagcaagagcagctccaat 852

                            
Query: 317 gaaggggccgacccaga 333
           |||||| || |||||||
Sbjct: 851 gaagggtccaacccaga 835



to top

>gb|AC153823.5| Mus musculus 10 BAC RP23-11M21 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 210101

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 103   acatcaaacttggaagacaaa 123
             |||||||||||||||||||||
Sbjct: 24157 acatcaaacttggaagacaaa 24177



to top

>gb|AY957387.1| Pseudomonas stutzeri DnrE (dnrE) gene, complete cds; NarL-like (narL)
            and NarX-like (narX) genes, complete sequence; NarK
            (narK), NarM (narM), NarG (narG), NarH (narH), NarJ
            (narJ), and NarI (narI) genes, complete cds; and unknown
            gene
          Length = 15150

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 308  ggcgccgatgaaggggccgacccag 332
            |||||||||||||||||||| ||||
Sbjct: 5753 ggcgccgatgaaggggccgatccag 5729



to top

>gb|AC153943.3| Mus musculus 10 BAC RP24-408O23 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 171960

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 103    acatcaaacttggaagacaaa 123
              |||||||||||||||||||||
Sbjct: 121183 acatcaaacttggaagacaaa 121203



to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 291     tagatggcggccagcgcggcgccgatga 318
               ||||| ||||||||| ||||||||||||
Sbjct: 3446908 tagatcgcggccagcccggcgccgatga 3446881



to top

>ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G45960 (PIP1B) mRNA,
           complete cds
          Length = 1259

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 257 cttgaatgggatcgctctgatgac 280
           |||||||||||| |||||||||||
Sbjct: 988 cttgaatgggatggctctgatgac 965



to top

>ref|XM_550604.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1086

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 308 ggcgccgatgaaggggccga 327
           ||||||||||||||||||||
Sbjct: 987 ggcgccgatgaaggggccga 968



to top

>ref|NM_187092.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1242

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 306 gcggcgccgatgaaggggccgacccaga 333
           |||||||||| ||| |||||||||||||
Sbjct: 901 gcggcgccgacgaacgggccgacccaga 874



to top

>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1257

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 306 gcggcgccgatgaaggggccgacccaga 333
           |||||||||| ||| |||||||||||||
Sbjct: 903 gcggcgccgacgaacgggccgacccaga 876



to top

>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1298

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 306 gcggcgccgatgaaggggccgacccaga 333
           |||||||||| ||| |||||||||||||
Sbjct: 904 gcggcgccgacgaacgggccgacccaga 877



to top

>gb|AF488413.1| Oryza sativa chromosome 6 BAC 134P10, complete sequence
          Length = 136866

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 308   ggcgccgatgaaggggccga 327
             ||||||||||||||||||||
Sbjct: 82946 ggcgccgatgaaggggccga 82927



to top

>gb|AF499725.1| Thellungiella halophila plasma membrane intrinsic protein 1B-like
           protein mRNA, complete cds
          Length = 833

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 257 cttgaatgggatcgctctgatgac 280
           |||||||||||| |||||||||||
Sbjct: 671 cttgaatgggattgctctgatgac 648



to top

>emb|CR339052.6| Zebrafish DNA sequence from clone CH211-218E6 in linkage group 10,
             complete sequence
          Length = 127879

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 173   cagaaagaaattcactcaga 192
             ||||||||||||||||||||
Sbjct: 53978 cagaaagaaattcactcaga 53997



to top

>gb|AC007528.5| Homo sapiens 12 BAC RP11-473N11 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 188451

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 82     cagagcaagagcaagagtag 101
              ||||||||||||||||||||
Sbjct: 155822 cagagcaagagcaagagtag 155841



to top

>emb|AL117377.18|HSJ1037B9 Human DNA sequence from clone RP5-1037B9 on chromosome 20p12.1-13
             Contains STSs, GSSs and a putative CpG island, complete
             sequence
          Length = 82183

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 102   cacatcaaacttggaagaca 121
             ||||||||||||||||||||
Sbjct: 72891 cacatcaaacttggaagaca 72872



to top

>emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein
          Length = 1064

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 257 cttgaatgggatcgctctgatgac 280
           |||||||||||| |||||||||||
Sbjct: 908 cttgaatgggatggctctgatgac 885



to top

>emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel protein (mipB)
          Length = 1114

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 257 cttgaatgggatcgctctgatgac 280
           |||||||||||| |||||||||||
Sbjct: 867 cttgaatgggatggctctgatgac 844



to top

>emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel protein (mipA)
          Length = 1104

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 257 cttgaatgggatcgctctgatgac 280
           |||||||||||| |||||||||||
Sbjct: 886 cttgaatgggatggctctgatgac 863



to top

>gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (At2g45960) mRNA,
           complete cds
          Length = 892

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 257 cttgaatgggatcgctctgatgac 280
           |||||||||||| |||||||||||
Sbjct: 849 cttgaatgggatggctctgatgac 826



to top

>emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A
          Length = 1105

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 257 cttgaatgggatcgctctgatgac 280
           |||||||||||| |||||||||||
Sbjct: 903 cttgaatgggatggctctgatgac 880



to top

>gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma membrane intrinsic
           protein 1B (At2g45960) mRNA, complete cds
          Length = 1077

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 257 cttgaatgggatcgctctgatgac 280
           |||||||||||| |||||||||||
Sbjct: 909 cttgaatgggatggctctgatgac 886



to top

>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 293    gatggcggccagcgcggcgc 312
              ||||||||||||||||||||
Sbjct: 539763 gatggcggccagcgcggcgc 539782



to top

>gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome
          Length = 5373180

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 166     cccccatcagaaagaaattcactc 189
               ||||||||||||| ||||||||||
Sbjct: 1961051 cccccatcagaaacaaattcactc 1961028



to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 293     gatggcggccagcgcggcgccgat 316
               |||||| |||||||||||||||||
Sbjct: 1468545 gatggccgccagcgcggcgccgat 1468568



to top

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 295     tggcggccagcgcggcgccg 314
               ||||||||||||||||||||
Sbjct: 4507898 tggcggccagcgcggcgccg 4507879



to top

>gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map CIC02E07, complete
             sequence
          Length = 101647

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 257   cttgaatgggatcgctctgatgac 280
             |||||||||||| |||||||||||
Sbjct: 15226 cttgaatgggatggctctgatgac 15249



to top

>gb|AC016493.14| Homo sapiens chromosome 18, clone RP11-58G13, complete sequence
          Length = 163936

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 112    ttggaagacaaattggaatt 131
              ||||||||||||||||||||
Sbjct: 159892 ttggaagacaaattggaatt 159873



to top

>gb|AC079064.6| Homo sapiens chromosome 11, clone RP11-485O14, complete sequence
          Length = 164009

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 170   catcagaaagaaattcactcagaa 193
             ||||||||| ||||||||||||||
Sbjct: 52709 catcagaaaaaaattcactcagaa 52732



to top

>gb|AC023577.6| Homo sapiens chromosome 18, clone RP11-645D5, complete sequence
          Length = 166503

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 112   ttggaagacaaattggaatt 131
             ||||||||||||||||||||
Sbjct: 50150 ttggaagacaaattggaatt 50131



to top

>dbj|AK222086.1| Arabidopsis thaliana mRNA for aquaporin, partial cds, clone:
           RAFL22-84-C08
          Length = 318

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 257 cttgaatgggatcgctctgatgac 280
           |||||||||||| |||||||||||
Sbjct: 111 cttgaatgggatggctctgatgac 88



to top

>gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205), mRNA sequence
          Length = 1913

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 257 cttgaatgggatcgctctgatgac 280
           |||||||||||| |||||||||||
Sbjct: 909 cttgaatgggatggctctgatgac 886



to top

>gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, complete cds
          Length = 1101

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 257 cttgaatgggatcgctctgatgac 280
           |||||||||||| |||||||||||
Sbjct: 868 cttgaatgggatggctctgatgac 845



to top

>gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, complete cds
          Length = 1084

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 257 cttgaatgggatcgctctgatgac 280
           |||||||||||| |||||||||||
Sbjct: 885 cttgaatgggatggctctgatgac 862



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 306      gcggcgccgatgaaggggccgacccaga 333
                |||||||||| ||| |||||||||||||
Sbjct: 15355775 gcggcgccgacgaacgggccgacccaga 15355748



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 308     ggcgccgatgaaggggccga 327
               ||||||||||||||||||||
Sbjct: 1762730 ggcgccgatgaaggggccga 1762711



to top

>emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS86ZH06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1084

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 257 cttgaatgggatcgctctgatgac 280
           |||||||||||| |||||||||||
Sbjct: 889 cttgaatgggatggctctgatgac 866



to top

>emb|BX819664.1|CNS0A8JV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS13ZG09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 679

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 257 cttgaatgggatcgctctgatgac 280
           |||||||||||| |||||||||||
Sbjct: 522 cttgaatgggatggctctgatgac 499



to top

>emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH87ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1036

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 257 cttgaatgggatcgctctgatgac 280
           |||||||||||| |||||||||||
Sbjct: 894 cttgaatgggatggctctgatgac 871



to top

>emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS2ZA01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1060

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 257 cttgaatgggatcgctctgatgac 280
           |||||||||||| |||||||||||
Sbjct: 881 cttgaatgggatggctctgatgac 858



to top

>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel
           protein, partial cds
          Length = 880

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 306 gcggcgccgatgaaggggccgacccaga 333
           |||||||||| ||| |||||||||||||
Sbjct: 467 gcggcgccgacgaacgggccgacccaga 440



to top

>gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, complete cds
          Length = 1052

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 257 cttgaatgggatcgctctgatgac 280
           |||||||||||| |||||||||||
Sbjct: 909 cttgaatgggatggctctgatgac 886



to top

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 306   gcggcgccgatgaaggggccgacccaga 333
             |||||||||| ||| |||||||||||||
Sbjct: 62774 gcggcgccgacgaacgggccgacccaga 62747



to top

>dbj|AP002542.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0679C08
          Length = 156266

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 308   ggcgccgatgaaggggccga 327
             ||||||||||||||||||||
Sbjct: 87879 ggcgccgatgaaggggccga 87860



to top

>emb|AJ243257.1|SNA243257 Streptomyces natalensis plasmid pSNA1 including spda, kora, spdb2 and
            rep genes
          Length = 9367

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 295  tggcggccagcgcggcgccg 314
            ||||||||||||||||||||
Sbjct: 4015 tggcggccagcgcggcgccg 3996



to top

>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full
           insert sequence
          Length = 1216

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 306 gcggcgccgatgaaggggccgacccaga 333
           |||||||||| ||| |||||||||||||
Sbjct: 901 gcggcgccgacgaacgggccgacccaga 874



to top

>emb|Z17399.1|ATORFB Arabidopsis thaliana PIP1b gene
          Length = 2773

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 257  cttgaatgggatcgctctgatgac 280
            |||||||||||| |||||||||||
Sbjct: 1547 cttgaatgggatggctctgatgac 1524



to top

>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full
           insert sequence
          Length = 1451

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 306 gcggcgccgatgaaggggccgacccaga 333
           |||||||||| ||| |||||||||||||
Sbjct: 495 gcggcgccgacgaacgggccgacccaga 468



to top

>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full
           insert sequence
          Length = 1242

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 306 gcggcgccgatgaaggggccgacccaga 333
           |||||||||| ||| |||||||||||||
Sbjct: 901 gcggcgccgacgaacgggccgacccaga 874



to top

>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full
           insert sequence
          Length = 1257

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 306 gcggcgccgatgaaggggccgacccaga 333
           |||||||||| ||| |||||||||||||
Sbjct: 903 gcggcgccgacgaacgggccgacccaga 876



to top

>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full
           insert sequence
          Length = 1298

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 306 gcggcgccgatgaaggggccgacccaga 333
           |||||||||| ||| |||||||||||||
Sbjct: 904 gcggcgccgacgaacgggccgacccaga 877



to top

>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds
          Length = 1328

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 306 gcggcgccgatgaaggggccgacccaga 333
           |||||||||| ||| |||||||||||||
Sbjct: 891 gcggcgccgacgaacgggccgacccaga 864



to top

>gb|AY107589.1| Zea mays PCO085320 mRNA sequence
          Length = 569

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 306 gcggcgccgatgaaggggccgacccaga 333
           |||||||||||||  |||||||||||||
Sbjct: 209 gcggcgccgatgagtgggccgacccaga 182



to top

>gb|AF004293.1|AF004293 Brassica rapa aquaporin (MOD) mRNA, complete cds
          Length = 900

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 257 cttgaatgggatcgctctgatgac 280
           |||||||||||| |||||||||||
Sbjct: 867 cttgaatgggatggctctgatgac 844



to top

>gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, complete cds
          Length = 1071

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 306 gcggcgccgatgaaggggccgacccaga 333
           |||||||||||||| ||||| |||||||
Sbjct: 792 gcggcgccgatgaacgggccaacccaga 765



to top

>dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane aquaporin 1b,
           complete cds
          Length = 1053

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 257 cttgaatgggatcgctctgatgac 280
           |||||||||||| |||||||||||
Sbjct: 870 cttgaatgggatggctctgatgac 847


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,312,014
Number of Sequences: 3902068
Number of extensions: 3312014
Number of successful extensions: 63564
Number of sequences better than 10.0: 114
Number of HSP's better than 10.0 without gapping: 115
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63086
Number of HSP's gapped (non-prelim): 478
length of query: 333
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 311
effective length of database: 17,147,199,772
effective search space: 5332779129092
effective search space used: 5332779129092
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top