>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 419     cactggccggcctgcgcgtca 439
               |||||||||||||||||||||
Sbjct: 1897388 cactggccggcctgcgcgtca 1897368

>gb|AC132286.3| Mus musculus BAC clone RP24-299C19 from 1, complete sequence
          Length = 192877

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 23    aggaaaaacagcccgcagatg 43
             |||||||||||||||||||||
Sbjct: 76570 aggaaaaacagcccgcagatg 76550

>emb|BX067989.1|CNS09OMH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 815

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 276 cagcaatggccccgacggaa 295
           ||||||||||||||||||||
Sbjct: 85  cagcaatggccccgacggaa 104

>gb|DQ355805.1| Trichoplax adhaerens ANTP homeobox protein (Hmx) gene, complete cds
          Length = 11728

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 61   ttcacatttcttttcaacac 80
            ||||||||||||||||||||
Sbjct: 1617 ttcacatttcttttcaacac 1598

>ref|NM_068167.2| Caenorhabditis elegans R08C7.10c (R08C7.10) mRNA, complete cds
          Length = 2219

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 192 tccgaattagcatccgacga 211
           ||||||||||||||||||||
Sbjct: 124 tccgaattagcatccgacga 105

>ref|NM_068165.2| Caenorhabditis elegans R08C7.10b (R08C7.10) mRNA, complete cds
          Length = 2328

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 192 tccgaattagcatccgacga 211
           ||||||||||||||||||||
Sbjct: 104 tccgaattagcatccgacga 85

>ref|NM_068166.2| Caenorhabditis elegans R08C7.10a (R08C7.10) mRNA, complete cds
          Length = 2463

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 192 tccgaattagcatccgacga 211
           ||||||||||||||||||||
Sbjct: 23  tccgaattagcatccgacga 4

>gb|U61953.2| Caenorhabditis elegans cosmid R08C7, complete sequence
          Length = 39012

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 192   tccgaattagcatccgacga 211
             ||||||||||||||||||||
Sbjct: 24656 tccgaattagcatccgacga 24675

>dbj|AP002453.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-801G16, complete
              sequence
          Length = 211345

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 61     ttcacatttcttttcaacac 80
              ||||||||||||||||||||
Sbjct: 207087 ttcacatttcttttcaacac 207106

>dbj|AP003384.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-35N19, complete
             sequence
          Length = 156712

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 61    ttcacatttcttttcaacac 80
             ||||||||||||||||||||
Sbjct: 75931 ttcacatttcttttcaacac 75950


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,239,217
Number of Sequences: 3902068
Number of extensions: 3239217
Number of successful extensions: 53223
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 53177
Number of HSP's gapped (non-prelim): 46
length of query: 445
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 423
effective length of database: 17,147,199,772
effective search space: 7253265503556
effective search space used: 7253265503556
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)