>gb|AC141435.28| Medicago truncatula clone mth2-21i11, complete sequence
          Length = 132497

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 119   tttttgtcaagttttcgtgcc 139
             |||||||||||||||||||||
Sbjct: 24498 tttttgtcaagttttcgtgcc 24478

>emb|BX908798.1| Parachlamydia-related symbiont UWE25, complete genome
          Length = 2414465

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 52     tttgattcatctttcactcc 71
              ||||||||||||||||||||
Sbjct: 885819 tttgattcatctttcactcc 885838

>gb|AE017340.1| Idiomarina loihiensis L2TR, complete genome
          Length = 2839318

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 184    ttcgtccccattatttgccg 203
              ||||||||||||||||||||
Sbjct: 297857 ttcgtccccattatttgccg 297838

>emb|BX005323.10| Zebrafish DNA sequence from clone DKEY-11F12 in linkage group 7, complete
              sequence
          Length = 219799

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 44     atttacagtttgattcatct 63
              ||||||||||||||||||||
Sbjct: 205970 atttacagtttgattcatct 205989

>gb|AC006227.1|AC006227 Homo sapiens, clone hRPK.16_A_1, complete sequence
          Length = 153337

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 153    atctctactagtacctcaca 172
              ||||||||||||||||||||
Sbjct: 143422 atctctactagtacctcaca 143403

>emb|BX005310.6| Zebrafish DNA sequence from clone CH211-214J2 in linkage group 7,
              complete sequence
          Length = 221979

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 44     atttacagtttgattcatct 63
              ||||||||||||||||||||
Sbjct: 140956 atttacagtttgattcatct 140975


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,799,697
Number of Sequences: 3902068
Number of extensions: 1799697
Number of successful extensions: 129844
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 129795
Number of HSP's gapped (non-prelim): 49
length of query: 217
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 195
effective length of database: 17,147,199,772
effective search space: 3343703955540
effective search space used: 3343703955540
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)