ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbart09d06 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC084817.5| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0419C04, complete sequence Length = 136713 Score = 165 bits (83), Expect = 2e-37 Identities = 235/285 (82%), Gaps = 3/285 (1%) Strand = Plus / Plus Query: 170 gcagctgggcttttatcgcccgaaccagcctctctggggaggctgcgcatcagtgtcgtt 229 ||||||| ||||||| |||||| ||||||||||||||| ||| || || | | |||| Sbjct: 77061 gcagctgagcttttaacgcccgtgccagcctctctgggg---ctgggcgtcggcgccgtt 77117 Query: 230 catcagcttgtcgagcaccacgttcaggtccacattctgaccgctctctgtcagcctgcg 289 ||||| ||| || ||||||| ||||||||| || |||||||||||||| |||||| ||| Sbjct: 77118 catcaccttatcaagcaccatgttcaggtcgacgttctgaccgctctcggtcagctggcg 77177 Query: 290 cacagtcgccctcacttgctccttcgagaaccccatcgtcgaaaccttgtccaccacgtc 349 || | ||| ||||| |||||| |||||||||||||||| | ||||||||| |||||||| Sbjct: 77178 aacggccgctctcacctgctccctcgagaaccccatcgtggcaaccttgtctaccacgtc 77237 Query: 350 atccaccgccaccctggtgccggatgagccgctcggagtggagctcactggcgctgcttg 409 ||| | || ||||||| |||| || ||| |||| || ||||||||| ||| ||| ||||| Sbjct: 77238 atcaatcggcaccctgttgcccgaggaggcgcttggggtggagctcgctgacgcggcttg 77297 Query: 410 gggtagtagttgagctgtcgggagcttgccgtacttgccacttcc 454 ||| || | ||||||||| |||||| ||| ||| ||||| ||||| Sbjct: 77298 gggcagcatttgagctgtagggagcctgctgtagttgccgcttcc 77342
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 165 bits (83), Expect = 2e-37 Identities = 235/285 (82%), Gaps = 3/285 (1%) Strand = Plus / Plus Query: 170 gcagctgggcttttatcgcccgaaccagcctctctggggaggctgcgcatcagtgtcgtt 229 ||||||| ||||||| |||||| ||||||||||||||| ||| || || | | |||| Sbjct: 4102367 gcagctgagcttttaacgcccgtgccagcctctctgggg---ctgggcgtcggcgccgtt 4102423 Query: 230 catcagcttgtcgagcaccacgttcaggtccacattctgaccgctctctgtcagcctgcg 289 ||||| ||| || ||||||| ||||||||| || |||||||||||||| |||||| ||| Sbjct: 4102424 catcaccttatcaagcaccatgttcaggtcgacgttctgaccgctctcggtcagctggcg 4102483 Query: 290 cacagtcgccctcacttgctccttcgagaaccccatcgtcgaaaccttgtccaccacgtc 349 || | ||| ||||| |||||| |||||||||||||||| | ||||||||| |||||||| Sbjct: 4102484 aacggccgctctcacctgctccctcgagaaccccatcgtggcaaccttgtctaccacgtc 4102543 Query: 350 atccaccgccaccctggtgccggatgagccgctcggagtggagctcactggcgctgcttg 409 ||| | || ||||||| |||| || ||| |||| || ||||||||| ||| ||| ||||| Sbjct: 4102544 atcaatcggcaccctgttgcccgaggaggcgcttggggtggagctcgctgacgcggcttg 4102603 Query: 410 gggtagtagttgagctgtcgggagcttgccgtacttgccacttcc 454 ||| || | ||||||||| |||||| ||| ||| ||||| ||||| Sbjct: 4102604 gggcagcatttgagctgtagggagcctgctgtagttgccgcttcc 4102648
>dbj|AK073439.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044H02, full insert sequence Length = 1988 Score = 165 bits (83), Expect = 2e-37 Identities = 235/285 (82%), Gaps = 3/285 (1%) Strand = Plus / Minus Query: 170 gcagctgggcttttatcgcccgaaccagcctctctggggaggctgcgcatcagtgtcgtt 229 ||||||| ||||||| |||||| ||||||||||||||| ||| || || | | |||| Sbjct: 1625 gcagctgagcttttaacgcccgtgccagcctctctgggg---ctgggcgtcggcgccgtt 1569 Query: 230 catcagcttgtcgagcaccacgttcaggtccacattctgaccgctctctgtcagcctgcg 289 ||||| ||| || ||||||| ||||||||| || |||||||||||||| |||||| ||| Sbjct: 1568 catcaccttatcaagcaccatgttcaggtcgacgttctgaccgctctcggtcagctggcg 1509 Query: 290 cacagtcgccctcacttgctccttcgagaaccccatcgtcgaaaccttgtccaccacgtc 349 || | ||| ||||| |||||| |||||||||||||||| | ||||||||| |||||||| Sbjct: 1508 aacggccgctctcacctgctccctcgagaaccccatcgtggcaaccttgtctaccacgtc 1449 Query: 350 atccaccgccaccctggtgccggatgagccgctcggagtggagctcactggcgctgcttg 409 ||| | || ||||||| |||| || ||| |||| || ||||||||| ||| ||| ||||| Sbjct: 1448 atcaatcggcaccctgttgcccgaggaggcgcttggggtggagctcgctgacgcggcttg 1389 Query: 410 gggtagtagttgagctgtcgggagcttgccgtacttgccacttcc 454 ||| || | ||||||||| |||||| ||| ||| ||||| ||||| Sbjct: 1388 gggcagcatttgagctgtagggagcctgctgtagttgccgcttcc 1344
>ref|XM_476050.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1386 Score = 153 bits (77), Expect = 6e-34 Identities = 191/229 (83%) Strand = Plus / Minus Query: 226 cgttcatcagcttgtcgagcaccacgttcaggtccacattctgaccgctctctgtcagcc 285 ||||||||| ||| || ||||||| ||||||||| || |||||||||||||| |||||| Sbjct: 1345 cgttcatcaccttatcaagcaccatgttcaggtcgacgttctgaccgctctcggtcagct 1286 Query: 286 tgcgcacagtcgccctcacttgctccttcgagaaccccatcgtcgaaaccttgtccacca 345 ||| || | ||| ||||| |||||| |||||||||||||||| | ||||||||| |||| Sbjct: 1285 ggcgaacggccgctctcacctgctccctcgagaaccccatcgtggcaaccttgtctacca 1226 Query: 346 cgtcatccaccgccaccctggtgccggatgagccgctcggagtggagctcactggcgctg 405 ||||||| | || ||||||| |||| || ||| |||| || ||||||||| ||| ||| | Sbjct: 1225 cgtcatcaatcggcaccctgttgcccgaggaggcgcttggggtggagctcgctgacgcgg 1166 Query: 406 cttggggtagtagttgagctgtcgggagcttgccgtacttgccacttcc 454 ||||||| || | ||||||||| |||||| ||| ||| ||||| ||||| Sbjct: 1165 cttggggcagcatttgagctgtagggagcctgctgtagttgccgcttcc 1117
>ref|XM_550268.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2234 Score = 145 bits (73), Expect = 1e-31 Identities = 223/273 (81%) Strand = Plus / Minus Query: 182 ttatcgcccgaaccagcctctctggggaggctgcgcatcagtgtcgttcatcagcttgtc 241 |||||| |||||||| ||| ||||||| |||| |||| ||||||||||||||||||| Sbjct: 1890 ttatcgaccgaaccatcctttctggggctgctgtacatcgctgtcgttcatcagcttgtc 1831 Query: 242 gagcaccacgttcaggtccacattctgaccgctctctgtcagcctgcgcacagtcgccct 301 ||||||||||||||| ||||||||||| || |||| |||||||| |||||||| ||||| Sbjct: 1830 gagcaccacgttcagatccacattctgcccattctcggtcagcctccgcacagttgccct 1771 Query: 302 cacttgctccttcgagaaccccatcgtcgaaaccttgtccaccacgtcatccaccgccac 361 ||||||||| | ||||| ||||| || | |||||| || || || ||||| |||| ||| Sbjct: 1770 cacttgctctcttgagaatcccattgttgcaaccttctcaactacatcatcaaccggcac 1711 Query: 362 cctggtgccggatgagccgctcggagtggagctcactggcgctgcttggggtagtagttg 421 |||| |||| || || || || || |||| | | ||| ||||||| ||||||| ||| Sbjct: 1710 cctgttgccagaggaaccacttgggctggaattgataggcactgcttgtggtagtatttg 1651 Query: 422 agctgtcgggagcttgccgtacttgccacttcc 454 ||||| |||||| |||| || ||||||||||| Sbjct: 1650 ggctgtggggagcctgccatagttgccacttcc 1618
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 145 bits (73), Expect = 1e-31 Identities = 223/273 (81%) Strand = Plus / Plus Query: 182 ttatcgcccgaaccagcctctctggggaggctgcgcatcagtgtcgttcatcagcttgtc 241 |||||| |||||||| ||| ||||||| |||| |||| ||||||||||||||||||| Sbjct: 3591171 ttatcgaccgaaccatcctttctggggctgctgtacatcgctgtcgttcatcagcttgtc 3591230 Query: 242 gagcaccacgttcaggtccacattctgaccgctctctgtcagcctgcgcacagtcgccct 301 ||||||||||||||| ||||||||||| || |||| |||||||| |||||||| ||||| Sbjct: 3591231 gagcaccacgttcagatccacattctgcccattctcggtcagcctccgcacagttgccct 3591290 Query: 302 cacttgctccttcgagaaccccatcgtcgaaaccttgtccaccacgtcatccaccgccac 361 ||||||||| | ||||| ||||| || | |||||| || || || ||||| |||| ||| Sbjct: 3591291 cacttgctctcttgagaatcccattgttgcaaccttctcaactacatcatcaaccggcac 3591350 Query: 362 cctggtgccggatgagccgctcggagtggagctcactggcgctgcttggggtagtagttg 421 |||| |||| || || || || || |||| | | ||| ||||||| ||||||| ||| Sbjct: 3591351 cctgttgccagaggaaccacttgggctggaattgataggcactgcttgtggtagtatttg 3591410 Query: 422 agctgtcgggagcttgccgtacttgccacttcc 454 ||||| |||||| |||| || ||||||||||| Sbjct: 3591411 ggctgtggggagcctgccatagttgccacttcc 3591443
>dbj|AP003339.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ1276_B06 Length = 175174 Score = 145 bits (73), Expect = 1e-31 Identities = 223/273 (81%) Strand = Plus / Plus Query: 182 ttatcgcccgaaccagcctctctggggaggctgcgcatcagtgtcgttcatcagcttgtc 241 |||||| |||||||| ||| ||||||| |||| |||| ||||||||||||||||||| Sbjct: 159239 ttatcgaccgaaccatcctttctggggctgctgtacatcgctgtcgttcatcagcttgtc 159298 Query: 242 gagcaccacgttcaggtccacattctgaccgctctctgtcagcctgcgcacagtcgccct 301 ||||||||||||||| ||||||||||| || |||| |||||||| |||||||| ||||| Sbjct: 159299 gagcaccacgttcagatccacattctgcccattctcggtcagcctccgcacagttgccct 159358 Query: 302 cacttgctccttcgagaaccccatcgtcgaaaccttgtccaccacgtcatccaccgccac 361 ||||||||| | ||||| ||||| || | |||||| || || || ||||| |||| ||| Sbjct: 159359 cacttgctctcttgagaatcccattgttgcaaccttctcaactacatcatcaaccggcac 159418 Query: 362 cctggtgccggatgagccgctcggagtggagctcactggcgctgcttggggtagtagttg 421 |||| |||| || || || || || |||| | | ||| ||||||| ||||||| ||| Sbjct: 159419 cctgttgccagaggaaccacttgggctggaattgataggcactgcttgtggtagtatttg 159478 Query: 422 agctgtcgggagcttgccgtacttgccacttcc 454 ||||| |||||| |||| || ||||||||||| Sbjct: 159479 ggctgtggggagcctgccatagttgccacttcc 159511
>dbj|AK121293.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023110A06, full insert sequence Length = 2234 Score = 145 bits (73), Expect = 1e-31 Identities = 223/273 (81%) Strand = Plus / Minus Query: 182 ttatcgcccgaaccagcctctctggggaggctgcgcatcagtgtcgttcatcagcttgtc 241 |||||| |||||||| ||| ||||||| |||| |||| ||||||||||||||||||| Sbjct: 1890 ttatcgaccgaaccatcctttctggggctgctgtacatcgctgtcgttcatcagcttgtc 1831 Query: 242 gagcaccacgttcaggtccacattctgaccgctctctgtcagcctgcgcacagtcgccct 301 ||||||||||||||| ||||||||||| || |||| |||||||| |||||||| ||||| Sbjct: 1830 gagcaccacgttcagatccacattctgcccattctcggtcagcctccgcacagttgccct 1771 Query: 302 cacttgctccttcgagaaccccatcgtcgaaaccttgtccaccacgtcatccaccgccac 361 ||||||||| | ||||| ||||| || | |||||| || || || ||||| |||| ||| Sbjct: 1770 cacttgctctcttgagaatcccattgttgcaaccttctcaactacatcatcaaccggcac 1711 Query: 362 cctggtgccggatgagccgctcggagtggagctcactggcgctgcttggggtagtagttg 421 |||| |||| || || || || || |||| | | ||| ||||||| ||||||| ||| Sbjct: 1710 cctgttgccagaggaaccacttgggctggaattgataggcactgcttgtggtagtatttg 1651 Query: 422 agctgtcgggagcttgccgtacttgccacttcc 454 ||||| |||||| |||| || ||||||||||| Sbjct: 1650 ggctgtggggagcctgccatagttgccacttcc 1618
>gb|AY107936.1| Zea mays PCO127654 mRNA sequence Length = 458 Score = 95.6 bits (48), Expect = 1e-16 Identities = 96/112 (85%) Strand = Plus / Minus Query: 226 cgttcatcagcttgtcgagcaccacgttcaggtccacattctgaccgctctctgtcagcc 285 ||||||||||||||||||| ||||||||||||||||||||||| || | || ||||||| Sbjct: 228 cgttcatcagcttgtcgagaaccacgttcaggtccacattctgcccattttccgtcagcc 169 Query: 286 tgcgcacagtcgccctcacttgctccttcgagaaccccatcgtcgaaacctt 337 | ||||| || || ||||| ||||| ||||||| |||||||| | |||||| Sbjct: 168 tccgcacggttgctctcacctgctctctcgagaatcccatcgtggcaacctt 117
>gb|AC040160.4|AC040160 Homo sapiens chromosome 16 clone CTC-277H1, complete sequence Length = 209574 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 ccacgttcaggtccacattct 267 ||||||||||||||||||||| Sbjct: 89060 ccacgttcaggtccacattct 89040
>gb|CP000112.1| Desulfovibrio desulfuricans G20, complete genome Length = 3730232 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 232 tcagcttgtcgagcaccacg 251 |||||||||||||||||||| Sbjct: 2318268 tcagcttgtcgagcaccacg 2318249
>gb|AE009111.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 137 of 256 of the complete sequence Length = 13051 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 340 ccaccacgtcatccaccgccaccc 363 |||||||| ||||||||||||||| Sbjct: 9999 ccaccacggcatccaccgccaccc 10022
>gb|AF434197.1| Rhodotorula glutinis superoxide dismutase mRNA, complete cds Length = 732 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 79 cgaaatacgaaatcccctca 98 |||||||||||||||||||| Sbjct: 682 cgaaatacgaaatcccctca 701
>gb|AF145281.1| Trichomonas vaginalis P-type ATPase (UNK-2) gene, partial cds Length = 665 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 431 gagcttgccgtacttgccac 450 |||||||||||||||||||| Sbjct: 189 gagcttgccgtacttgccac 170
>gb|AE005876.1| Caulobacter crescentus CB15 section 202 of 359 of the complete genome Length = 10072 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 230 catcagcttgtcgagcaccacgtt 253 ||||||||||||||||| |||||| Sbjct: 5354 catcagcttgtcgagcagcacgtt 5331
>gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome Length = 2841581 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 340 ccaccacgtcatccaccgccaccc 363 |||||||| ||||||||||||||| Sbjct: 1520553 ccaccacggcatccaccgccaccc 1520576
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 232 tcagcttgtcgagcaccacg 251 |||||||||||||||||||| Sbjct: 1205710 tcagcttgtcgagcaccacg 1205729
>dbj|BA000004.3| Bacillus halodurans C-125 DNA, complete genome Length = 4202352 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 80 gaaatacgaaatcccctcat 99 |||||||||||||||||||| Sbjct: 2829010 gaaatacgaaatcccctcat 2829029
>dbj|AB032523.1| Streptomyces avermitilis avermectin biosynthetic gene cluster (orf1, aveBI, aveBII, aveBIII, aveBIV, aveBV, aveBVI, aveBVII, aveBVIII), complete cds Length = 9530 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 232 tcagcttgtcgagcaccacg 251 |||||||||||||||||||| Sbjct: 3037 tcagcttgtcgagcaccacg 3056 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,597,575 Number of Sequences: 3902068 Number of extensions: 2597575 Number of successful extensions: 45694 Number of sequences better than 10.0: 19 Number of HSP's better than 10.0 without gapping: 19 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 45567 Number of HSP's gapped (non-prelim): 124 length of query: 458 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 436 effective length of database: 17,147,199,772 effective search space: 7476179100592 effective search space used: 7476179100592 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
