ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart09c09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ277799.1|HVU277799 Hordeum vulgare mRNA for putative elong... 993 0.0
2gb|AY111648.1| Zea mays CL2935_1 mRNA sequence 246 6e-62
3gb|BT016185.1| Zea mays clone Contig18 mRNA sequence 240 4e-60
4gb|BT016424.1| Zea mays clone Contig257 mRNA sequence 236 6e-59
5gb|AY103717.1| Zea mays PCO098989 mRNA sequence 200 3e-48
6dbj|AK073405.1| Oryza sativa (japonica cultivar-group) cDNA clon... 139 1e-29
7dbj|AK059914.1| Oryza sativa (japonica cultivar-group) cDNA clon... 139 1e-29
8dbj|D83727.1| Oryza sativa (japonica cultivar-group) mRNA for el... 139 1e-29
9gb|U87222.1|PBU87222 Pimpinella brachycarpa elongation factor 1-... 113 6e-22
10ref|NM_127367.1| Arabidopsis thaliana translation elongation fac... 107 4e-20
11gb|AY081568.1| Arabidopsis thaliana putative elongation factor 1... 107 4e-20
12gb|AY065159.1| Arabidopsis thaliana putative elongation factor 1... 107 4e-20
13emb|BX820727.1|CNS0A8QL Arabidopsis thaliana Full-length cDNA Co... 107 4e-20
14emb|BX820611.1|CNS0A8PL Arabidopsis thaliana Full-length cDNA Co... 107 4e-20
15gb|AY087429.1| Arabidopsis thaliana clone 35337 mRNA, complete s... 107 4e-20
16emb|BX842001.1|CNS09Y84 Arabidopsis thaliana Full-length cDNA Co... 105 1e-19
17emb|BX820768.1|CNS0A8OK Arabidopsis thaliana Full-length cDNA Co... 100 9e-18
18ref|NM_102762.2| Arabidopsis thaliana translation elongation fac... 98 3e-17
19emb|BX816984.1|CNS0AE2C Arabidopsis thaliana Full-length cDNA Co... 98 3e-17
20emb|BX817009.1|CNS0ABWL Arabidopsis thaliana Full-length cDNA Co... 98 3e-17
21emb|BX817138.1|CNS0ABNH Arabidopsis thaliana Full-length cDNA Co... 98 3e-17
22emb|BX818274.1|CNS0AB2B Arabidopsis thaliana Full-length cDNA Co... 92 2e-15
23ref|XM_479153.1| Oryza sativa (japonica cultivar-group), mRNA 90 9e-15
24ref|XM_506463.1| PREDICTED Oryza sativa (japonica cultivar-group... 90 9e-15
25emb|X74733.1|ATL1BETA A.thaliana mRNA for elongation factor 1 beta 90 9e-15
26emb|BX813340.1|CNS0AC3L Arabidopsis thaliana Full-length cDNA Co... 90 9e-15
27emb|BX841878.1|CNS09Y45 Arabidopsis thaliana Full-length cDNA Co... 90 9e-15
28dbj|AK071736.1| Oryza sativa (japonica cultivar-group) cDNA clon... 90 9e-15
29dbj|AK061069.1| Oryza sativa (japonica cultivar-group) cDNA clon... 90 9e-15
30dbj|AK059384.1| Oryza sativa (japonica cultivar-group) cDNA clon... 90 9e-15
31dbj|D23674.1|RICEF1BRB Oryza sativa (japonica cultivar-group) mR... 90 9e-15
32emb|Z97067.1|BVEF1BETA Beta vulgaris mRNA for elongation factor ... 86 1e-13
33gb|DQ235167.1| Solanum tuberosum clone 154B05 ripening regulated... 82 2e-12
34dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 80 8e-12
35dbj|AP005198.3| Oryza sativa (japonica cultivar-group) genomic D... 80 8e-12
36dbj|D13147.1|WHTNANBU Triticum aestivum mRNA for elongation fact... 74 5e-10
37gb|AC007212.7| Arabidopsis thaliana chromosome 2 clone F8D23 map... 70 8e-09
38gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 ma... 70 8e-09
39emb|CR954185.2| Medicago truncatula chromosome 5 clone mth4-20m5... 70 8e-09
40gb|AF204787.1|AF204787 Lycopersicon esculentum ripening regulate... 68 3e-08
41gb|AC134886.5| Oryza sativa chromosome 3 BAC OSJNBa0002D18 genom... 66 1e-07
42gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 66 1e-07
43dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
44dbj|D83726.1| Oryza sativa (japonica cultivar-group) gene for el... 66 1e-07
45gb|DQ207867.1| Solanum tuberosum clone 085E09 putative elongatio... 64 5e-07
46gb|DQ191626.1| Solanum tuberosum unknown mRNA 64 5e-07
47gb|AC073506.11|AC073506 Arabidopsis thaliana chromosome 1 BAC F1... 64 5e-07
48gb|AC136471.1| Solanum demissum chromosome 11 BAC PGEC561 genomi... 60 8e-06
49gb|BC072139.1| Xenopus laevis cDNA clone MGC:80004 IMAGE:6317228... 60 8e-06
50gb|DQ191662.1| Solanum tuberosum elongation factor-like protein ... 60 8e-06
51emb|X85096.1|XLEF1DELT X.laevis mRNA for elongation factor-1 delta 60 8e-06
52emb|X66837.1|XLELF1D X.laevis mRNA for elongation factor 1 delta 60 8e-06
53emb|BX841873.1|CNS09Y2H Arabidopsis thaliana Full-length cDNA Co... 60 8e-06
54gb|BC088696.1| Xenopus laevis elongation factor-1 delta, mRNA (c... 60 8e-06
55gb|BC068905.1| Xenopus laevis elongation factor-1 delta, mRNA (c... 60 8e-06
56ref|NM_121956.2| Arabidopsis thaliana translation elongation fac... 58 3e-05
57ref|NM_121955.2| Arabidopsis thaliana amino acid-polyamine trans... 58 3e-05
58ref|NM_029663.1| Mus musculus eukaryotic translation elongation ... 58 3e-05
59ref|NM_023240.2| Mus musculus eukaryotic translation elongation ... 58 3e-05
60gb|DQ226877.1| Boechera divaricarpa isolate SLW-C-G10 mRNA sequence 58 3e-05
61gb|AY480020.1| Capsicum annuum putative elongation factor 1B alp... 58 3e-05
62gb|AY056354.1| Arabidopsis thaliana putative elongation factor 1... 58 3e-05
63gb|AF360304.1| Arabidopsis thaliana putative elongation factor 1... 58 3e-05
64gb|BC013059.1| Mus musculus eukaryotic translation elongation fa... 58 3e-05
65gb|AF304351.1| Mus musculus eukaryotic translation elongation fa... 58 3e-05
66dbj|AK010347.1| Mus musculus ES cells cDNA, RIKEN full-length en... 58 3e-05
67dbj|AK010308.1| Mus musculus ES cells cDNA, RIKEN full-length en... 58 3e-05
68dbj|AK044934.1| Mus musculus 9.5 days embryo parthenogenote cDNA... 58 3e-05
69dbj|AK017616.1| Mus musculus 8 days embryo whole body cDNA, RIKE... 58 3e-05
70emb|BX830320.1|CNS0A1AJ Arabidopsis thaliana Full-length cDNA Co... 58 3e-05
71emb|BX830295.1|CNS0A1LL Arabidopsis thaliana Full-length cDNA Co... 58 3e-05
72emb|BX832129.1|CNS0A0XD Arabidopsis thaliana Full-length cDNA Co... 58 3e-05
73emb|BX831615.1|CNS0A14O Arabidopsis thaliana Full-length cDNA Co... 58 3e-05
74emb|BX830589.1|CNS0A17N Arabidopsis thaliana Full-length cDNA Co... 58 3e-05
75gb|AY089071.1| Arabidopsis thaliana clone 26936 mRNA, complete s... 58 3e-05
76gb|AF296830.1|T20D1 Arabidopsis thaliana BAC T20D1 58 3e-05
77gb|BC082536.1| Mus musculus cDNA clone IMAGE:5688033, containing... 58 3e-05
78gb|BC079855.1| Mus musculus eukaryotic translation elongation fa... 58 3e-05
79emb|AL645928.9| Mouse DNA sequence from clone RP23-185J21 on chr... 58 3e-05
80gb|DQ306840.1| Hevea brasiliensis isolate SSH111 mRNA sequence 56 1e-04
81gb|DQ306812.1| Hevea brasiliensis isolate SSH83 mRNA sequence 56 1e-04
82gb|L36094.1|RICENDP Oryza sativa unknown ORF mRNA, complete cds 56 1e-04
83gb|BC106340.1| Xenopus laevis elogation factor 1 beta, mRNA (cDN... 54 5e-04
84gb|BC077005.1| Xenopus tropicalis eukaryotic translation elongat... 54 5e-04
85emb|CR761193.2| Xenopus tropicalis finished cDNA, clone TEgg033n03 54 5e-04
86emb|X74734.1|ATHEFBI Arabidopsis thaliana gene for elongation fa... 54 5e-04
87emb|X69764.1|XLEF1B X.laevis mRNA for elongation factor 1 beta 54 5e-04
88ref|NM_001006876.1| Xenopus tropicalis eukaryotic translation el... 54 5e-04
89dbj|AB046366.1| Bombyx mori ef-1d mRNA for elongation factor 1 d... 52 0.002
90gb|AC116520.14| Mus musculus chromosome 15, clone RP24-340J12, c... 50 0.007
91emb|AJ249597.1|ATH249597 Arabidopsis thaliana mRNA for elongatio... 50 0.007
92ref|XM_381184.1| Gibberella zeae PH-1 chromosome 1 hypothetical ... 50 0.007
93emb|AJ721003.1| Gallus gallus mRNA for hypothetical protein, clo... 50 0.007
94gb|BC079391.1| Rattus norvegicus eukaryotic translation elongati... 50 0.007
95emb|CR524341.1| Gallus gallus finished cDNA, clone ChEST813e21 50 0.007
96emb|CR390527.1| Gallus gallus finished cDNA, clone ChEST668b23 50 0.007
97emb|CR387136.1| Gallus gallus finished cDNA, clone ChEST717g5 50 0.007
98emb|BX935857.2| Gallus gallus finished cDNA, clone ChEST165b6 50 0.007
99emb|BX934935.2| Gallus gallus finished cDNA, clone ChEST150n2 50 0.007
100emb|BX930838.2| Gallus gallus finished cDNA, clone ChEST371h16 50 0.007
101emb|BX930783.2| Gallus gallus finished cDNA, clone ChEST974l2 50 0.007
102ref|XM_625024.1| PREDICTED: Apis mellifera similar to elongation... 50 0.007
103ref|NM_001013104.1| Rattus norvegicus eukaryotic translation elo... 50 0.007
104emb|BX933428.1| Gallus gallus finished cDNA, clone ChEST63n8 50 0.007
105emb|BX930051.1| Gallus gallus finished cDNA, clone ChEST976o24 50 0.007
106ref|XM_633643.1| Dictyostelium discoideum elongation factor 1b (... 48 0.029
107gb|U15926.1|DDU15926 Dictyostelium discoideum elongation factor ... 48 0.029
108emb|CR387695.1| Gallus gallus finished cDNA, clone ChEST70j23 48 0.029
109emb|BX933683.2| Gallus gallus finished cDNA, clone ChEST942d7 48 0.029
110emb|BX935015.1| Gallus gallus finished cDNA, clone ChEST301p14 48 0.029
111gb|AY067690.1| Schmidtea mediterranea clone H.94.9h unknown mRNA... 48 0.029
112dbj|AB007025.1| Dictyostelium discoideum DdEF1b mRNA for elongat... 48 0.029
113gb|AY398339.1| Danio rerio clone RK121A4C07 eukaryotic translati... 46 0.11
114ref|XM_519999.1| PREDICTED: Pan troglodytes similar to EEF1D pro... 46 0.11
115gb|BT016181.1| Zea mays clone Contig14 mRNA sequence 46 0.11
116gb|AY432242.1| Aedes aegypti ASAP ID: 43013 translation elongati... 46 0.11
117gb|BC046042.1| Danio rerio eukaryotic translation elongation fac... 46 0.11
118ref|XM_954532.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.11
119gb|BC071840.1| Homo sapiens eukaryotic translation elongation fa... 46 0.11
120ref|XM_325889.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.11
121gb|AY552052.1| Aedes aegypti elongation factor 1 beta mRNA, comp... 46 0.11
122gb|AF370363.1| Homo sapiens FP1047 mRNA, complete cds 46 0.11
123emb|CT009620.9| Zebrafish DNA sequence from clone CH73-187F10 in... 46 0.11
124emb|CR733962.2|CNS0GT3T Tetraodon nigroviridis full-length cDNA 46 0.11
125emb|CR729832.2|CNS0GQ32 Tetraodon nigroviridis full-length cDNA 46 0.11
126emb|CR728847.1|CNS0GPBP Tetraodon nigroviridis full-length cDNA 46 0.11
127emb|CR727009.2|CNS0GNWN Tetraodon nigroviridis full-length cDNA 46 0.11
128emb|CR726703.1|CNS0GNO5 Tetraodon nigroviridis full-length cDNA 46 0.11
129emb|CR726496.2|CNS0GNIE Tetraodon nigroviridis full-length cDNA 46 0.11
130emb|CR723983.1|CNS0GLKL Tetraodon nigroviridis full-length cDNA 46 0.11
131emb|CR713936.2|CNS0GDTO Tetraodon nigroviridis full-length cDNA 46 0.11
132emb|CR703064.2|CNS0G5FO Tetraodon nigroviridis full-length cDNA 46 0.11
133emb|CR700877.2|CNS0G3QX Tetraodon nigroviridis full-length cDNA 46 0.11
134emb|CR695051.2|CNS0FZ93 Tetraodon nigroviridis full-length cDNA 46 0.11
135emb|CR687266.2|CNS0FT8U Tetraodon nigroviridis full-length cDNA 46 0.11
136emb|CR686204.2|CNS0FSFC Tetraodon nigroviridis full-length cDNA 46 0.11
137emb|CR686001.2|CNS0FS9P Tetraodon nigroviridis full-length cDNA 46 0.11
138emb|CR685768.2|CNS0FS38 Tetraodon nigroviridis full-length cDNA 46 0.11
139emb|CR684960.2|CNS0FRGS Tetraodon nigroviridis full-length cDNA 46 0.11
140emb|CR677430.2|CNS0FLO2 Tetraodon nigroviridis full-length cDNA 46 0.11
141emb|CR675506.2|CNS0FK6W Tetraodon nigroviridis full-length cDNA 46 0.11
142emb|CR673642.1|CNS0FIR4 Tetraodon nigroviridis full-length cDNA 46 0.11
143emb|CR672514.2|CNS0FHVS Tetraodon nigroviridis full-length cDNA 46 0.11
144emb|CR672092.2|CNS0FHK2 Tetraodon nigroviridis full-length cDNA 46 0.11
145emb|CR671889.2|CNS0FHEF Tetraodon nigroviridis full-length cDNA 46 0.11
146emb|CR670250.2|CNS0FG4W Tetraodon nigroviridis full-length cDNA 46 0.11
147emb|CR668315.2|CNS0FEN5 Tetraodon nigroviridis full-length cDNA 46 0.11
148emb|CR661446.2|CNS0F9CC Tetraodon nigroviridis full-length cDNA 46 0.11
149emb|CR660398.2|CNS0F8J8 Tetraodon nigroviridis full-length cDNA 46 0.11
150emb|CR659860.2|CNS0F84A Tetraodon nigroviridis full-length cDNA 46 0.11
151emb|CR658451.2|CNS0F715 Tetraodon nigroviridis full-length cDNA 46 0.11
152emb|CR658171.2|CNS0F6TD Tetraodon nigroviridis full-length cDNA 46 0.11
153emb|CR657031.2|CNS0F5XP Tetraodon nigroviridis full-length cDNA 46 0.11
154emb|CR649797.2|CNS0F0CR Tetraodon nigroviridis full-length cDNA 46 0.11
155emb|CR646529.2|CNS0EXTZ Tetraodon nigroviridis full-length cDNA 46 0.11
156emb|CR644730.2|CNS0EWG0 Tetraodon nigroviridis full-length cDNA 46 0.11
157emb|CR642666.2|CNS0EUUO Tetraodon nigroviridis full-length cDNA 46 0.11
158emb|CR639269.1|CNS0ES8B Tetraodon nigroviridis full-length cDNA 46 0.11
159emb|CR638477.2|CNS0ERMB Tetraodon nigroviridis full-length cDNA 46 0.11
160emb|CR636114.2|CNS0EPSO Tetraodon nigroviridis full-length cDNA 46 0.11
161gb|AC182640.3| Pan troglodytes BAC clone CH251-352K16 from chrom... 46 0.11
162ref|XM_968676.1| PREDICTED: Tribolium castaneum similar to CG634... 46 0.11
163emb|Z21507.1|HSEF1DELA H.sapiens EF-1delta gene encoding human e... 46 0.11
164gb|BC094806.1| Homo sapiens eukaryotic translation elongation fa... 46 0.11
165gb|BC062535.1| Homo sapiens eukaryotic translation elongation fa... 46 0.11
166gb|BC000678.2| Homo sapiens eukaryotic translation elongation fa... 46 0.11
167gb|BC007847.2| Homo sapiens eukaryotic translation elongation fa... 46 0.11
168gb|BC009907.2| Homo sapiens eukaryotic translation elongation fa... 46 0.11
169emb|CR938370.1| Single read from an extremity of a full-length c... 46 0.11
170emb|CR938369.1| Single read from an extremity of a full-length c... 46 0.11
171gb|BT008044.1| Synthetic construct Homo sapiens eukaryotic trans... 46 0.11
172gb|BT007242.1| Homo sapiens eukaryotic translation elongation fa... 46 0.11
173gb|BC012819.2| Homo sapiens eukaryotic translation elongation fa... 46 0.11
174gb|AC092691.3| Homo sapiens 3q BAC RP11-768G7 (Roswell Park Canc... 46 0.11
175emb|CR626284.1| full-length cDNA clone CS0CAP008YC23 of Thymus o... 46 0.11
176emb|CR617003.1| full-length cDNA clone CS0DB001YP07 of Neuroblas... 46 0.11
177emb|CR612725.1| full-length cDNA clone CS0DC001YE01 of Neuroblas... 46 0.11
178dbj|AK093756.1| Homo sapiens cDNA FLJ36437 fis, clone THYMU20121... 46 0.11
179emb|CR602809.1| full-length cDNA clone CS0DC028YB08 of Neuroblas... 46 0.11
180emb|CR597518.1| full-length cDNA clone CS0DL005YN23 of B cells (... 46 0.11
181emb|AL116697.1|CNS01DDT Botrytis cinerea strain T4 cDNA library 46 0.11
182emb|AL116510.1|CNS01D8M Botrytis cinerea strain T4 cDNA library 46 0.11
183emb|AL116208.1|CNS01D08 Botrytis cinerea strain T4 cDNA library 46 0.11
184emb|AL115318.1|CNS01CBI Botrytis cinerea strain T4 cDNA library 46 0.11
185emb|AL114622.1|CNS01BS6 Botrytis cinerea strain T4 cDNA library 46 0.11
186emb|AL112302.1|CNS019ZQ Botrytis cinerea strain T4 cDNA library 46 0.11
187emb|AL111685.1|CNS019IL Botrytis cinerea strain T4 cDNA library 46 0.11
188ref|NM_199949.2| Danio rerio eukaryotic translation elongation f... 46 0.11
189emb|AJ538799.1|NTA538799 Nicotiana tabacum cDNA-AFLP-fragment BT... 46 0.11
190gb|AY892424.1| Synthetic construct Homo sapiens clone FLH026417.... 46 0.11
191gb|AY892423.1| Synthetic construct Homo sapiens clone FLH026416.... 46 0.11
192gb|AY889946.1| Synthetic construct Homo sapiens clone FLH026420.... 46 0.11
193dbj|AK024550.1| Homo sapiens cDNA: FLJ20897 fis, clone ADKA03573 46 0.11
194emb|AJ719105.1| Nicotiana tabacum cDNA-AFLP-fragment BSTT1-23-32... 46 0.11
195ref|NM_001960.2| Homo sapiens eukaryotic translation elongation ... 46 0.11
196ref|NM_032378.2| Homo sapiens eukaryotic translation elongation ... 46 0.11
197gb|BC071464.1| Danio rerio eukaryotic translation elongation fac... 46 0.11
198emb|AL833379.1|HSM804692 Homo sapiens mRNA; cDNA DKFZp667K1314 (... 46 0.11
199ref|XM_361991.1| Magnaporthe grisea 70-15 hypothetical protein (... 44 0.45
200gb|AC119825.11| Mus musculus chromosome 3, clone RP23-358O22, co... 44 0.45
201gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete ge... 44 0.45
202gb|AF544990.1| Ovis aries translational elongation factor 1 delt... 44 0.45
203gb|AC121963.3| Mus musculus BAC clone RP24-257C17 from chromosom... 44 0.45
204gb|AC073349.11| Homo sapiens BAC clone RP11-797H7 from 7, comple... 44 0.45
205emb|BX056192.1|CNS09FIS Single read from an extremity of a full-... 44 0.45
206gb|AF366456.1|AF366456 Allium cepa clone API063 maintainer line ... 44 0.45
207emb|AL114417.1|CNS01BMH Botrytis cinerea strain T4 cDNA library 44 0.45
208ref|NM_001009449.1| Ovis aries translational elongation factor 1... 44 0.45
209dbj|AK130207.1| Homo sapiens cDNA FLJ26697 fis, clone PCD00618 44 0.45
210gb|AY849611.1| Magnaporthe grisea elongation factor 1-beta-like ... 44 0.45
211dbj|D13339.1|BMOEF1BP Bombyx mori mRNA for elongation factor 1 b... 44 0.45
212ref|NM_121249.2| Arabidopsis thaliana translation elongation fac... 42 1.8
213gb|L25599.1| Caenorhabditis elegans cosmid F54H12, complete sequ... 42 1.8
214emb|AJ249596.1|ATH249596 Arabidopsis thaliana mRNA for elongatio... 42 1.8
215emb|AL139379.14| Human DNA sequence from clone RP11-358P11 on ch... 42 1.8
216dbj|AB254814.1| Cryptomeria japonica mRNA for putative elongatio... 42 1.8
217gb|BT024774.1| Arabidopsis thaliana At5g12110 mRNA, complete cds 42 1.8
218ref|NM_070415.3| Caenorhabditis elegans Y41E3.10 (Y41E3.10) mRNA... 42 1.8
219ref|NM_066336.2| Caenorhabditis elegans F54H12.6 (F54H12.6) mRNA... 42 1.8
220dbj|AK017796.1| Mus musculus 8 days embryo whole body cDNA, RIKE... 42 1.8
221gb|BT002990.1| Arabidopsis thaliana clone RAFL15-16-K06 (R20516)... 42 1.8
222dbj|AB007727.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 42 1.8
223emb|AJ249598.1|ATH249598 Arabidopsis thaliana mRNA for elongatio... 42 1.8
224emb|Z95559.1|CEY41E3 Caenorhabditis elegans YAC Y41E3, complete ... 42 1.8
225emb|AL844555.8| Mouse DNA sequence from clone RP23-251E2 on chro... 42 1.8
226ref|XM_520696.1| PREDICTED: Pan troglodytes similar to bA526D8.4... 40 7.1
227gb|AC165254.2| Mus musculus BAC clone RP23-285H4 from chromosome... 40 7.1
228gb|BC003899.1| Mus musculus eukaryotic translation elongation fa... 40 7.1
229ref|NM_018796.2| Mus musculus eukaryotic translation elongation ... 40 7.1
230ref|XM_653674.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 7.1
231ref|XM_453023.1| Kluyveromyces lactis NRRL Y-1140, KLLA0C18469g ... 40 7.1
232ref|NM_001010925.1| Homo sapiens ankyrin repeat domain 19 (ANKRD... 40 7.1
233ref|XM_753723.1| Ustilago maydis 521 hypothetical protein (UM026... 40 7.1
234gb|AY444796.1| Pisum sativum translational elongation factor 1 s... 40 7.1
235emb|AL136981.22| Human DNA sequence from clone RP11-526D8 on chr... 40 7.1
236gb|AC108713.2| Homo sapiens 3q BAC RP11-115O13 (Roswell Park Can... 40 7.1
237gb|BC028712.1| Homo sapiens ankyrin repeat domain 19, mRNA (cDNA... 40 7.1
238emb|CR382123.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 40 7.1
239emb|AL645950.13| Mouse DNA sequence from clone RP23-13C17 on chr... 40 7.1
240emb|AL031863.1|DMCEG0003 Drosophila melanogaster cosmid EG0003 40 7.1
241gb|AF523586.1| Gavia immer clone TUMWGi6.1.102 microsatellite se... 40 7.1
242dbj|AK093497.1| Homo sapiens cDNA FLJ36178 fis, clone TESTI2026534 40 7.1
243ref|NM_080069.3| Drosophila melanogaster Elongation factor 1 CG6... 40 7.1
244gb|AC099030.1| Drosophila melanogaster, chromosome 2R, region 53... 40 7.1
245gb|AC099021.1| Drosophila melanogaster, chromosome 2R, region 53... 40 7.1
246emb|AL773587.11| Mouse DNA sequence from clone RP23-38J2 on chro... 40 7.1
247dbj|AK168191.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 40 7.1
248gb|BC040791.1| Mus musculus RIKEN cDNA B230208H17 gene, mRNA (cD... 40 7.1
249gb|BC006855.1| Mus musculus RIKEN cDNA B230208H17 gene, mRNA (cD... 40 7.1
250gb|AF029844.2|AF029844 Mus musculus elongation factor 1-beta hom... 40 7.1
251gb|AF362573.1|AF362573 Mus musculus L115 (L115) mRNA, complete cds 40 7.1
252dbj|AK012756.1| Mus musculus 10, 11 days embryo whole body cDNA,... 40 7.1
253gb|BC023139.1| Mus musculus eukaryotic translation elongation fa... 40 7.1
254dbj|AK027911.1| Mus musculus adult male kidney cDNA, RIKEN full-... 40 7.1
255gb|AC084454.1|AC084454 Caenorhabditis briggsae cosmid CB027J01, ... 40 7.1
256gb|AF172636.1| Drosophila melanogaster LD24492 full insert cDNA 40 7.1
257gb|AY909456.1| Siniperca chuatsi clone C279 translation elongati... 40 7.1
258gb|BC038951.1| Homo sapiens ankyrin repeat domain 19, mRNA (cDNA... 40 7.1
259gb|AE003805.3| Drosophila melanogaster chromosome 2R, section 45... 40 7.1
260emb|BX936400.1| Yersinia pseudotuberculosis IP32953 cryptic plas... 40 7.1
261gb|BC110782.1| Xenopus laevis cDNA clone IMAGE:7391768 40 7.1
262gb|AC004641.1|AC004641 Drosophila melanogaster DNA sequence (P1s... 40 7.1
263emb|CT032647.1| Platynereis dumerilii EST IB0AAA34BA06EM1 40 7.1
264emb|CT032646.1| Platynereis dumerilii EST IB0AAA34BA06FM1 40 7.1
265emb|CT032313.1| Platynereis dumerilii EST IB0AAA40DD04EM1 40 7.1
266emb|CT032312.1| Platynereis dumerilii EST IB0AAA40DD04FM1 40 7.1
267gb|AY227782.3| Bos taurus T cell receptor alpha (TCRA) gene, J s... 40 7.1
268emb|AL732590.7| Mouse DNA sequence from clone RP23-464C2 on chro... 40 7.1
269gb|BC039635.1| Mus musculus, eukaryotic translation elongation f... 40 7.1
270emb|AL365333.13| Mouse DNA sequence from clone RP21-490L20 on ch... 40 7.1

>emb|AJ277799.1|HVU277799 Hordeum vulgare mRNA for putative elongation factor 1 beta
           (eEF1Bbeta 25 gene)
          Length = 1000

 Score =  993 bits (501), Expect = 0.0
 Identities = 517/523 (98%)
 Strand = Plus / Minus

                                                                       
Query: 1   gaatcccaccacattgtctcatttcatacgatgcaaacaacactcagtagtaatactacg 60
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 984 gaatccaaccacattgtctcatttcatacgatgcaaacaacactcagtagtaatactacg 925

                                                                       
Query: 61  accaaactcaacctaaggtccaaaaacctcacagggcagaatatgttatgctgctttagc 120
           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 924 acaaaactcaacctaaggtccaaaaacctcacagggcagaatatgttatgctgctttagc 865

                                                                       
Query: 121 tacgacaccatcatggcaacgggaaactgtagacatattgtttgtgctgctgcattgtcc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 864 tacgacaccatcatggcaacgggaaactgtagacatattgtttgtgctgctgcattgtcc 805

                                                                       
Query: 181 accgaccgcaatcacgaacctcgggaagatttagattttgttgaaggcaacaatgtcaca 240
           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 804 accgaccacaatcacgaacctcgggaagatttagattttgttgaaggcaacaatgtcaca 745

                                                                       
Query: 241 gctctggatgtactcgttcgctggttcgacgcacagatggtcttcaatcagagtgtcaac 300
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 744 gctctggatgtactcgttcgctggttcaacgcacagatggtcttcaatcagagtgtcaac 685

                                                                       
Query: 301 agagacnaggtcatcaatgatggtcatcataatctggagcttcttgatgccatatccnac 360
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 684 agagacaaggtcatcaatgatggtcatcataatctggagcttcttgatgccatatccaac 625

                                                                       
Query: 361 tggcatgagcttggaagcaccccacagaaggccctccatcttgatgcttcggacagcttc 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 624 tggcatgagcttggaagcaccccacagaaggccctccatcttgatgcttcggacagcttc 565

                                                                       
Query: 421 ctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaaactgatga 480
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 564 ctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaaactgatga 505

                                                      
Query: 481 cttgccagattctttcttcttggtagatgccttcgctttggca 523
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 504 cttgccagattctttcttcttggtagatgccttcgctttggca 462



to top

>gb|AY111648.1| Zea mays CL2935_1 mRNA sequence
          Length = 1119

 Score =  246 bits (124), Expect = 6e-62
 Identities = 251/294 (85%)
 Strand = Plus / Plus

                                                                       
Query: 209 atttagattttgttgaaggcaacaatgtcacagctctggatgtactcgttcgctggttcg 268
           |||||||| ||||||||||| |||||||| |||||||||| ||| ||| || |||| || 
Sbjct: 319 atttagatcttgttgaaggcgacaatgtcgcagctctggacgtattcgctcactggctca 378

                                                                       
Query: 269 acgcacagatggtcttcaatcagagtgtcaacagagacnaggtcatcaatgatggtcatc 328
            |||| |||||||| || || ||||||||||||||||| |||||||| |  |||||||||
Sbjct: 379 gcgcagagatggtcctcgatgagagtgtcaacagagacaaggtcatcgacaatggtcatc 438

                                                                       
Query: 329 ataatctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacaga 388
           || || || |||||||||||||||||||| ||||| |  |||||||| || ||||| || 
Sbjct: 439 atgatttgcagcttcttgatgccatatccaactgggacaagcttggatgcgccccaaagc 498

                                                                       
Query: 389 aggccctccatcttgatgcttcggacagcttcctctagcttgaccatgtcagtctcatca 448
           || || ||||||| ||  || |  ||||||||||| |||||| |||||||||||||||| 
Sbjct: 499 agcccttccatctggacactcctaacagcttcctcgagcttggccatgtcagtctcatcg 558

                                                                 
Query: 449 tcccatggcttaacatcaagcaaaactgatgacttgccagattctttcttcttg 502
           ||||||||||| |||||||| |||||||||||||| ||||||||||||||||||
Sbjct: 559 tcccatggcttcacatcaagtaaaactgatgacttcccagattctttcttcttg 612



to top

>gb|BT016185.1| Zea mays clone Contig18 mRNA sequence
          Length = 1070

 Score =  240 bits (121), Expect = 4e-60
 Identities = 248/291 (85%)
 Strand = Plus / Minus

                                                                       
Query: 212 tagattttgttgaaggcaacaatgtcacagctctggatgtactcgttcgctggttcgacg 271
           ||||| |||||||||||||| ||||| |||||||| | |||||||||| |||| ||  ||
Sbjct: 820 tagatcttgttgaaggcaactatgtcgcagctctgcacgtactcgttcactggctcagcg 761

                                                                       
Query: 272 cacagatggtcttcaatcagagtgtcaacagagacnaggtcatcaatgatggtcatcata 331
           ||||||| ||| ||||| |||||||| |||||||| ||||| || | |||||||||||| 
Sbjct: 760 cacagatagtcctcaatgagagtgtcgacagagacaaggtcgtcgacgatggtcatcatg 701

                                                                       
Query: 332 atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
           || || ||||||||||| |||||||| ||||| |  |||||||| || ||||| || || 
Sbjct: 700 atttgcagcttcttgataccatatccaactgggacaagcttggatgcgccccagagcagc 641

                                                                       
Query: 392 ccctccatcttgatgcttcggacagcttcctctagcttgaccatgtcagtctcatcatcc 451
           || ||||||| ||  || |  ||||||||||| |||||| |||||||||||||||| |||
Sbjct: 640 ccttccatctggacactcctaacagcttcctcgagcttggccatgtcagtctcatcgtcc 581

                                                              
Query: 452 catggcttaacatcaagcaaaactgatgacttgccagattctttcttcttg 502
           |||||||| |||||||| |||||||||||||| ||||||||||||||||||
Sbjct: 580 catggcttcacatcaagtaaaactgatgacttcccagattctttcttcttg 530



to top

>gb|BT016424.1| Zea mays clone Contig257 mRNA sequence
          Length = 1064

 Score =  236 bits (119), Expect = 6e-59
 Identities = 243/285 (85%)
 Strand = Plus / Minus

                                                                       
Query: 218 ttgttgaaggcaacaatgtcacagctctggatgtactcgttcgctggttcgacgcacaga 277
           |||||||||||||| ||||| |||||||| | |||||||||| |||| ||  ||||||||
Sbjct: 786 ttgttgaaggcaactatgtcgcagctctgcacgtactcgttcactggctcagcgcacaga 727

                                                                       
Query: 278 tggtcttcaatcagagtgtcaacagagacnaggtcatcaatgatggtcatcataatctgg 337
           | ||| ||||| |||||||| |||||||| ||||| || | |||||||||||| || || 
Sbjct: 726 tagtcctcaatgagagtgtcgacagagacaaggtcgtcgacgatggtcatcatgatttgc 667

                                                                       
Query: 338 agcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaaggccctcc 397
           ||||||||||| |||||||| ||||| |  |||||||| || ||||| || || || |||
Sbjct: 666 agcttcttgataccatatccaactgggacaagcttggatgcgccccagagcagcccttcc 607

                                                                       
Query: 398 atcttgatgcttcggacagcttcctctagcttgaccatgtcagtctcatcatcccatggc 457
           |||| ||  || |  ||||||||||| |||||| |||||||||||||||| |||||||||
Sbjct: 606 atctggacactcctaacagcttcctcgagcttggccatgtcagtctcatcgtcccatggc 547

                                                        
Query: 458 ttaacatcaagcaaaactgatgacttgccagattctttcttcttg 502
           || |||||||| |||||||||||||| ||||||||||||||||||
Sbjct: 546 ttcacatcaagtaaaactgatgacttcccagattctttcttcttg 502



to top

>gb|AY103717.1| Zea mays PCO098989 mRNA sequence
          Length = 1312

 Score =  200 bits (101), Expect = 3e-48
 Identities = 243/291 (83%)
 Strand = Plus / Minus

                                                                       
Query: 212 tagattttgttgaaggcaacaatgtcacagctctggatgtactcgttcgctggttcgacg 271
           ||||| |||||||||||||| ||||| || ||||| | |||||||||  |||| ||  ||
Sbjct: 986 tagatcttgttgaaggcaactatgtcgcaactctgtacgtactcgttaactggctcagcg 927

                                                                       
Query: 272 cacagatggtcttcaatcagagtgtcaacagagacnaggtcatcaatgatggtcatcata 331
           ||||||| ||| ||||| |||||||| |||||||| ||||| || | |||||||||||| 
Sbjct: 926 cacagatagtcctcaatgagagtgtcgacagagacaaggtcgtcgacgatggtcatcatg 867

                                                                       
Query: 332 atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
           || || ||||||||||| |||||||| ||||| |  |||||||| || ||||| || |  
Sbjct: 866 atttgcagcttcttgataccatatccaactgggacaagcttggatgcgccccagagcaac 807

                                                                       
Query: 392 ccctccatcttgatgcttcggacagcttcctctagcttgaccatgtcagtctcatcatcc 451
           || ||||||| ||  || |  ||||||||||| |||||| |||||||||||||||| |||
Sbjct: 806 ccttccatctggacactcctaacagcttcctcgagcttggccatgtcagtctcatcgtcc 747

                                                              
Query: 452 catggcttaacatcaagcaaaactgatgacttgccagattctttcttcttg 502
           |||||||| |||||||| |||||||| || || ||||||||||||||||||
Sbjct: 746 catggcttcacatcaagtaaaactgacgatttcccagattctttcttcttg 696



to top

>dbj|AK073405.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033042N03, full
           insert sequence
          Length = 933

 Score =  139 bits (70), Expect = 1e-29
 Identities = 236/292 (80%)
 Strand = Plus / Minus

                                                                       
Query: 210 tttagattttgttgaaggcaacaatgtcacagctctggatgtactcgttcgctggttcga 269
           |||||||||||||||| |||||||||||||| ||||| ||  |||| || ||||||||  
Sbjct: 772 tttagattttgttgaaagcaacaatgtcacaactctgaataaactcattagctggttccg 713

                                                                       
Query: 270 cgcacagatggtcttcaatcagagtgtcaacagagacnaggtcatcaatgatggtcatca 329
            | | | ||  || ||||| ||| |||| ||||| || || || || |  ||||||||||
Sbjct: 712 tgtaaaaataatcctcaatgagactgtccacagaaacaagatcgtccacaatggtcatca 653

                                                                       
Query: 330 taatctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaa 389
           |||| || | |||||||||||||||||| ||||| |  || ||||| |||||||| || |
Sbjct: 652 taatttgcaacttcttgatgccatatccaactggtacaagtttggatgcaccccagagca 593

                                                                       
Query: 390 ggccctccatcttgatgcttcggacagcttcctctagcttgaccatgtcagtctcatcat 449
           ||||||||||||| |   | |  ||||||||||| |||||  ||||||| || || ||||
Sbjct: 592 ggccctccatcttcacattcctcacagcttcctcaagctttgccatgtctgtttcgtcat 533

                                                               
Query: 450 cccatggcttaacatcaagcaaaactgatgacttgccagattctttcttctt 501
           |||||||||| ||||| |||| ||| ||||| || |||||||||||||||||
Sbjct: 532 cccatggctttacatctagcagaaccgatgatttcccagattctttcttctt 481



to top

>dbj|AK059914.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-209-E04, full
           insert sequence
          Length = 972

 Score =  139 bits (70), Expect = 1e-29
 Identities = 236/292 (80%)
 Strand = Plus / Minus

                                                                       
Query: 210 tttagattttgttgaaggcaacaatgtcacagctctggatgtactcgttcgctggttcga 269
           |||||||||||||||| |||||||||||||| ||||| ||  |||| || ||||||||  
Sbjct: 803 tttagattttgttgaaagcaacaatgtcacaactctgaataaactcattagctggttccg 744

                                                                       
Query: 270 cgcacagatggtcttcaatcagagtgtcaacagagacnaggtcatcaatgatggtcatca 329
            | | | ||  || ||||| ||| |||| ||||| || || || || |  ||||||||||
Sbjct: 743 tgtaaaaataatcctcaatgagactgtccacagaaacaagatcgtccacaatggtcatca 684

                                                                       
Query: 330 taatctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaa 389
           |||| || | |||||||||||||||||| ||||| |  || ||||| |||||||| || |
Sbjct: 683 taatttgcaacttcttgatgccatatccaactggtacaagtttggatgcaccccagagca 624

                                                                       
Query: 390 ggccctccatcttgatgcttcggacagcttcctctagcttgaccatgtcagtctcatcat 449
           ||||||||||||| |   | |  ||||||||||| |||||  ||||||| || || ||||
Sbjct: 623 ggccctccatcttcacattcctcacagcttcctcaagctttgccatgtctgtttcgtcat 564

                                                               
Query: 450 cccatggcttaacatcaagcaaaactgatgacttgccagattctttcttctt 501
           |||||||||| ||||| |||| ||| ||||| || |||||||||||||||||
Sbjct: 563 cccatggctttacatctagcagaaccgatgatttcccagattctttcttctt 512



to top

>dbj|D83727.1| Oryza sativa (japonica cultivar-group) mRNA for elongation factor 1
           beta 2, complete cds
          Length = 1350

 Score =  139 bits (70), Expect = 1e-29
 Identities = 236/292 (80%)
 Strand = Plus / Minus

                                                                       
Query: 210 tttagattttgttgaaggcaacaatgtcacagctctggatgtactcgttcgctggttcga 269
           |||||||||||||||| |||||||||||||| ||||| ||  |||| || ||||||||  
Sbjct: 781 tttagattttgttgaaagcaacaatgtcacaactctgaataaactcattagctggttccg 722

                                                                       
Query: 270 cgcacagatggtcttcaatcagagtgtcaacagagacnaggtcatcaatgatggtcatca 329
            | | | ||  || ||||| ||| |||| ||||| || || || || |  ||||||||||
Sbjct: 721 tgtaaaaataatcctcaatgagactgtccacagaaacaagatcgtccacaatggtcatca 662

                                                                       
Query: 330 taatctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaa 389
           |||| || | |||||||||||||||||| ||||| |  || ||||| |||||||| || |
Sbjct: 661 taatttgcaacttcttgatgccatatccaactggtacaagtttggatgcaccccagagca 602

                                                                       
Query: 390 ggccctccatcttgatgcttcggacagcttcctctagcttgaccatgtcagtctcatcat 449
           ||||||||||||| |   | |  ||||||||||| |||||  ||||||| || || ||||
Sbjct: 601 ggccctccatcttcacattcctcacagcttcctcaagctttgccatgtctgtttcgtcat 542

                                                               
Query: 450 cccatggcttaacatcaagcaaaactgatgacttgccagattctttcttctt 501
           |||||||||| ||||| |||| ||| ||||| || |||||||||||||||||
Sbjct: 541 cccatggctttacatctagcagaaccgatgatttcccagattctttcttctt 490



to top

>gb|U87222.1|PBU87222 Pimpinella brachycarpa elongation factor 1-beta (EF-1-beta) mRNA,
           complete cds
          Length = 969

 Score =  113 bits (57), Expect = 6e-22
 Identities = 169/207 (81%)
 Strand = Plus / Minus

                                                                       
Query: 295 gtcaacagagacnaggtcatcaatgatggtcatcataatctggagcttcttgatgccata 354
           ||||||||| || | |||||| |  ||||||| |||||| || |||||||| || |||||
Sbjct: 650 gtcaacagacactaagtcatctacaatggtcaacataatttgcagcttctttataccata 591

                                                                       
Query: 355 tccnactggcatgagcttggaagcaccccacagaaggccctccatcttgatgcttcggac 414
           ||| || |  |  |||||||| || ||||| || | ||| ||||||||||| ||||  ||
Sbjct: 590 tccaacagctacaagcttggatgctccccaaagcaagccatccatcttgatacttctaac 531

                                                                       
Query: 415 agcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaaac 474
           ||||||||| |||||   ||||||||| |||||||||||||| || ||||| | ||| ||
Sbjct: 530 agcttcctcaagcttcgtcatgtcagtttcatcatcccatggttttacatccaacaagac 471

                                      
Query: 475 tgatgacttgccagattctttcttctt 501
           ||||||||| || ||||||||||||||
Sbjct: 470 tgatgacttaccggattctttcttctt 444



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 209 atttagattttgttgaaggcaacaatgtcacagctctggatgtactcgttcgctgg 264
           ||||| ||||| || || |||||||| |||||||||||||||||||| ||||||||
Sbjct: 736 atttatattttattaaacgcaacaatatcacagctctggatgtactcattcgctgg 681



to top

>ref|NM_127367.1| Arabidopsis thaliana translation elongation factor AT2G18110 mRNA,
           complete cds
          Length = 974

 Score =  107 bits (54), Expect = 4e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 413 acagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaa 472
           |||||||||||||||||   |||||| |||||||||||||| ||||| | ||| | ||||
Sbjct: 577 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccatcaaa 518

                                                     
Query: 473 actgatgacttgccagattctttcttcttggtagatgccttc 514
           ||||||||||| || |||||||||||||| ||||||||||||
Sbjct: 517 actgatgactttccggattctttcttctttgtagatgccttc 476



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 218 ttgttgaaggcaacaatgtcacagctctgga 248
           ||||||||||||||||||||||| |||||||
Sbjct: 772 ttgttgaaggcaacaatgtcacaactctgga 742



to top

>gb|AY081568.1| Arabidopsis thaliana putative elongation factor 1-beta (At2g18110)
           mRNA, complete cds
          Length = 805

 Score =  107 bits (54), Expect = 4e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 413 acagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaa 472
           |||||||||||||||||   |||||| |||||||||||||| ||||| | ||| | ||||
Sbjct: 494 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccatcaaa 435

                                                     
Query: 473 actgatgacttgccagattctttcttcttggtagatgccttc 514
           ||||||||||| || |||||||||||||| ||||||||||||
Sbjct: 434 actgatgactttccggattctttcttctttgtagatgccttc 393



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 218 ttgttgaaggcaacaatgtcacagctctgga 248
           ||||||||||||||||||||||| |||||||
Sbjct: 689 ttgttgaaggcaacaatgtcacaactctgga 659



to top

>gb|AY065159.1| Arabidopsis thaliana putative elongation factor 1-beta (At2g18110;
           F8D23.11) mRNA, complete cds
          Length = 928

 Score =  107 bits (54), Expect = 4e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 413 acagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaa 472
           |||||||||||||||||   |||||| |||||||||||||| ||||| | ||| | ||||
Sbjct: 575 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccatcaaa 516

                                                     
Query: 473 actgatgacttgccagattctttcttcttggtagatgccttc 514
           ||||||||||| || |||||||||||||| ||||||||||||
Sbjct: 515 actgatgactttccggattctttcttctttgtagatgccttc 474



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 218 ttgttgaaggcaacaatgtcacagctctgga 248
           ||||||||||||||||||||||| |||||||
Sbjct: 770 ttgttgaaggcaacaatgtcacaactctgga 740



to top

>emb|BX820727.1|CNS0A8QL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH63ZE01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 920

 Score =  107 bits (54), Expect = 4e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 413 acagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaa 472
           |||||||||||||||||   |||||| |||||||||||||| ||||| | ||| | ||||
Sbjct: 564 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccatcaaa 505

                                                     
Query: 473 actgatgacttgccagattctttcttcttggtagatgccttc 514
           ||||||||||| || |||||||||||||| ||||||||||||
Sbjct: 504 actgatgactttccggattctttcttctttgtagatgccttc 463



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 218 ttgttgaaggcaacaatgtcacagctctgga 248
           ||||||||||||||||||||||| |||||||
Sbjct: 759 ttgttgaaggcaacaatgtcacaactctgga 729



to top

>emb|BX820611.1|CNS0A8PL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH52ZC12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 900

 Score =  107 bits (54), Expect = 4e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 413 acagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaa 472
           |||||||||||||||||   |||||| |||||||||||||| ||||| | ||| | ||||
Sbjct: 544 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccatcaaa 485

                                                     
Query: 473 actgatgacttgccagattctttcttcttggtagatgccttc 514
           ||||||||||| || |||||||||||||| ||||||||||||
Sbjct: 484 actgatgactttccggattctttcttctttgtagatgccttc 443



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 218 ttgttgaaggcaacaatgtcacagctctgga 248
           ||||||||||||||||||||||| |||||||
Sbjct: 739 ttgttgaaggcaacaatgtcacaactctgga 709



to top

>gb|AY087429.1| Arabidopsis thaliana clone 35337 mRNA, complete sequence
          Length = 974

 Score =  107 bits (54), Expect = 4e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 413 acagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaa 472
           |||||||||||||||||   |||||| |||||||||||||| ||||| | ||| | ||||
Sbjct: 577 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccatcaaa 518

                                                     
Query: 473 actgatgacttgccagattctttcttcttggtagatgccttc 514
           ||||||||||| || |||||||||||||| ||||||||||||
Sbjct: 517 actgatgactttccggattctttcttctttgtagatgccttc 476



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 218 ttgttgaaggcaacaatgtcacagctctgga 248
           ||||||||||||||||||||||| |||||||
Sbjct: 772 ttgttgaaggcaacaatgtcacaactctgga 742



to top

>emb|BX842001.1|CNS09Y84 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB64ZA01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 824

 Score =  105 bits (53), Expect = 1e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                       
Query: 413 acagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaa 472
           |||||||||||||||||   |||||| |||||||||||||| ||||| | ||| | ||||
Sbjct: 523 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccatcaaa 464

                                                    
Query: 473 actgatgacttgccagattctttcttcttggtagatgcctt 513
           ||||||||||| || |||||||||||||| |||||||||||
Sbjct: 463 actgatgactttccggattctttcttctttgtagatgcctt 423



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 218 ttgttgaaggcaacaatgtcacagctctgga 248
           |||||||||||||||||||| || |||||||
Sbjct: 718 ttgttgaaggcaacaatgtcgcaactctgga 688



to top

>emb|BX820768.1|CNS0A8OK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH68ZB10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 558

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 413 acagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaa 472
           |||||||||||||||||   |||||| || ||||||||||| ||||| | ||| | ||||
Sbjct: 201 acagcttcctctagcttcttcatgtccgtttcatcatcccacggcttgatatccatcaaa 142

                                                     
Query: 473 actgatgacttgccagattctttcttcttggtagatgccttc 514
           ||||||||||| || |||||||||||||| ||||||||||||
Sbjct: 141 actgatgactttccggattctttcttctttgtagatgccttc 100



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 218 ttgttgaaggcaacaatgtcacagctctgga 248
           ||||||||||||||||||||||| |||||||
Sbjct: 396 ttgttgaaggcaacaatgtcacaactctgga 366



to top

>ref|NM_102762.2| Arabidopsis thaliana translation elongation factor AT1G30230 mRNA,
           complete cds
          Length = 1028

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 88/101 (87%)
 Strand = Plus / Minus

                                                                       
Query: 413 acagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaa 472
           ||||||||||| |||||   ||||||||||||||||||||| || || | ||||| ||||
Sbjct: 568 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgatatcaatcaaa 509

                                                    
Query: 473 actgatgacttgccagattctttcttcttggtagatgcctt 513
           ||||| ||||| |||||||| |||||||| |||||||||||
Sbjct: 508 actgaggactttccagattccttcttctttgtagatgcctt 468



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 218 ttgttgaaggcaacaatgtcacagctctgga 248
           |||||||||||||||||||||||||||||||
Sbjct: 763 ttgttgaaggcaacaatgtcacagctctgga 733



to top

>emb|BX816984.1|CNS0AE2C Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH7ZA05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 728

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 88/101 (87%)
 Strand = Plus / Minus

                                                                       
Query: 413 acagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaa 472
           ||||||||||| |||||   ||||||||||||||||||||| || || | ||||| ||||
Sbjct: 353 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgatatcaatcaaa 294

                                                    
Query: 473 actgatgacttgccagattctttcttcttggtagatgcctt 513
           ||||| ||||| |||||||| |||||||| |||||||||||
Sbjct: 293 actgaggactttccagattccttcttctttgtagatgcctt 253



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 218 ttgttgaaggcaacaatgtcacagctctgga 248
           |||||||||||||||||||||||||||||||
Sbjct: 548 ttgttgaaggcaacaatgtcacagctctgga 518



to top

>emb|BX817009.1|CNS0ABWL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH80ZD06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 908

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 88/101 (87%)
 Strand = Plus / Minus

                                                                       
Query: 413 acagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaa 472
           ||||||||||| |||||   ||||||||||||||||||||| || || | ||||| ||||
Sbjct: 546 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgatatcaatcaaa 487

                                                    
Query: 473 actgatgacttgccagattctttcttcttggtagatgcctt 513
           ||||| ||||| |||||||| |||||||| |||||||||||
Sbjct: 486 actgaggactttccagattccttcttctttgtagatgcctt 446



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 218 ttgttgaaggcaacaatgtcacagctctgga 248
           |||||||||||||||||||||||||||||||
Sbjct: 741 ttgttgaaggcaacaatgtcacagctctgga 711



to top

>emb|BX817138.1|CNS0ABNH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH89ZB09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 925

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 88/101 (87%)
 Strand = Plus / Minus

                                                                       
Query: 413 acagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaa 472
           ||||||||||| |||||   ||||||||||||||||||||| || || | ||||| ||||
Sbjct: 559 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgatatcaatcaaa 500

                                                    
Query: 473 actgatgacttgccagattctttcttcttggtagatgcctt 513
           ||||| ||||| |||||||| |||||||| |||||||||||
Sbjct: 499 actgaggactttccagattccttcttctttgtagatgcctt 459



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 218 ttgttgaaggcaacaatgtcacagctctgga 248
           |||||||||||||||||||||||||||||||
Sbjct: 754 ttgttgaaggcaacaatgtcacagctctgga 724



to top

>emb|BX818274.1|CNS0AB2B Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL6ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 879

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 413 acagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaa 472
           ||||||||||| |||||   ||||| ||||||||||||||| || || | ||||| ||||
Sbjct: 517 acagcttcctcaagcttcttcatgtgagtctcatcatcccacggtttgatatcaatcaaa 458

                                                     
Query: 473 actgatgacttgccagattctttcttcttggtagatgccttc 514
           ||||| ||||| |||||||| |||||||| ||||||||||||
Sbjct: 457 actgaggactttccagattccttcttctttgtagatgccttc 416



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 218 ttgttgaaggcaacaatgtcacagctctgga 248
           ||||||||||||||||||| |||||||||||
Sbjct: 712 ttgttgaaggcaacaatgtgacagctctgga 682



to top

>ref|XM_479153.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1025

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                       
Query: 204 ggaagatttagattttgttgaaggcaacaatgtcacagctctggatgtactcgttcgctg 263
           ||||||| ||||| |||||||| ||||||||||| ||||||||||||||||| |||||||
Sbjct: 804 ggaagatctagatcttgttgaacgcaacaatgtcgcagctctggatgtactcattcgctg 745

                
Query: 264 gttcg 268
           |||||
Sbjct: 744 gttcg 740



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 63/70 (90%)
 Strand = Plus / Minus

                                                                       
Query: 433 catgtcagtctcatcatcccatggcttaacatcaagcaaaactgatgacttgccagattc 492
           ||||||||||||||| |||||||| || ||||||||||| ||||| ||||| ||||||||
Sbjct: 575 catgtcagtctcatcgtcccatggtttgacatcaagcaacactgaggacttcccagattc 516

                     
Query: 493 tttcttcttg 502
            |||||||||
Sbjct: 515 cttcttcttg 506



to top

>ref|XM_506463.1| PREDICTED Oryza sativa (japonica cultivar-group), P0616D06.117 mRNA
          Length = 1363

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                       
Query: 204 ggaagatttagattttgttgaaggcaacaatgtcacagctctggatgtactcgttcgctg 263
           ||||||| ||||| |||||||| ||||||||||| ||||||||||||||||| |||||||
Sbjct: 799 ggaagatctagatcttgttgaacgcaacaatgtcgcagctctggatgtactcattcgctg 740

                
Query: 264 gttcg 268
           |||||
Sbjct: 739 gttcg 735



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 63/70 (90%)
 Strand = Plus / Minus

                                                                       
Query: 433 catgtcagtctcatcatcccatggcttaacatcaagcaaaactgatgacttgccagattc 492
           ||||||||||||||| |||||||| || ||||||||||| ||||| ||||| ||||||||
Sbjct: 570 catgtcagtctcatcgtcccatggtttgacatcaagcaacactgaggacttcccagattc 511

                     
Query: 493 tttcttcttg 502
            |||||||||
Sbjct: 510 cttcttcttg 501



to top

>emb|X74733.1|ATL1BETA A.thaliana mRNA for elongation factor 1 beta
          Length = 900

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 433 catgtcagtctcatcatcccatggcttaacatcaagcaaaactgatgacttgccagattc 492
           ||||||||||||||||||||| || || | ||||| ||||||||| ||||| ||||||||
Sbjct: 519 catgtcagtctcatcatcccacggtttgatatcaatcaaaactgaggactttccagattc 460

                                
Query: 493 tttcttcttggtagatgcctt 513
            |||||||| |||||||||||
Sbjct: 459 cttcttctttgtagatgcctt 439



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 218 ttgttgaaggcaacaatgtcacagctctgga 248
           |||||||||||||||||||||||||||||||
Sbjct: 734 ttgttgaaggcaacaatgtcacagctctgga 704



to top

>emb|BX813340.1|CNS0AC3L Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB10ZC06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 699

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 87/101 (86%)
 Strand = Plus / Minus

                                                                       
Query: 413 acagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaa 472
           ||||||||||| |||||   ||||| ||||||||||||||| || || | ||||| ||||
Sbjct: 336 acagcttcctcaagcttcttcatgtaagtctcatcatcccacggtttgatatcaatcaaa 277

                                                    
Query: 473 actgatgacttgccagattctttcttcttggtagatgcctt 513
           ||||| ||||| |||||||| |||||||| |||||||||||
Sbjct: 276 actgaggactttccagattccttcttctttgtagatgcctt 236



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 218 ttgttgaaggcaacaatgtcacagctctgga 248
           |||||||||||||||||||||||||||||||
Sbjct: 531 ttgttgaaggcaacaatgtcacagctctgga 501



to top

>emb|BX841878.1|CNS09Y45 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH80ZE05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 895

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 87/101 (86%)
 Strand = Plus / Minus

                                                                       
Query: 413 acagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaa 472
           ||||||||||| |||||   ||||||||| ||||||||||| || || | ||||| ||||
Sbjct: 533 acagcttcctcaagcttcttcatgtcagtttcatcatcccacggtttgatatcaatcaaa 474

                                                    
Query: 473 actgatgacttgccagattctttcttcttggtagatgcctt 513
           ||||| ||||| |||||||| |||||||| |||||||||||
Sbjct: 473 actgaggactttccagattccttcttctttgtagatgcctt 433



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 218 ttgttgaaggcaacaatgtcacagctctgga 248
           ||||||||||||| ||||| |||||||||||
Sbjct: 728 ttgttgaaggcaaaaatgtaacagctctgga 698



to top

>dbj|AK071736.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023109L04, full
           insert sequence
          Length = 1364

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                       
Query: 204 ggaagatttagattttgttgaaggcaacaatgtcacagctctggatgtactcgttcgctg 263
           ||||||| ||||| |||||||| ||||||||||| ||||||||||||||||| |||||||
Sbjct: 799 ggaagatctagatcttgttgaacgcaacaatgtcgcagctctggatgtactcattcgctg 740

                
Query: 264 gttcg 268
           |||||
Sbjct: 739 gttcg 735



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 63/70 (90%)
 Strand = Plus / Minus

                                                                       
Query: 433 catgtcagtctcatcatcccatggcttaacatcaagcaaaactgatgacttgccagattc 492
           ||||||||||||||| |||||||| || ||||||||||| ||||| ||||| ||||||||
Sbjct: 570 catgtcagtctcatcgtcccatggtttgacatcaagcaacactgaggacttcccagattc 511

                     
Query: 493 tttcttcttg 502
            |||||||||
Sbjct: 510 cttcttcttg 501



to top

>dbj|AK061069.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-206-C03, full
           insert sequence
          Length = 1025

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                       
Query: 204 ggaagatttagattttgttgaaggcaacaatgtcacagctctggatgtactcgttcgctg 263
           ||||||| ||||| |||||||| ||||||||||| ||||||||||||||||| |||||||
Sbjct: 804 ggaagatctagatcttgttgaacgcaacaatgtcgcagctctggatgtactcattcgctg 745

                
Query: 264 gttcg 268
           |||||
Sbjct: 744 gttcg 740



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 63/70 (90%)
 Strand = Plus / Minus

                                                                       
Query: 433 catgtcagtctcatcatcccatggcttaacatcaagcaaaactgatgacttgccagattc 492
           ||||||||||||||| |||||||| || ||||||||||| ||||| ||||| ||||||||
Sbjct: 575 catgtcagtctcatcgtcccatggtttgacatcaagcaacactgaggacttcccagattc 516

                     
Query: 493 tttcttcttg 502
            |||||||||
Sbjct: 515 cttcttcttg 506



to top

>dbj|AK059384.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-026-G07, full
           insert sequence
          Length = 636

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                       
Query: 204 ggaagatttagattttgttgaaggcaacaatgtcacagctctggatgtactcgttcgctg 263
           ||||||| ||||| |||||||| ||||||||||| ||||||||||||||||| |||||||
Sbjct: 421 ggaagatctagatcttgttgaacgcaacaatgtcgcagctctggatgtactcattcgctg 362

                
Query: 264 gttcg 268
           |||||
Sbjct: 361 gttcg 357



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 63/70 (90%)
 Strand = Plus / Minus

                                                                       
Query: 433 catgtcagtctcatcatcccatggcttaacatcaagcaaaactgatgacttgccagattc 492
           ||||||||||||||| |||||||| || ||||||||||| ||||| ||||| ||||||||
Sbjct: 192 catgtcagtctcatcgtcccatggtttgacatcaagcaacactgaggacttcccagattc 133

                     
Query: 493 tttcttcttg 502
            |||||||||
Sbjct: 132 cttcttcttg 123



to top

>dbj|D23674.1|RICEF1BRB Oryza sativa (japonica cultivar-group) mRNA for elongation factor 1
           beta, complete cds
          Length = 1420

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                       
Query: 204 ggaagatttagattttgttgaaggcaacaatgtcacagctctggatgtactcgttcgctg 263
           ||||||| ||||| |||||||| ||||||||||| ||||||||||||||||| |||||||
Sbjct: 784 ggaagatctagatcttgttgaacgcaacaatgtcgcagctctggatgtactcattcgctg 725

                
Query: 264 gttcg 268
           |||||
Sbjct: 724 gttcg 720



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 63/70 (90%)
 Strand = Plus / Minus

                                                                       
Query: 433 catgtcagtctcatcatcccatggcttaacatcaagcaaaactgatgacttgccagattc 492
           ||||||||||||||| |||||||| || ||||||||||| ||||| ||||| ||||||||
Sbjct: 555 catgtcagtctcatcgtcccatggtttgacatcaagcaacactgaggacttcccagattc 496

                     
Query: 493 tttcttcttg 502
            |||||||||
Sbjct: 495 cttcttcttg 486



to top

>emb|Z97067.1|BVEF1BETA Beta vulgaris mRNA for elongation factor 1-beta
          Length = 1069

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 82/95 (86%)
 Strand = Plus / Minus

                                                                       
Query: 407 cttcggacagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatca 466
           |||| |||||||||||| |||||   |||||| || ||||||||||||||||| ||||| 
Sbjct: 586 cttctgacagcttcctcaagcttcttcatgtctgtttcatcatcccatggcttcacatcc 527

                                              
Query: 467 agcaaaactgatgacttgccagattctttcttctt 501
           | ||| || ||||||||||| ||||||||||||||
Sbjct: 526 aacaagaccgatgacttgcccgattctttcttctt 492



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 120/151 (79%)
 Strand = Plus / Minus

                                                                       
Query: 213 agattttgttgaaggcaacaatgtcacagctctggatgtactcgttcgctggttcgacgc 272
           ||||||||||||| || ||||| ||||| |||||||  ||||||||   ||| |||||  
Sbjct: 780 agattttgttgaatgctacaatatcacaactctggacatactcgttgattggctcgactg 721

                                                                       
Query: 273 acagatggtcttcaatcagagtgtcaacagagacnaggtcatcaatgatggtcatcataa 332
            ||||| ||||||||||| | |||| ||||| || |  ||||| |  ||||||||||| |
Sbjct: 720 tcagatagtcttcaatcaaattgtcgacagacaccaaatcatcgacaatggtcatcatga 661

                                          
Query: 333 tctggagcttcttgatgccatatccnactgg 363
           ||   || |||||||| |||||||| |||||
Sbjct: 660 tcgttagtttcttgataccatatccaactgg 630



to top

>gb|DQ235167.1| Solanum tuberosum clone 154B05 ripening regulated protein
           DDTFR10-like mRNA, complete cds
          Length = 928

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 437 tcagtctcatcatcccatggcttaacatcaagcaaaactgatgacttgccagattctttc 496
           ||||||||||||||||||||||| ||||| |  | |||||| ||||||||||||||||||
Sbjct: 535 tcagtctcatcatcccatggcttgacatccatgagaactgaggacttgccagattctttc 476

                
Query: 497 ttctt 501
           |||||
Sbjct: 475 ttctt 471



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 215 attttgttgaaggcaacaatgtcacagctctg 246
           ||||||||||| |||||||| |||||||||||
Sbjct: 757 attttgttgaaagcaacaatatcacagctctg 726



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                        
Query: 213      agattttgttgaaggcaacaatgtcacagctctggatgtactcgttcgctggttcg 268
                |||| |||||||| ||||||||||| ||||||||||||||||| ||||||||||||
Sbjct: 25260940 agatcttgttgaacgcaacaatgtcgcagctctggatgtactcattcgctggttcg 25260995



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                        
Query: 433      catgtcagtctcatcatcccatggcttaacatcaagcaaaactgatgacttgccag 488
                ||||||||||||||| |||||||| || ||||||||||| ||||| ||||| ||||
Sbjct: 25261257 catgtcagtctcatcgtcccatggtttgacatcaagcaacactgaggacttcccag 25261312



to top

>dbj|AP005198.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0616D06
          Length = 153800

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                     
Query: 213   agattttgttgaaggcaacaatgtcacagctctggatgtactcgttcgctggttcg 268
             |||| |||||||| ||||||||||| ||||||||||||||||| ||||||||||||
Sbjct: 77611 agatcttgttgaacgcaacaatgtcgcagctctggatgtactcattcgctggttcg 77666



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                     
Query: 433   catgtcagtctcatcatcccatggcttaacatcaagcaaaactgatgacttgccag 488
             ||||||||||||||| |||||||| || ||||||||||| ||||| ||||| ||||
Sbjct: 77928 catgtcagtctcatcgtcccatggtttgacatcaagcaacactgaggacttcccag 77983



to top

>dbj|D13147.1|WHTNANBU Triticum aestivum mRNA for elongation factor 1 beta', complete cds
          Length = 884

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 308 aggtcatcaatgatggtcatcataatctggagcttcttgatgccatatccnactggcatg 367
           ||||| || ||||| |||| ||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 562 aggtcgtcgatgatcgtcagcatgatctggagcttcttgatgccataacccacaggcata 503

                                                                       
Query: 368 agcttggaagcaccccacagaaggccctccatcttgatgcttcggacagcttcctctagc 427
           ||||| || ||||||||    || |||||||| |  |  || |||||||| ||||| | |
Sbjct: 502 agcttagatgcaccccaggtgagaccctccatttgaacactgcggacagcctcctccaac 443

                                           
Query: 428 ttgaccatgtcagtctcatcatcccatggctt 459
           ||   ||||||||||||||| |||||||||||
Sbjct: 442 ttcttcatgtcagtctcatcgtcccatggctt 411



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 212 tagattttgttgaaggcaacaatgtcaca 240
           ||||| |||||||||||||| ||||||||
Sbjct: 652 tagatcttgttgaaggcaacgatgtcaca 624



to top

>gb|AC007212.7| Arabidopsis thaliana chromosome 2 clone F8D23 map PhyB, complete
             sequence
          Length = 57550

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                         
Query: 413   acagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaa 472
             |||||||||||||||||   |||||| |||||||||||||| ||||| | ||| | ||||
Sbjct: 54608 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccatcaaa 54667

                        
Query: 473   actgatgactt 483
             |||||||||||
Sbjct: 54668 actgatgactt 54678



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                            
Query: 218   ttgttgaaggcaacaatgtcacagctctgga 248
             ||||||||||||||||||||||| |||||||
Sbjct: 54413 ttgttgaaggcaacaatgtcacaactctgga 54443



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 489   attctttcttcttggtagatgccttc 514
             ||||||||||||| ||||||||||||
Sbjct: 54773 attctttcttctttgtagatgccttc 54798



to top

>gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 map c245, complete
            sequence
          Length = 88149

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                        
Query: 413  acagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaa 472
            |||||||||||||||||   |||||| |||||||||||||| ||||| | ||| | ||||
Sbjct: 2484 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccatcaaa 2543

                       
Query: 473  actgatgactt 483
            |||||||||||
Sbjct: 2544 actgatgactt 2554



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                           
Query: 218  ttgttgaaggcaacaatgtcacagctctgga 248
            ||||||||||||||||||||||| |||||||
Sbjct: 2289 ttgttgaaggcaacaatgtcacaactctgga 2319



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 489  attctttcttcttggtagatgccttc 514
            ||||||||||||| ||||||||||||
Sbjct: 2649 attctttcttctttgtagatgccttc 2674



to top

>emb|CR954185.2| Medicago truncatula chromosome 5 clone mth4-20m5, COMPLETE SEQUENCE
          Length = 210708

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                     
Query: 433    catgtcagtctcatcatcccatggcttaacatcaagcaaaactgatgacttgcca 487
              |||||| ||||||||||||||||||||||||||||||| ||  || |||||||||
Sbjct: 171407 catgtctgtctcatcatcccatggcttaacatcaagcagaatggaagacttgcca 171461



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                              
Query: 440    gtctcatcatcccatggcttaacatcaagcaaaactgatgacttgcca 487
              ||||||||||||||||||||||||||||||| ||  || |||||||||
Sbjct: 158114 gtctcatcatcccatggcttaacatcaagcagaatggaagacttgcca 158161



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                          
Query: 215    attttgttgaaggcaacaatgtcacagctctggatgtactcgtt 258
              ||||||||||| || |||||||||||||||||||  ||||||||
Sbjct: 171058 attttgttgaatgcgacaatgtcacagctctggacatactcgtt 171101



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                         
Query: 299    acagagacnaggtcatcaatgatggtcatcataatctggagcttcttgatgccatatcc 357
              ||||| || || |||||||| ||||||| ||| ||||| ||||||||||| || |||||
Sbjct: 171142 acagatacaagatcatcaataatggtcaacatgatctgcagcttcttgattccgtatcc 171200



 Score = 40.1 bits (20), Expect = 7.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 441    tctcatcatcccatggcttaacatcaag 468
              |||||||||||||  |||||||||||||
Sbjct: 156303 tctcatcatcccaaagcttaacatcaag 156330



to top

>gb|AF204787.1|AF204787 Lycopersicon esculentum ripening regulated protein DDTFR10
           (DDTFR10) mRNA, complete cds
          Length = 988

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 440 gtctcatcatcccatggcttaacatcaagcaaaactgatgacttgccagattctttcttc 499
           |||||||||||||||||||| ||||| |  | ||| || |||||||||||||||||||||
Sbjct: 514 gtctcatcatcccatggcttgacatccatgagaacagaggacttgccagattctttcttc 455

             
Query: 500 tt 501
           ||
Sbjct: 454 tt 453



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 215 attttgttgaaggcaacaatgtcacagctctggatgtactcgtt 258
           ||||||||||| |||||||||||||| ||||| | |||||||||
Sbjct: 740 attttgttgaaagcaacaatgtcacaactctgaacgtactcgtt 697



to top

>gb|AC134886.5| Oryza sativa chromosome 3 BAC OSJNBa0002D18 genomic sequence, complete
              sequence
          Length = 145714

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 121/151 (80%)
 Strand = Plus / Plus

                                                                          
Query: 213    agattttgttgaaggcaacaatgtcacagctctggatgtactcgttcgctggttcgacgc 272
              ||||||||||||| |||||||||||||| ||||| ||  |||| || ||||||||   | 
Sbjct: 113105 agattttgttgaaagcaacaatgtcacaactctgaataaactcattagctggttccgtgt 113164

                                                                          
Query: 273    acagatggtcttcaatcagagtgtcaacagagacnaggtcatcaatgatggtcatcataa 332
              | | ||  || ||||| ||| |||| ||||| || || || || |  |||||||||||||
Sbjct: 113165 aaaaataatcctcaatgagactgtccacagaaacaagatcgtccacaatggtcatcataa 113224

                                             
Query: 333    tctggagcttcttgatgccatatccnactgg 363
              | || | |||||||||||||||||| |||||
Sbjct: 113225 tttgcaacttcttgatgccatatccaactgg 113255



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                          
Query: 413    acagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaa 472
              ||||||||||| |||||  ||||||| || || |||||||||||||| ||||| |||| |
Sbjct: 113409 acagcttcctcaagctttgccatgtctgtttcgtcatcccatggctttacatctagcaga 113468

                      
Query: 473    actgatga 480
              || |||||
Sbjct: 113469 accgatga 113476



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 121/151 (80%)
 Strand = Plus / Minus

                                                                            
Query: 213      agattttgttgaaggcaacaatgtcacagctctggatgtactcgttcgctggttcgacgc 272
                ||||||||||||| |||||||||||||| ||||| ||  |||| || ||||||||   | 
Sbjct: 16471228 agattttgttgaaagcaacaatgtcacaactctgaataaactcattagctggttccgtgt 16471169

                                                                            
Query: 273      acagatggtcttcaatcagagtgtcaacagagacnaggtcatcaatgatggtcatcataa 332
                | | ||  || ||||| ||| |||| ||||| || || || || |  |||||||||||||
Sbjct: 16471168 aaaaataatcctcaatgagactgtccacagaaacaagatcgtccacaatggtcatcataa 16471109

                                               
Query: 333      tctggagcttcttgatgccatatccnactgg 363
                | || | |||||||||||||||||| |||||
Sbjct: 16471108 tttgcaacttcttgatgccatatccaactgg 16471078



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                            
Query: 413      acagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaa 472
                ||||||||||| |||||  ||||||| || || |||||||||||||| ||||| |||| |
Sbjct: 16470924 acagcttcctcaagctttgccatgtctgtttcgtcatcccatggctttacatctagcaga 16470865

                        
Query: 473      actgatga 480
                || |||||
Sbjct: 16470864 accgatga 16470857



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 121/151 (80%)
 Strand = Plus / Minus

                                                                            
Query: 213      agattttgttgaaggcaacaatgtcacagctctggatgtactcgttcgctggttcgacgc 272
                ||||||||||||| |||||||||||||| ||||| ||  |||| || ||||||||   | 
Sbjct: 16464861 agattttgttgaaagcaacaatgtcacaactctgaataaactcattagctggttccgtgt 16464802

                                                                            
Query: 273      acagatggtcttcaatcagagtgtcaacagagacnaggtcatcaatgatggtcatcataa 332
                | | ||  || ||||| ||| |||| ||||| || || || || |  |||||||||||||
Sbjct: 16464801 aaaaataatcctcaatgagactgtccacagaaacaagatcgtccacaatggtcatcataa 16464742

                                               
Query: 333      tctggagcttcttgatgccatatccnactgg 363
                | || | |||||||||||||||||| |||||
Sbjct: 16464741 tttgcaacttcttgatgccatatccaactgg 16464711



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                            
Query: 413      acagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaa 472
                ||||||||||| |||||  ||||||| || || |||||||||||||| ||||| |||| |
Sbjct: 16464557 acagcttcctcaagctttgccatgtctgtttcgtcatcccatggctttacatctagcaga 16464498

                        
Query: 473      actgatga 480
                || |||||
Sbjct: 16464497 accgatga 16464490



to top

>dbj|D83726.1| Oryza sativa (japonica cultivar-group) gene for elongation factor 1
            beta 2, complete cds
          Length = 7364

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 121/151 (80%)
 Strand = Plus / Minus

                                                                        
Query: 213  agattttgttgaaggcaacaatgtcacagctctggatgtactcgttcgctggttcgacgc 272
            ||||||||||||| |||||||||||||| ||||| ||  |||| || ||||||||   | 
Sbjct: 3952 agattttgttgaaagcaacaatgtcacaactctgaataaactcattagctggttccgtgt 3893

                                                                        
Query: 273  acagatggtcttcaatcagagtgtcaacagagacnaggtcatcaatgatggtcatcataa 332
            | | ||  || ||||| ||| |||| ||||| || || || || |  |||||||||||||
Sbjct: 3892 aaaaataatcctcaatgagactgtccacagaaacaagatcgtccacaatggtcatcataa 3833

                                           
Query: 333  tctggagcttcttgatgccatatccnactgg 363
            | || | |||||||||||||||||| |||||
Sbjct: 3832 tttgcaacttcttgatgccatatccaactgg 3802



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                        
Query: 413  acagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaa 472
            ||||||||||| |||||  ||||||| || || |||||||||||||| ||||| |||| |
Sbjct: 3648 acagcttcctcaagctttgccatgtctgtttcgtcatcccatggctttacatctagcaga 3589

                    
Query: 473  actgatga 480
            || |||||
Sbjct: 3588 accgatga 3581



to top

>gb|DQ207867.1| Solanum tuberosum clone 085E09 putative elongation factor 1B
           alpha-subunit0like mRNA, complete cds
          Length = 957

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 215 attttgttgaaggcaacaatgtcacagctctggatgtactcgtt 258
           |||||||||||||||||||| ||||||||||||| ||| |||||
Sbjct: 725 attttgttgaaggcaacaatatcacagctctggacgtattcgtt 682



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 443 tcatcatcccatggcttaacatcaagcaaaactgatgacttgccagattctttcttcttg 502
           ||||||||||| |||||||| || |  | ||| |||||||| |||   ||||||||||||
Sbjct: 497 tcatcatcccaaggcttaacgtccataagaacggatgactttccactctctttcttcttg 438

                      
Query: 503 gtagatgcctt 513
           |||||||||||
Sbjct: 437 gtagatgcctt 427



to top

>gb|DQ191626.1| Solanum tuberosum unknown mRNA
          Length = 1088

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 215 attttgttgaaggcaacaatgtcacagctctggatgtactcgtt 258
           |||||||||||||||||||| ||||||||||||| ||| |||||
Sbjct: 709 attttgttgaaggcaacaatatcacagctctggacgtattcgtt 666



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 443 tcatcatcccatggcttaacatcaagcaaaactgatgacttgccagattctttcttcttg 502
           ||||||||||| |||||||| || |  | ||| |||||||| |||   ||||||||||||
Sbjct: 481 tcatcatcccaaggcttaacgtccataagaacggatgactttccactctctttcttcttg 422

                      
Query: 503 gtagatgcctt 513
           |||||||||||
Sbjct: 421 gtagatgcctt 411



to top

>gb|AC073506.11|AC073506 Arabidopsis thaliana chromosome 1 BAC F12P21 genomic sequence, complete
             sequence
          Length = 55095

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                         
Query: 413   acagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaa 472
             ||||||||||| |||||   ||||||||||||||||||||| || || | ||||| ||||
Sbjct: 19386 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgatatcaatcaaa 19327

                             
Query: 473   actgatgacttgccag 488
             ||||| ||||| ||||
Sbjct: 19326 actgaggactttccag 19311



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                            
Query: 218   ttgttgaaggcaacaatgtcacagctctgga 248
             |||||||||||||||||||||||||||||||
Sbjct: 19581 ttgttgaaggcaacaatgtcacagctctgga 19551



to top

>gb|AC136471.1| Solanum demissum chromosome 11 BAC PGEC561 genomic sequence, complete
             sequence
          Length = 123428

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                               
Query: 215   attttgttgaaggcaacaatgtcacagctctgga 248
             |||||||||||||||||||| |||||||||||||
Sbjct: 10813 attttgttgaaggcaacaatatcacagctctgga 10846



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 491   tctttcttcttggtagatgcctt 513
             |||||||||||||||||||||||
Sbjct: 11394 tctttcttcttggtagatgcctt 11416



to top

>gb|BC072139.1| Xenopus laevis cDNA clone MGC:80004 IMAGE:6317228, complete cds
          Length = 2113

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 419 tcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaaactgat 478
           ||||| |||||| ||||||| |||||||||||||| ||||| ||||| |||| ||  |||
Sbjct: 663 tcctccagcttggccatgtctgtctcatcatcccacggctttacatccagcagaatggat 604

                 
Query: 479 gacttg 484
           ||||||
Sbjct: 603 gacttg 598



to top

>gb|DQ191662.1| Solanum tuberosum elongation factor-like protein mRNA, complete cds
          Length = 903

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 215 attttgttgaaggcaacaatgtcacagctctgga 248
           |||||||||||||||||||| |||||||||||||
Sbjct: 732 attttgttgaaggcaacaatatcacagctctgga 699



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 443 tcatcatcccatggcttaacatcaagcaaaactgatgacttgccagattctttcttcttg 502
           ||||||||||| |||||||| || |  | ||| |||||||| |||   ||||||||||||
Sbjct: 504 tcatcatcccaaggcttaacgtccataagaacggatgactttccactctctttcttcttg 445

                      
Query: 503 gtagatgcctt 513
           |||||||||||
Sbjct: 444 gtagatgcctt 434



to top

>emb|X85096.1|XLEF1DELT X.laevis mRNA for elongation factor-1 delta
          Length = 1649

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 419 tcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaaactgat 478
           ||||| |||||| ||||||| |||||||||||||| ||||| ||||| |||| ||  |||
Sbjct: 591 tcctccagcttggccatgtccgtctcatcatcccacggctttacatccagcagaatggat 532

                 
Query: 479 gacttg 484
           ||||||
Sbjct: 531 gacttg 526



to top

>emb|X66837.1|XLELF1D X.laevis mRNA for elongation factor 1 delta
          Length = 983

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 419 tcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaaactgat 478
           ||||| |||||| ||||||| |||||||||||||| ||||| ||||| |||| ||  |||
Sbjct: 704 tcctccagcttggccatgtctgtctcatcatcccacggctttacatccagcagaatggat 645

                 
Query: 479 gacttg 484
           ||||||
Sbjct: 644 gacttg 639



to top

>emb|BX841873.1|CNS09Y2H Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH57ZC11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 946

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                         
Query: 218 ttgttgaaggcaacaatgtcacagctctgg 247
           ||||||||||||||||||||||||||||||
Sbjct: 817 ttgttgaaggcaacaatgtcacagctctgg 788



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 433 catgtcagtctcatcatccca 453
           |||||||||||||||||||||
Sbjct: 592 catgtcagtctcatcatccca 572



to top

>gb|BC088696.1| Xenopus laevis elongation factor-1 delta, mRNA (cDNA clone MGC:99202
            IMAGE:7208380), complete cds
          Length = 1591

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                        
Query: 419  tcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaaactgat 478
            ||||| |||||| ||||||| |||||||||||||| ||||| ||||| |||| ||  |||
Sbjct: 1312 tcctccagcttggccatgtccgtctcatcatcccacggctttacatccagcagaatggat 1253

                  
Query: 479  gacttg 484
            ||||||
Sbjct: 1252 gacttg 1247



to top

>gb|BC068905.1| Xenopus laevis elongation factor-1 delta, mRNA (cDNA clone
           MGC:83103 IMAGE:6317612), complete cds
          Length = 887

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 419 tcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaaaactgat 478
           ||||| |||||| ||||||| |||||||||||||| ||||| ||||| |||| ||  |||
Sbjct: 625 tcctccagcttggccatgtccgtctcatcatcccacggctttacatccagcagaatggat 566

                 
Query: 479 gacttg 484
           ||||||
Sbjct: 565 gacttg 560



to top

>ref|NM_121956.2| Arabidopsis thaliana translation elongation factor AT5G19510 mRNA,
           complete cds
          Length = 945

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 218 ttgttgaaggcaacaatgtcacagctctggatgtactcgtt 258
           |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 742 ttgttgaaagcgacaatgtcacaactctggatgtactcgtt 702



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 433 catgtcagtctcatcatcccatggcttaacatc 465
           |||||| || |||||||||||||||||||||||
Sbjct: 527 catgtcggtttcatcatcccatggcttaacatc 495



to top

>ref|NM_121955.2| Arabidopsis thaliana amino acid-polyamine transporter AT5G19500 mRNA,
            complete cds
          Length = 1831

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 218  ttgttgaaggcaacaatgtcacagctctggatgtactcgtt 258
            |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 1747 ttgttgaaagcgacaatgtcacaactctggatgtactcgtt 1787



to top

>ref|NM_029663.1| Mus musculus eukaryotic translation elongation factor 1 delta
            (guanine nucleotide exchange protein) (Eef1d), transcript
            variant 1, mRNA
          Length = 2847

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 421  ctctagcttgaccatgtcagtctcatcatcccatggcttaacatc 465
            |||||||| | |||||||||||||||||||||| || ||||||||
Sbjct: 1893 ctctagctgggccatgtcagtctcatcatcccaaggtttaacatc 1849



to top

>ref|NM_023240.2| Mus musculus eukaryotic translation elongation factor 1 delta
           (guanine nucleotide exchange protein) (Eef1d),
           transcript variant 2, mRNA
          Length = 1702

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 421 ctctagcttgaccatgtcagtctcatcatcccatggcttaacatc 465
           |||||||| | |||||||||||||||||||||| || ||||||||
Sbjct: 748 ctctagctgggccatgtcagtctcatcatcccaaggtttaacatc 704



to top

>gb|DQ226877.1| Boechera divaricarpa isolate SLW-C-G10 mRNA sequence
          Length = 459

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 433 catgtcagtctcatcatcccatggcttaacatc 465
           |||||| ||||||||||||||||||||||||||
Sbjct: 278 catgtcggtctcatcatcccatggcttaacatc 246



to top

>gb|AY480020.1| Capsicum annuum putative elongation factor 1B alpha-subunit mRNA,
           partial sequence
          Length = 728

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 433 catgtcagtctcatcatcccatggcttaacatcaagcaaaactgatgacttgccagattc 492
           ||||||||| || |||||||| |||||||| || |  | ||| |||||||| |||   ||
Sbjct: 515 catgtcagtttcgtcatcccaaggcttaacgtccataagaacagatgactttccactctc 456

                                
Query: 493 tttcttcttggtagatgcctt 513
           |||||||||||||||||||||
Sbjct: 455 tttcttcttggtagatgcctt 435



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 222 tgaaggcaacaatgtcacagctctg 246
           ||||||||||||| |||||||||||
Sbjct: 726 tgaaggcaacaatatcacagctctg 702



to top

>gb|AY056354.1| Arabidopsis thaliana putative elongation factor 1B alpha-subunit
           (At5g19510) mRNA, complete cds
          Length = 706

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 218 ttgttgaaggcaacaatgtcacagctctggatgtactcgtt 258
           |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 668 ttgttgaaagcgacaatgtcacaactctggatgtactcgtt 628



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 433 catgtcagtctcatcatcccatggcttaacatc 465
           |||||| || |||||||||||||||||||||||
Sbjct: 453 catgtcggtttcatcatcccatggcttaacatc 421



to top

>gb|AF360304.1| Arabidopsis thaliana putative elongation factor 1B alpha-subunit
           (At5g19510) mRNA, complete cds
          Length = 881

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 218 ttgttgaaggcaacaatgtcacagctctggatgtactcgtt 258
           |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 707 ttgttgaaagcgacaatgtcacaactctggatgtactcgtt 667



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 433 catgtcagtctcatcatcccatggcttaacatc 465
           |||||| || |||||||||||||||||||||||
Sbjct: 492 catgtcggtttcatcatcccatggcttaacatc 460



to top

>gb|BC013059.1| Mus musculus eukaryotic translation elongation factor 1 delta
           (guanine nucleotide exchange protein), mRNA (cDNA clone
           IMAGE:3482148), complete cds
          Length = 965

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 421 ctctagcttgaccatgtcagtctcatcatcccatggcttaacatc 465
           |||||||| | |||||||||||||||||||||| || ||||||||
Sbjct: 682 ctctagctgggccatgtcagtctcatcatcccaaggtttaacatc 638



to top

>gb|AF304351.1| Mus musculus eukaryotic translation elongation factor 1-delta mRNA,
           complete cds
          Length = 1004

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 421 ctctagcttgaccatgtcagtctcatcatcccatggcttaacatc 465
           |||||||| | |||||||||||||||||||||| || ||||||||
Sbjct: 715 ctctagctgggccatgtcagtctcatcatcccaaggtttaacatc 671



to top

>dbj|AK010347.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410002P09 product:ELONGATION FACTOR 1-DELTA
           (EF-1-DELTA) homolog [Mus musculus], full insert
           sequence
          Length = 992

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 421 ctctagcttgaccatgtcagtctcatcatcccatggcttaacatc 465
           |||||||| | |||||||||||||||||||||| || ||||||||
Sbjct: 727 ctctagctgggccatgtcagtctcatcatcccaaggtttaacatc 683



to top

>dbj|AK010308.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2400010D10 product:hypothetical protein, full
           insert sequence
          Length = 631

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 421 ctctagcttgaccatgtcagtctcatcatcccatggcttaacatc 465
           |||||||| | |||||||||||||||||||||| || ||||||||
Sbjct: 368 ctctagctgggccatgtcagtctcatcatcccaaggtttaacatc 324



to top

>dbj|AK044934.1| Mus musculus 9.5 days embryo parthenogenote cDNA, RIKEN full-length
           enriched library, clone:B130014I07 product:eukaryotic
           translation elongation factor 1 delta (guanine
           nucleotide exchange protein), full insert sequence
          Length = 967

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 421 ctctagcttgaccatgtcagtctcatcatcccatggcttaacatc 465
           |||||||| | |||||||||||||||||||||| || ||||||||
Sbjct: 704 ctctagctgggccatgtcagtctcatcatcccaaggtttaacatc 660



to top

>dbj|AK017616.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:5730435B20 product:SIMILAR TO
           EUKARYOTIC TRANSLATION ELONGATION FACTOR 1 DELTA
           (GUANINE NUCLEOTIDE EXCHANGE PROTEIN) homolog [Mus
           musculus], full insert sequence
          Length = 1589

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 421 ctctagcttgaccatgtcagtctcatcatcccatggcttaacatc 465
           |||||||| | |||||||||||||||||||||| || ||||||||
Sbjct: 632 ctctagctgggccatgtcagtctcatcatcccaaggtttaacatc 588



to top

>emb|BX830320.1|CNS0A1AJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB73ZB12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 820

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 218 ttgttgaaggcaacaatgtcacagctctggatgtactcgtt 258
           |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 638 ttgttgaaagcgacaatgtcacaactctggatgtactcgtt 598



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 433 catgtcagtctcatcatcccatggcttaacatc 465
           |||||| || |||||||||||||||||||||||
Sbjct: 423 catgtcggtttcatcatcccatggcttaacatc 391



to top

>emb|BX830295.1|CNS0A1LL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZA05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 883

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 218 ttgttgaaggcaacaatgtcacagctctggatgtactcgtt 258
           |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 725 ttgttgaaagcgacaatgtcacaactctggatgtactcgtt 685



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 433 catgtcagtctcatcatcccatggcttaacatc 465
           |||||| || |||||||||||||||||||||||
Sbjct: 510 catgtcggtttcatcatcccatggcttaacatc 478



to top

>emb|BX832129.1|CNS0A0XD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZE09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 835

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 218 ttgttgaaggcaacaatgtcacagctctggatgtactcgtt 258
           |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 683 ttgttgaaagcgacaatgtcacaactctggatgtactcgtt 643



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 433 catgtcagtctcatcatcccatggcttaacatc 465
           |||||| || |||||||||||||||||||||||
Sbjct: 468 catgtcggtttcatcatcccatggcttaacatc 436



to top

>emb|BX831615.1|CNS0A14O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH19ZB11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 868

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 218 ttgttgaaggcaacaatgtcacagctctggatgtactcgtt 258
           |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 725 ttgttgaaagcgacaatgtcacaactctggatgtactcgtt 685



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 433 catgtcagtctcatcatcccatggcttaacatc 465
           |||||| || |||||||||||||||||||||||
Sbjct: 510 catgtcggtttcatcatcccatggcttaacatc 478



to top

>emb|BX830589.1|CNS0A17N Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB91ZF03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 712

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 218 ttgttgaaggcaacaatgtcacagctctggatgtactcgtt 258
           |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 554 ttgttgaaagcgacaatgtcacaactctggatgtactcgtt 514



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 433 catgtcagtctcatcatcccatggcttaacatc 465
           |||||| || ||||||||||||||||| |||||
Sbjct: 339 catgtcggtttcatcatcccatggcttcacatc 307



to top

>gb|AY089071.1| Arabidopsis thaliana clone 26936 mRNA, complete sequence
          Length = 849

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 218 ttgttgaaggcaacaatgtcacagctctggatgtactcgtt 258
           |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 682 ttgttgaaagcgacaatgtcacaactctggatgtactcgtt 642



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 433 catgtcagtctcatcatcccatggcttaacatc 465
           |||||| || |||||||||||||||||||||||
Sbjct: 467 catgtcggtttcatcatcccatggcttaacatc 435



to top

>gb|AF296830.1|T20D1 Arabidopsis thaliana BAC T20D1
          Length = 35369

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 218  ttgttgaaggcaacaatgtcacagctctggatgtactcgtt 258
            |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 6153 ttgttgaaagcgacaatgtcacaactctggatgtactcgtt 6193



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                             
Query: 433  catgtcagtctcatcatcccatggcttaacatc 465
            |||||| || |||||||||||||||||||||||
Sbjct: 6465 catgtcggtttcatcatcccatggcttaacatc 6497



to top

>gb|BC082536.1| Mus musculus cDNA clone IMAGE:5688033, containing frame-shift errors
          Length = 2120

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 421  ctctagcttgaccatgtcagtctcatcatcccatggcttaacatc 465
            |||||||| | |||||||||||||||||||||| || ||||||||
Sbjct: 1828 ctctagctgggccatgtcagtctcatcatcccaaggtttaacatc 1784



to top

>gb|BC079855.1| Mus musculus eukaryotic translation elongation factor 1 delta
            (guanine nucleotide exchange protein), mRNA (cDNA clone
            MGC:105169 IMAGE:6403006), complete cds
          Length = 2174

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 421  ctctagcttgaccatgtcagtctcatcatcccatggcttaacatc 465
            |||||||| | |||||||||||||||||||||| || ||||||||
Sbjct: 1843 ctctagctgggccatgtcagtctcatcatcccaaggtttaacatc 1799



to top

>emb|AL645928.9| Mouse DNA sequence from clone RP23-185J21 on chromosome 11, complete
             sequence
          Length = 158913

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                          
Query: 421   ctctagcttgaccatgtcagtctcatcatcccatggcttaacatc 465
             |||||||| | |||||||||||||||||||||| || ||||||||
Sbjct: 83910 ctctagctgggccatgtcagtctcatcatcccaaggtttaacatc 83866



to top

>gb|DQ306840.1| Hevea brasiliensis isolate SSH111 mRNA sequence
          Length = 364

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 215 attttgttgaaggcaacaatgtcacagctctg 246
           ||||||||||||||||||||||| ||||||||
Sbjct: 194 attttgttgaaggcaacaatgtcgcagctctg 163



to top

>gb|DQ306812.1| Hevea brasiliensis isolate SSH83 mRNA sequence
          Length = 359

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 215 attttgttgaaggcaacaatgtcacagctctg 246
           ||||||||||||||||||||||| ||||||||
Sbjct: 198 attttgttgaaggcaacaatgtcgcagctctg 167



to top

>gb|L36094.1|RICENDP Oryza sativa unknown ORF mRNA, complete cds
          Length = 759

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 446 tcatcccatggcttaacatcaagcaaaactgatgacttgccagattctttcttctt 501
           |||||||||| ||| ||||| |||| ||| ||||| || |||||||||||||||||
Sbjct: 348 tcatcccatgcctttacatctagcagaaccgatgatttcccagattctttcttctt 293



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 112/141 (79%)
 Strand = Plus / Minus

                                                                       
Query: 210 tttagattttgttgaaggcaacaatgtcacagctctggatgtactcgttcgctggttcga 269
           |||||||||||||||  |||||||||||||| ||||| ||  |||| || ||||||||  
Sbjct: 590 tttagattttgttgacagcaacaatgtcacaactctgaataaactcattagctggttccg 531

                                                                       
Query: 270 cgcacagatggtcttcaatcagagtgtcaacagagacnaggtcatcaatgatggtcatca 329
            | | | ||  || ||||| ||| |||| ||||| || || || || |  ||||||||||
Sbjct: 530 tgtaaaaataatcctcaatgagactgtccacagaaacaagatcgtccacaatggtcatca 471

                                
Query: 330 taatctggagcttcttgatgc 350
           |||| |||| |||||||||||
Sbjct: 470 taatttggaacttcttgatgc 450



to top

>gb|BC106340.1| Xenopus laevis elogation factor 1 beta, mRNA (cDNA clone MGC:130878
           IMAGE:7210653), complete cds
          Length = 805

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 422 tctagcttgaccatgtcagtctcatcatcccatggcttaacatcaag 468
           ||||| ||| |||| || |||||||||||||||||||| ||||||||
Sbjct: 517 tctagtttgcccatatccgtctcatcatcccatggcttcacatcaag 471



to top

>gb|BC077005.1| Xenopus tropicalis eukaryotic translation elongation factor 1 beta
           2, mRNA (cDNA clone MGC:89655 IMAGE:7025984), complete
           cds
          Length = 812

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 422 tctagcttgaccatgtcagtctcatcatcccatggcttaacatcaag 468
           ||||||||| |||| || || ||||||||||||||||| ||||||||
Sbjct: 532 tctagcttggccatatccgtttcatcatcccatggcttcacatcaag 486



to top

>emb|CR761193.2| Xenopus tropicalis finished cDNA, clone TEgg033n03
          Length = 941

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 422 tctagcttgaccatgtcagtctcatcatcccatggcttaacatcaag 468
           ||||||||| |||| || || ||||||||||||||||| ||||||||
Sbjct: 510 tctagcttggccatatccgtttcatcatcccatggcttcacatcaag 464



to top

>emb|X74734.1|ATHEFBI Arabidopsis thaliana gene for elongation factor 1 beta
          Length = 1996

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 218  ttgttgaaggcaacaatgtcacagctctgga 248
            ||||||||||||||||||||||| |||||||
Sbjct: 1827 ttgttgaaggcaacaatgtcacaactctgga 1797



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 413  acagcttcctctagcttgaccatgtcagtctcatcatcccatggctt 459
            |||||||||||||||||   |||||| |||||||||||||| |||||
Sbjct: 1632 acagcttcctctagcttcttcatgtccgtctcatcatcccacggctt 1586



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 485  ccagattctttcttcttggtagatgcctt 513
            |||||||| |||||||| |||||||||||
Sbjct: 1337 ccagattccttcttctttgtagatgcctt 1309



to top

>emb|X69764.1|XLEF1B X.laevis mRNA for elongation factor 1 beta
          Length = 811

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 422 tctagcttgaccatgtcagtctcatcatcccatggcttaacatcaag 468
           ||||| ||| |||| || |||||||||||||||||||| ||||||||
Sbjct: 533 tctagtttgcccatatccgtctcatcatcccatggcttcacatcaag 487



to top

>ref|NM_001006876.1| Xenopus tropicalis eukaryotic translation elongation factor 1 beta
           2 (eef1b2), mRNA
          Length = 812

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 422 tctagcttgaccatgtcagtctcatcatcccatggcttaacatcaag 468
           ||||||||| |||| || || ||||||||||||||||| ||||||||
Sbjct: 532 tctagcttggccatatccgtttcatcatcccatggcttcacatcaag 486



to top

>dbj|AB046366.1| Bombyx mori ef-1d mRNA for elongation factor 1 delta, complete cds
          Length = 882

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 432 ccatgtcagtctcatcatcccatggcttaacatc 465
           |||| ||||||||||||||||||||||| |||||
Sbjct: 638 ccatatcagtctcatcatcccatggctttacatc 605



to top

>gb|AC116520.14| Mus musculus chromosome 15, clone RP24-340J12, complete sequence
          Length = 149118

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                              
Query: 421   ctctagcttgaccatgtcagtctcatcatccca 453
             |||||||| | ||||||||||||||||||||||
Sbjct: 84739 ctctagctgggccatgtcagtctcatcatccca 84771



to top

>emb|AJ249597.1|ATH249597 Arabidopsis thaliana mRNA for elongation factor 1B alpha-subunit
           (eEF1Balpha2 gene)
          Length = 680

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 230 acaatgtcacagctctggatgtactcgtt 258
           ||||||||||| |||||||||||||||||
Sbjct: 658 acaatgtcacaactctggatgtactcgtt 630



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 433 catgtcagtctcatcatcccatggcttaacatc 465
           |||||| || |||||||||||||||||||||||
Sbjct: 455 catgtcggtttcatcatcccatggcttaacatc 423



to top

>ref|XM_381184.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG01008.1)
           partial mRNA
          Length = 705

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 432 ccatgtcagtctcatcatcccatggcttaacatcaag 468
           ||||||||||||| |||||||| |||||||| |||||
Sbjct: 493 ccatgtcagtctcgtcatcccaaggcttaacgtcaag 457



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 332 atctggagcttcttgatgccatatccnactggcatgagcttggaagcacccca 384
           ||||||||||||||||  ||| | || || || | ||||||||||||||||||
Sbjct: 593 atctggagcttcttgacaccaaaaccaacggggacgagcttggaagcacccca 541



to top

>emb|AJ721003.1| Gallus gallus mRNA for hypothetical protein, clone 32c11
          Length = 770

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 419 tcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaa 471
           |||||||  ||| ||||||| |||||||||||||| || || |||||||||||
Sbjct: 532 tcctctaatttggccatgtctgtctcatcatcccaaggtttcacatcaagcaa 480



to top

>gb|BC079391.1| Rattus norvegicus eukaryotic translation elongation factor 1 delta
            (guanine nucleotide exchange protein), mRNA (cDNA clone
            MGC:94908 IMAGE:7111852), complete cds
          Length = 2042

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                         
Query: 421  ctctagcttgaccatgtcagtctcatcatcccatggcttaacatc 465
            |||||||| | ||||||| |||||||||||||| || ||||||||
Sbjct: 1753 ctctagctgggccatgtctgtctcatcatcccaaggtttaacatc 1709



to top

>emb|CR524341.1| Gallus gallus finished cDNA, clone ChEST813e21
          Length = 750

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 419 tcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaa 471
           |||||||  ||| ||||||| |||||||||||||| || || |||||||||||
Sbjct: 519 tcctctaatttggccatgtctgtctcatcatcccaaggtttcacatcaagcaa 467



to top

>emb|CR390527.1| Gallus gallus finished cDNA, clone ChEST668b23
          Length = 711

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 419 tcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaa 471
           |||||||  ||| ||||||| |||||||||||||| || || |||||||||||
Sbjct: 480 tcctctaatttggccatgtctgtctcatcatcccaaggtttcacatcaagcaa 428



to top

>emb|CR387136.1| Gallus gallus finished cDNA, clone ChEST717g5
          Length = 745

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 419 tcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaa 471
           |||||||  ||| ||||||| |||||||||||||| || || |||||||||||
Sbjct: 513 tcctctaatttggccatgtctgtctcatcatcccaaggtttcacatcaagcaa 461



to top

>emb|BX935857.2| Gallus gallus finished cDNA, clone ChEST165b6
          Length = 754

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 419 tcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaa 471
           |||||||  ||| ||||||| |||||||||||||| || || |||||||||||
Sbjct: 524 tcctctaatttggccatgtctgtctcatcatcccaaggtttcacatcaagcaa 472



to top

>emb|BX934935.2| Gallus gallus finished cDNA, clone ChEST150n2
          Length = 753

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 419 tcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaa 471
           |||||||  ||| ||||||| |||||||||||||| || || |||||||||||
Sbjct: 523 tcctctaatttggccatgtctgtctcatcatcccaaggtttcacatcaagcaa 471



to top

>emb|BX930838.2| Gallus gallus finished cDNA, clone ChEST371h16
          Length = 742

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 419 tcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaa 471
           |||||||  ||| ||||||| |||||||||||||| || || |||||||||||
Sbjct: 512 tcctctaatttggccatgtctgtctcatcatcccaaggtttcacatcaagcaa 460



to top

>emb|BX930783.2| Gallus gallus finished cDNA, clone ChEST974l2
          Length = 759

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 419 tcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaa 471
           |||||||  ||| ||||||| |||||||||||||| || || |||||||||||
Sbjct: 529 tcctctaatttggccatgtctgtctcatcatcccaaggtttcacatcaagcaa 477



to top

>ref|XM_625024.1| PREDICTED: Apis mellifera similar to elongation factor 1 beta
           (LOC552649), mRNA
          Length = 772

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 433 catgtcagtctcatcatcccatggcttaacatc 465
           ||||||||| |||||||||||||| ||||||||
Sbjct: 514 catgtcagtttcatcatcccatggtttaacatc 482



to top

>ref|NM_001013104.1| Rattus norvegicus eukaryotic translation elongation factor 1 delta
            (guanine nucleotide exchange protein) (Eef1d), mRNA
          Length = 2042

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                         
Query: 421  ctctagcttgaccatgtcagtctcatcatcccatggcttaacatc 465
            |||||||| | ||||||| |||||||||||||| || ||||||||
Sbjct: 1753 ctctagctgggccatgtctgtctcatcatcccaaggtttaacatc 1709



to top

>emb|BX933428.1| Gallus gallus finished cDNA, clone ChEST63n8
          Length = 1349

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 419 tcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaa 471
           |||||||  ||| ||||||| |||||||||||||| || || |||||||||||
Sbjct: 533 tcctctaatttggccatgtctgtctcatcatcccaaggtttcacatcaagcaa 481



to top

>emb|BX930051.1| Gallus gallus finished cDNA, clone ChEST976o24
          Length = 776

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 419 tcctctagcttgaccatgtcagtctcatcatcccatggcttaacatcaagcaa 471
           |||||||  ||| ||||||| |||||||||||||| || || |||||||||||
Sbjct: 544 tcctctaatttggccatgtctgtctcatcatcccaaggtttcacatcaagcaa 492



to top

>ref|XM_633643.1| Dictyostelium discoideum elongation factor 1b (DDB0191174), partial
           mRNA
          Length = 651

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 430 gaccatgtcagtctcatcatcccatggcttaacatc 465
           |||||| || || |||||||||||||||||||||||
Sbjct: 441 gaccatatcggtttcatcatcccatggcttaacatc 406



to top

>gb|U15926.1|DDU15926 Dictyostelium discoideum elongation factor 1 beta (eEF1beta) mRNA,
           complete cds
          Length = 717

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 430 gaccatgtcagtctcatcatcccatggcttaacatc 465
           |||||| || || |||||||||||||||||||||||
Sbjct: 459 gaccatatcggtttcatcatcccatggcttaacatc 424



to top

>emb|CR387695.1| Gallus gallus finished cDNA, clone ChEST70j23
          Length = 936

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 432 ccatgtcagtctcatcatcccatggctt 459
           |||||||||||||||||||||| |||||
Sbjct: 671 ccatgtcagtctcatcatcccacggctt 644



to top

>emb|BX933683.2| Gallus gallus finished cDNA, clone ChEST942d7
          Length = 820

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 432 ccatgtcagtctcatcatcccatggctt 459
           |||||||||||||||||||||| |||||
Sbjct: 638 ccatgtcagtctcatcatcccacggctt 611



to top

>emb|BX935015.1| Gallus gallus finished cDNA, clone ChEST301p14
          Length = 978

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 432 ccatgtcagtctcatcatcccatggctt 459
           |||||||||||||||||||||| |||||
Sbjct: 717 ccatgtcagtctcatcatcccacggctt 690



to top

>gb|AY067690.1| Schmidtea mediterranea clone H.94.9h unknown mRNA sequence
          Length = 777

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 432 ccatgtcagtctcatcatcccatggcttaacatcaa 467
           |||| ||||| |||||||||||||| ||||||||||
Sbjct: 552 ccatatcagtttcatcatcccatggtttaacatcaa 587



to top

>dbj|AB007025.1| Dictyostelium discoideum DdEF1b mRNA for elongation factor 1b,
           complete cds
          Length = 699

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 430 gaccatgtcagtctcatcatcccatggcttaacatc 465
           |||||| || || |||||||||||||||||||||||
Sbjct: 435 gaccatatcggtttcatcatcccatggcttaacatc 400



to top

>gb|AY398339.1| Danio rerio clone RK121A4C07 eukaryotic translation elongation
           factor 1 beta 2 (EEF1B2) mRNA, complete cds
          Length = 1045

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 419 tcctctagcttgaccatgtcagtctcatcatcccatggcttaacatc 465
           ||||| |||||| ||||||| || ||||||||||| ||||| |||||
Sbjct: 762 tcctcaagcttggccatgtcggtttcatcatcccagggcttgacatc 716



to top

>ref|XM_519999.1| PREDICTED: Pan troglodytes similar to EEF1D protein (LOC464444),
           mRNA
          Length = 926

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 432 ccatgtcagtctcatcatcccatggcttaacatcaagca 470
           ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 633 ccatgtccgtctcatcatcccaaggcttgacatccagca 595



to top

>gb|BT016181.1| Zea mays clone Contig14 mRNA sequence
          Length = 1084

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 100/126 (79%)
 Strand = Plus / Minus

                                                                       
Query: 340 cttcttgatgccatatccnactggcatgagcttggaagcaccccacagaaggccctccat 399
           |||||||||||| ||||| || ||||  ||||| || || |||||    || ||||||||
Sbjct: 628 cttcttgatgccgtatccaacaggcacaagctttgatgctccccaagtcagaccctccat 569

                                                                       
Query: 400 cttgatgcttcggacagcttcctctagcttgaccatgtcagtctcatcatcccatggctt 459
           || ||  || |||||||| ||||| |||||   ||| ||||||||||| |||||||| ||
Sbjct: 568 ctggacactgcggacagcctcctccagcttcttcatatcagtctcatcgtcccatggttt 509

                 
Query: 460 aacatc 465
            |||||
Sbjct: 508 tacatc 503



to top

>gb|AY432242.1| Aedes aegypti ASAP ID: 43013 translation elongation factor mRNA
           sequence
          Length = 443

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 211 ttagattttgttgaaggcaacaatgtc 237
           ||||||||||||||||||| |||||||
Sbjct: 270 ttagattttgttgaaggcagcaatgtc 244



to top

>gb|BC046042.1| Danio rerio eukaryotic translation elongation factor 1 beta 2, mRNA
           (cDNA clone MGC:56277 IMAGE:5602371), complete cds
          Length = 806

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 419 tcctctagcttgaccatgtcagtctcatcatcccatggcttaacatc 465
           ||||| |||||| ||||||| || ||||||||||| ||||| |||||
Sbjct: 545 tcctcaagcttggccatgtcggtttcatcatcccagggcttgacatc 499



to top

>ref|XM_954532.1| Neurospora crassa OR74A hypothetical protein (NCU06035.1) partial
           mRNA
          Length = 696

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 431 accatgtcagtctcatcatcccatggcttaacatc 465
           |||||||| |||||||||||||| ||||| |||||
Sbjct: 485 accatgtcggtctcatcatcccagggcttgacatc 451



to top

>gb|BC071840.1| Homo sapiens eukaryotic translation elongation factor 1 delta
           (guanine nucleotide exchange protein), mRNA (cDNA clone
           IMAGE:5470872), partial cds
          Length = 969

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 432 ccatgtcagtctcatcatcccatggcttaacatcaagca 470
           ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 671 ccatgtccgtctcatcatcccaaggcttgacatccagca 633



to top

>ref|XM_325889.1| Neurospora crassa OR74A hypothetical protein (NCU06035.1) partial
           mRNA
          Length = 696

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 431 accatgtcagtctcatcatcccatggcttaacatc 465
           |||||||| |||||||||||||| ||||| |||||
Sbjct: 485 accatgtcggtctcatcatcccagggcttgacatc 451



to top

>gb|AY552052.1| Aedes aegypti elongation factor 1 beta mRNA, complete cds
          Length = 885

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 211 ttagattttgttgaaggcaacaatgtc 237
           ||||||||||||||||||| |||||||
Sbjct: 769 ttagattttgttgaaggcagcaatgtc 743



to top

>gb|AF370363.1| Homo sapiens FP1047 mRNA, complete cds
          Length = 2152

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 432  ccatgtcagtctcatcatcccatggcttaacatcaagca 470
            ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 1774 ccatgtccgtctcatcatcccaaggcttgacatccagca 1736



to top

>emb|CT009620.9| Zebrafish DNA sequence from clone CH73-187F10 in linkage group 6,
             complete sequence
          Length = 95528

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                            
Query: 419   tcctctagcttgaccatgtcagtctcatcatcccatggcttaacatc 465
             ||||| |||||| ||||||| || ||||||||||| ||||| |||||
Sbjct: 89981 tcctcaagcttggccatgtcggtttcatcatcccagggcttgacatc 90027



to top

>emb|CR733962.2|CNS0GT3T Tetraodon nigroviridis full-length cDNA
          Length = 894

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 332 atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
           ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 698 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 639

                     
Query: 392 ccctccatct 401
           || |||||||
Sbjct: 638 ccgtccatct 629



to top

>emb|CR729832.2|CNS0GQ32 Tetraodon nigroviridis full-length cDNA
          Length = 1529

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 332  atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
            ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 1337 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 1278

                      
Query: 392  ccctccatct 401
            || |||||||
Sbjct: 1277 ccgtccatct 1268



to top

>emb|CR728847.1|CNS0GPBP Tetraodon nigroviridis full-length cDNA
          Length = 1196

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 332  atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
            ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 1006 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 947

                      
Query: 392  ccctccatct 401
            || |||||||
Sbjct: 946  ccgtccatct 937



to top

>emb|CR727009.2|CNS0GNWN Tetraodon nigroviridis full-length cDNA
          Length = 1522

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 332  atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
            ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 1336 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 1277

                      
Query: 392  ccctccatct 401
            || |||||||
Sbjct: 1276 ccgtccatct 1267



to top

>emb|CR726703.1|CNS0GNO5 Tetraodon nigroviridis full-length cDNA
          Length = 1478

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 332  atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
            ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 1304 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 1245

                      
Query: 392  ccctccatct 401
            || |||||||
Sbjct: 1244 ccgtccatct 1235



to top

>emb|CR726496.2|CNS0GNIE Tetraodon nigroviridis full-length cDNA
          Length = 1463

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 332  atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
            ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 1310 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 1251

                      
Query: 392  ccctccatct 401
            || |||||||
Sbjct: 1250 ccgtccatct 1241



to top

>emb|CR723983.1|CNS0GLKL Tetraodon nigroviridis full-length cDNA
          Length = 1472

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 332  atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
            ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 1314 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 1255

                      
Query: 392  ccctccatct 401
            || |||||||
Sbjct: 1254 ccgtccatct 1245



to top

>emb|CR713936.2|CNS0GDTO Tetraodon nigroviridis full-length cDNA
          Length = 898

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 332 atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
           ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 702 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 643

                     
Query: 392 ccctccatct 401
           || |||||||
Sbjct: 642 ccgtccatct 633



to top

>emb|CR703064.2|CNS0G5FO Tetraodon nigroviridis full-length cDNA
          Length = 992

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 332 atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
           ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 796 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 737

                     
Query: 392 ccctccatct 401
           || |||||||
Sbjct: 736 ccgtccatct 727



to top

>emb|CR700877.2|CNS0G3QX Tetraodon nigroviridis full-length cDNA
          Length = 938

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 332 atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
           ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 742 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 683

                     
Query: 392 ccctccatct 401
           || |||||||
Sbjct: 682 ccgtccatct 673



to top

>emb|CR695051.2|CNS0FZ93 Tetraodon nigroviridis full-length cDNA
          Length = 892

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 332 atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
           ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 698 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 639

                     
Query: 392 ccctccatct 401
           || |||||||
Sbjct: 638 ccgtccatct 629



to top

>emb|CR687266.2|CNS0FT8U Tetraodon nigroviridis full-length cDNA
          Length = 1316

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 332  atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
            ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 1149 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 1090

                      
Query: 392  ccctccatct 401
            || |||||||
Sbjct: 1089 ccgtccatct 1080



to top

>emb|CR686204.2|CNS0FSFC Tetraodon nigroviridis full-length cDNA
          Length = 995

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 332 atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
           ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 799 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 740

                     
Query: 392 ccctccatct 401
           || |||||||
Sbjct: 739 ccgtccatct 730



to top

>emb|CR686001.2|CNS0FS9P Tetraodon nigroviridis full-length cDNA
          Length = 938

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 332 atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
           ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 742 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 683

                     
Query: 392 ccctccatct 401
           || |||||||
Sbjct: 682 ccgtccatct 673



to top

>emb|CR685768.2|CNS0FS38 Tetraodon nigroviridis full-length cDNA
          Length = 1349

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 332  atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
            ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 1154 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 1095

                      
Query: 392  ccctccatct 401
            || |||||||
Sbjct: 1094 ccgtccatct 1085



to top

>emb|CR684960.2|CNS0FRGS Tetraodon nigroviridis full-length cDNA
          Length = 925

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 332 atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
           ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 729 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 670

                     
Query: 392 ccctccatct 401
           || |||||||
Sbjct: 669 ccgtccatct 660



to top

>emb|CR677430.2|CNS0FLO2 Tetraodon nigroviridis full-length cDNA
          Length = 1409

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 332  atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
            ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 1214 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 1155

                      
Query: 392  ccctccatct 401
            || |||||||
Sbjct: 1154 ccgtccatct 1145



to top

>emb|CR675506.2|CNS0FK6W Tetraodon nigroviridis full-length cDNA
          Length = 720

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 332 atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
           ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 531 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 472

                     
Query: 392 ccctccatct 401
           || |||||||
Sbjct: 471 ccgtccatct 462



to top

>emb|CR673642.1|CNS0FIR4 Tetraodon nigroviridis full-length cDNA
          Length = 1511

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 332  atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
            ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 1316 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 1257

                      
Query: 392  ccctccatct 401
            || |||||||
Sbjct: 1256 ccgtccatct 1247



to top

>emb|CR672514.2|CNS0FHVS Tetraodon nigroviridis full-length cDNA
          Length = 945

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 332 atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
           ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 755 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 696

                     
Query: 392 ccctccatct 401
           || |||||||
Sbjct: 695 ccgtccatct 686



to top

>emb|CR672092.2|CNS0FHK2 Tetraodon nigroviridis full-length cDNA
          Length = 690

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 332 atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
           ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 494 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 435

                     
Query: 392 ccctccatct 401
           || |||||||
Sbjct: 434 ccgtccatct 425



to top

>emb|CR671889.2|CNS0FHEF Tetraodon nigroviridis full-length cDNA
          Length = 952

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 332 atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
           ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 756 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 697

                     
Query: 392 ccctccatct 401
           || |||||||
Sbjct: 696 ccgtccatct 687



to top

>emb|CR670250.2|CNS0FG4W Tetraodon nigroviridis full-length cDNA
          Length = 1521

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 332  atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
            ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 1327 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 1268

                      
Query: 392  ccctccatct 401
            || |||||||
Sbjct: 1267 ccgtccatct 1258



to top

>emb|CR668315.2|CNS0FEN5 Tetraodon nigroviridis full-length cDNA
          Length = 1524

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 332  atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
            ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 1331 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 1272

                      
Query: 392  ccctccatct 401
            || |||||||
Sbjct: 1271 ccgtccatct 1262



to top

>emb|CR661446.2|CNS0F9CC Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 332 atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
           ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 443 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 384

                     
Query: 392 ccctccatct 401
           || |||||||
Sbjct: 383 ccgtccatct 374



to top

>emb|CR660398.2|CNS0F8J8 Tetraodon nigroviridis full-length cDNA
          Length = 830

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 332 atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
           ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 634 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 575

                     
Query: 392 ccctccatct 401
           || |||||||
Sbjct: 574 ccgtccatct 565



to top

>emb|CR659860.2|CNS0F84A Tetraodon nigroviridis full-length cDNA
          Length = 948

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 332 atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
           ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 752 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 693

                     
Query: 392 ccctccatct 401
           || |||||||
Sbjct: 692 ccgtccatct 683



to top

>emb|CR658451.2|CNS0F715 Tetraodon nigroviridis full-length cDNA
          Length = 903

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 332 atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
           ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 709 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 650

                     
Query: 392 ccctccatct 401
           || |||||||
Sbjct: 649 ccgtccatct 640



to top

>emb|CR658171.2|CNS0F6TD Tetraodon nigroviridis full-length cDNA
          Length = 572

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 332 atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
           ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 376 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 317

                     
Query: 392 ccctccatct 401
           || |||||||
Sbjct: 316 ccgtccatct 307



to top

>emb|CR657031.2|CNS0F5XP Tetraodon nigroviridis full-length cDNA
          Length = 1408

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 332  atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
            ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 1213 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 1154

                      
Query: 392  ccctccatct 401
            || |||||||
Sbjct: 1153 ccgtccatct 1144



to top

>emb|CR649797.2|CNS0F0CR Tetraodon nigroviridis full-length cDNA
          Length = 1501

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 332  atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
            ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 1331 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 1272

                      
Query: 392  ccctccatct 401
            || |||||||
Sbjct: 1271 ccgtccatct 1262



to top

>emb|CR646529.2|CNS0EXTZ Tetraodon nigroviridis full-length cDNA
          Length = 1387

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 332  atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
            ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 1216 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 1157

                      
Query: 392  ccctccatct 401
            || |||||||
Sbjct: 1156 ccgtccatct 1147



to top

>emb|CR644730.2|CNS0EWG0 Tetraodon nigroviridis full-length cDNA
          Length = 1424

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 332  atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
            ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 1229 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 1170

                      
Query: 392  ccctccatct 401
            || |||||||
Sbjct: 1169 ccgtccatct 1160



to top

>emb|CR642666.2|CNS0EUUO Tetraodon nigroviridis full-length cDNA
          Length = 1153

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 332 atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
           ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 965 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 906

                     
Query: 392 ccctccatct 401
           || |||||||
Sbjct: 905 ccgtccatct 896



to top

>emb|CR639269.1|CNS0ES8B Tetraodon nigroviridis full-length cDNA
          Length = 1415

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 332  atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
            ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 1249 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 1190

                      
Query: 392  ccctccatct 401
            || |||||||
Sbjct: 1189 ccgtccatct 1180



to top

>emb|CR638477.2|CNS0ERMB Tetraodon nigroviridis full-length cDNA
          Length = 1394

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 332  atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
            ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 1216 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 1157

                      
Query: 392  ccctccatct 401
            || |||||||
Sbjct: 1156 ccgtccatct 1147



to top

>emb|CR636114.2|CNS0EPSO Tetraodon nigroviridis full-length cDNA
          Length = 1415

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 332  atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
            ||||| |||||||||||||| || || |||||||  || ||||| || |||||||| || 
Sbjct: 1221 atctgcagcttcttgatgccgtagccaactggcaccagtttggaggcgccccacaggagc 1162

                      
Query: 392  ccctccatct 401
            || |||||||
Sbjct: 1161 ccgtccatct 1152



to top

>gb|AC182640.3| Pan troglodytes BAC clone CH251-352K16 from chromosome 7, complete
              sequence
          Length = 180187

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 432    ccatgtcagtctcatcatcccatggcttaac 462
              |||||| ||||||||||||||| ||||||||
Sbjct: 132056 ccatgttagtctcatcatcccaaggcttaac 132086



to top

>ref|XM_968676.1| PREDICTED: Tribolium castaneum similar to CG6341-PA (LOC662587),
           mRNA
          Length = 742

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 440 gtctcatcatcccatggcttaacatcaagca 470
           |||||||||||||| ||||| ||||||||||
Sbjct: 481 gtctcatcatcccagggcttgacatcaagca 451



to top

>emb|Z21507.1|HSEF1DELA H.sapiens EF-1delta gene encoding human elongation factor-1-delta
          Length = 991

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 432 ccatgtcagtctcatcatcccatggcttaacatcaagca 470
           ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 703 ccatgtccgtctcatcatcccaaggcttgacatccagca 665



to top

>gb|BC094806.1| Homo sapiens eukaryotic translation elongation factor 1 delta
           (guanine nucleotide exchange protein), mRNA (cDNA clone
           IMAGE:5442454), complete cds
          Length = 902

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 432 ccatgtcagtctcatcatcccatggcttaacatcaagca 470
           ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 608 ccatgtccgtctcatcatcccaaggcttgacatccagca 570



to top

>gb|BC062535.1| Homo sapiens eukaryotic translation elongation factor 1 delta
           (guanine nucleotide exchange protein), transcript
           variant 2, mRNA (cDNA clone IMAGE:5017304), complete cds
          Length = 990

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 432 ccatgtcagtctcatcatcccatggcttaacatcaagca 470
           ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 683 ccatgtccgtctcatcatcccaaggcttgacatccagca 645



to top

>gb|BC000678.2| Homo sapiens eukaryotic translation elongation factor 1 delta
            (guanine nucleotide exchange protein), mRNA (cDNA clone
            IMAGE:3349601), partial cds
          Length = 1739

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 432  ccatgtcagtctcatcatcccatggcttaacatcaagca 470
            ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 1441 ccatgtccgtctcatcatcccaaggcttgacatccagca 1403



to top

>gb|BC007847.2| Homo sapiens eukaryotic translation elongation factor 1 delta
            (guanine nucleotide exchange protein), mRNA (cDNA clone
            MGC:14256 IMAGE:4129368), complete cds
          Length = 2098

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 432  ccatgtcagtctcatcatcccatggcttaacatcaagca 470
            ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 1795 ccatgtccgtctcatcatcccaaggcttgacatccagca 1757



to top

>gb|BC009907.2| Homo sapiens eukaryotic translation elongation factor 1 delta
           (guanine nucleotide exchange protein), transcript
           variant 2, mRNA (cDNA clone IMAGE:2961609), complete cds
          Length = 1031

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 432 ccatgtcagtctcatcatcccatggcttaacatcaagca 470
           ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 691 ccatgtccgtctcatcatcccaaggcttgacatccagca 653



to top

>emb|CR938370.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YB12AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 910

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 211 ttagattttgttgaaggcaacaatgtc 237
           ||||||||||||||||||| |||||||
Sbjct: 838 ttagattttgttgaaggcagcaatgtc 812



to top

>emb|CR938369.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 3-prime end of clone
           KW0AAA2YB12BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 656

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 211 ttagattttgttgaaggcaacaatgtc 237
           ||||||||||||||||||| |||||||
Sbjct: 183 ttagattttgttgaaggcagcaatgtc 209



to top

>gb|BT008044.1| Synthetic construct Homo sapiens eukaryotic translation elongation
            factor 1 delta (guanine nucleotide exchange protein)
            mRNA, partial cds
          Length = 1944

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 432  ccatgtcagtctcatcatcccatggcttaacatcaagca 470
            ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 1732 ccatgtccgtctcatcatcccaaggcttgacatccagca 1694



to top

>gb|BT007242.1| Homo sapiens eukaryotic translation elongation factor 1 delta
            (guanine nucleotide exchange protein) mRNA, complete cds
          Length = 1944

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 432  ccatgtcagtctcatcatcccatggcttaacatcaagca 470
            ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 1732 ccatgtccgtctcatcatcccaaggcttgacatccagca 1694



to top

>gb|BC012819.2| Homo sapiens eukaryotic translation elongation factor 1 delta
           (guanine nucleotide exchange protein), transcript
           variant 2, mRNA (cDNA clone IMAGE:2961609), complete cds
          Length = 1031

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 432 ccatgtcagtctcatcatcccatggcttaacatcaagca 470
           ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 691 ccatgtccgtctcatcatcccaaggcttgacatccagca 653



to top

>gb|AC092691.3| Homo sapiens 3q BAC RP11-768G7 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 170215

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 460    aacatcaagcaaaactgatgact 482
              |||||||||||||||||||||||
Sbjct: 165303 aacatcaagcaaaactgatgact 165325



to top

>emb|CR626284.1| full-length cDNA clone CS0CAP008YC23 of Thymus of Homo sapiens
           (human)
          Length = 926

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 432 ccatgtcagtctcatcatcccatggcttaacatcaagca 470
           ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 675 ccatgtccgtctcatcatcccaaggcttgacatccagca 637



to top

>emb|CR617003.1| full-length cDNA clone CS0DB001YP07 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 955

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 432 ccatgtcagtctcatcatcccatggcttaacatcaagca 470
           ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 692 ccatgtccgtctcatcatcccaaggcttgacatccagca 654



to top

>emb|CR612725.1| full-length cDNA clone CS0DC001YE01 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 955

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 432 ccatgtcagtctcatcatcccatggcttaacatcaagca 470
           ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 693 ccatgtccgtctcatcatcccaaggcttgacatccagca 655



to top

>dbj|AK093756.1| Homo sapiens cDNA FLJ36437 fis, clone THYMU2012104, highly similar to
            ELONGATION FACTOR 1-DELTA
          Length = 2387

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 432  ccatgtcagtctcatcatcccatggcttaacatcaagca 470
            ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 2111 ccatgtccgtctcatcatcccaaggcttgacatccagca 2073



to top

>emb|CR602809.1| full-length cDNA clone CS0DC028YB08 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1058

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 432 ccatgtcagtctcatcatcccatggcttaacatcaagca 470
           ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 784 ccatgtccgtctcatcatcccaaggcttgacatccagca 746



to top

>emb|CR597518.1| full-length cDNA clone CS0DL005YN23 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 968

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 432 ccatgtcagtctcatcatcccatggcttaacatcaagca 470
           ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 693 ccatgtccgtctcatcatcccaaggcttgacatccagca 655



to top

>emb|AL116697.1|CNS01DDT Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 431 accatgtcagtctcatcatcccatggcttaacatc 465
           |||||||| |||||||| ||||||||||| |||||
Sbjct: 350 accatgtcggtctcatcgtcccatggcttgacatc 316



to top

>emb|AL116510.1|CNS01D8M Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 431 accatgtcagtctcatcatcccatggcttaacatc 465
           |||||||| |||||||| ||||||||||| |||||
Sbjct: 534 accatgtcggtctcatcgtcccatggcttgacatc 500



to top

>emb|AL116208.1|CNS01D08 Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 431 accatgtcagtctcatcatcccatggcttaacatc 465
           |||||||| |||||||| ||||||||||| |||||
Sbjct: 407 accatgtcggtctcatcgtcccatggcttgacatc 373



to top

>emb|AL115318.1|CNS01CBI Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 431 accatgtcagtctcatcatcccatggcttaacatc 465
           |||||||| |||||||| ||||||||||| |||||
Sbjct: 586 accatgtcggtctcatcgtcccatggcttgacatc 552



to top

>emb|AL114622.1|CNS01BS6 Botrytis cinerea strain T4 cDNA library
          Length = 480

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 431 accatgtcagtctcatcatcccatggcttaacatc 465
           |||||||| |||||||| ||||||||||| |||||
Sbjct: 84  accatgtcggtctcatcgtcccatggcttgacatc 50



to top

>emb|AL112302.1|CNS019ZQ Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 431 accatgtcagtctcatcatcccatggcttaacatc 465
           |||||||| |||||||| ||||||||||| |||||
Sbjct: 534 accatgtcggtctcatcgtcccatggcttgacatc 500



to top

>emb|AL111685.1|CNS019IL Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 431 accatgtcagtctcatcatcccatggcttaacatc 465
           |||||||| |||||||| ||||||||||| |||||
Sbjct: 550 accatgtcggtctcatcgtcccatggcttgacatc 516



to top

>ref|NM_199949.2| Danio rerio eukaryotic translation elongation factor 1 beta 2
           (eef1b2), mRNA
          Length = 1045

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 419 tcctctagcttgaccatgtcagtctcatcatcccatggcttaacatc 465
           ||||| |||||| ||||||| || ||||||||||| ||||| |||||
Sbjct: 762 tcctcaagcttggccatgtcggtttcatcatcccagggcttgacatc 716



to top

>emb|AJ538799.1|NTA538799 Nicotiana tabacum cDNA-AFLP-fragment BT1-M32-030
          Length = 246

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 491 tctttcttcttggtagatgcctt 513
           |||||||||||||||||||||||
Sbjct: 214 tctttcttcttggtagatgcctt 192



to top

>gb|AY892424.1| Synthetic construct Homo sapiens clone FLH026417.01L eukaryotic
            translation elongation factor 1 delta (EEF1D) mRNA,
            partial cds
          Length = 1944

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 432  ccatgtcagtctcatcatcccatggcttaacatcaagca 470
            ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 1732 ccatgtccgtctcatcatcccaaggcttgacatccagca 1694



to top

>gb|AY892423.1| Synthetic construct Homo sapiens clone FLH026416.01L eukaryotic
            translation elongation factor 1 delta (EEF1D) mRNA,
            partial cds
          Length = 1944

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 432  ccatgtcagtctcatcatcccatggcttaacatcaagca 470
            ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 1732 ccatgtccgtctcatcatcccaaggcttgacatccagca 1694



to top

>gb|AY889946.1| Synthetic construct Homo sapiens clone FLH026420.01X eukaryotic
            translation elongation factor 1 delta (EEF1D) mRNA,
            complete cds
          Length = 1944

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 432  ccatgtcagtctcatcatcccatggcttaacatcaagca 470
            ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 1732 ccatgtccgtctcatcatcccaaggcttgacatccagca 1694



to top

>dbj|AK024550.1| Homo sapiens cDNA: FLJ20897 fis, clone ADKA03573
          Length = 2255

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 432  ccatgtcagtctcatcatcccatggcttaacatcaagca 470
            ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 1928 ccatgtccgtctcatcatcccaaggcttgacatccagca 1890



to top

>emb|AJ719105.1| Nicotiana tabacum cDNA-AFLP-fragment BSTT1-23-320, cultivar Bright
           Yellow 2
          Length = 271

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 491 tctttcttcttggtagatgcctt 513
           |||||||||||||||||||||||
Sbjct: 242 tctttcttcttggtagatgcctt 220



to top

>ref|NM_001960.2| Homo sapiens eukaryotic translation elongation factor 1 delta
           (guanine nucleotide exchange protein) (EEF1D),
           transcript variant 2, mRNA
          Length = 994

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 432 ccatgtcagtctcatcatcccatggcttaacatcaagca 470
           ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 707 ccatgtccgtctcatcatcccaaggcttgacatccagca 669



to top

>ref|NM_032378.2| Homo sapiens eukaryotic translation elongation factor 1 delta
            (guanine nucleotide exchange protein) (EEF1D), transcript
            variant 1, mRNA
          Length = 2216

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 432  ccatgtcagtctcatcatcccatggcttaacatcaagca 470
            ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 1929 ccatgtccgtctcatcatcccaaggcttgacatccagca 1891



to top

>gb|BC071464.1| Danio rerio eukaryotic translation elongation factor 1 beta 2, mRNA
           (cDNA clone MGC:86802 IMAGE:6901030), complete cds
          Length = 823

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 419 tcctctagcttgaccatgtcagtctcatcatcccatggcttaacatc 465
           ||||| |||||| ||||||| || ||||||||||| ||||| |||||
Sbjct: 547 tcctcaagcttggccatgtcggtttcatcatcccagggcttgacatc 501



to top

>emb|AL833379.1|HSM804692 Homo sapiens mRNA; cDNA DKFZp667K1314 (from clone DKFZp667K1314)
          Length = 3797

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 432  ccatgtcagtctcatcatcccatggcttaacatcaagca 470
            ||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 3441 ccatgtccgtctcatcatcccaaggcttgacatccagca 3403



to top

>ref|XM_361991.1| Magnaporthe grisea 70-15 hypothetical protein (MG04436.4) partial
           cds
          Length = 690

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 410 cggacagcttcctctagcttgaccatgtcagtctcatcatcccatggctt 459
           ||||||||  |||| |||| ||||||||  |||||||||||||| |||||
Sbjct: 500 cggacagcagcctcgagctcgaccatgttggtctcatcatcccaaggctt 451



to top

>gb|AC119825.11| Mus musculus chromosome 3, clone RP23-358O22, complete sequence
          Length = 205291

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                         
Query: 404   atgcttcggacagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaaca 463
             ||||||||||||   |||||||| ||   |||||| |||||||||||||| ||||| |||
Sbjct: 22319 atgcttcggacacactcctctagttttgtcatgtccgtctcatcatcccaaggcttcaca 22260

               
Query: 464   tc 465
             ||
Sbjct: 22259 tc 22258



to top

>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome
          Length = 3696649

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 176     tgtccaccgaccgcaatcacga 197
               ||||||||||||||||||||||
Sbjct: 3420868 tgtccaccgaccgcaatcacga 3420847



to top

>gb|AF544990.1| Ovis aries translational elongation factor 1 delta mRNA, complete
           cds
          Length = 960

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 432 ccatgtcagtctcatcatcccatggcttaacatc 465
           ||||||| |||||||||||||| ||||| |||||
Sbjct: 685 ccatgtccgtctcatcatcccaaggcttcacatc 652



to top

>gb|AC121963.3| Mus musculus BAC clone RP24-257C17 from chromosome 3, complete sequence
          Length = 148813

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                         
Query: 404   atgcttcggacagcttcctctagcttgaccatgtcagtctcatcatcccatggcttaaca 463
             ||||||||||||   |||||||| ||   |||||| |||||||||||||| ||||| |||
Sbjct: 77717 atgcttcggacacactcctctagttttgtcatgtccgtctcatcatcccaaggcttcaca 77776

               
Query: 464   tc 465
             ||
Sbjct: 77777 tc 77778



to top

>gb|AC073349.11| Homo sapiens BAC clone RP11-797H7 from 7, complete sequence
          Length = 140861

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 432    ccatgtcagtctcatcatcccatggcttaa 461
              |||||| ||||||||||||||| |||||||
Sbjct: 112781 ccatgttagtctcatcatcccaaggcttaa 112752



to top

>emb|BX056192.1|CNS09FIS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 133

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 332 atctggagcttcttgatgccatatccnactggcatgagcttggaagcaccccacagaagg 391
           ||||| ||||||| |||||||||||| || || | ||||||||  || |||||||  || 
Sbjct: 8   atctgcagcttctggatgccatatccgaccggtacgagcttggccgctccccacaacagt 67

                            
Query: 392 ccctccatcttgatgct 408
           || ||||||| ||||||
Sbjct: 68  ccgtccatctcgatgct 84



to top

>gb|AF366456.1|AF366456 Allium cepa clone API063 maintainer line sequence
          Length = 1258

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 227 gcaacaatgtcacagctctggatgtactcg 256
           |||||||||||||| ||||| |||||||||
Sbjct: 530 gcaacaatgtcacaactctgaatgtactcg 501



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 55/66 (83%)
 Strand = Plus / Minus

                                                                       
Query: 433 catgtcagtctcatcatcccatggcttaacatcaagcaaaactgatgacttgccagattc 492
           |||||| || ||||||||||||||||| | ||| |  | ||| || ||||| ||||||||
Sbjct: 324 catgtccgtttcatcatcccatggctttatatccaatagaacagaagactttccagattc 265

                 
Query: 493 tttctt 498
           ||||||
Sbjct: 264 tttctt 259



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 299 acagagacnaggtcatcaatgatggtcatcataatctggagcttcttgatgccata 354
           |||||||| || |||||||  || |||||||| ||||| | ||| |||||||||||
Sbjct: 458 acagagacgagatcatcaacaattgtcatcattatctgcaactttttgatgccata 403



to top

>emb|AL114417.1|CNS01BMH Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 432 ccatgtcagtctcatcatcccatggcttaacatc 465
           ||||||| |||||||| ||||||||||| |||||
Sbjct: 552 ccatgtcggtctcatcgtcccatggcttgacatc 519



to top

>ref|NM_001009449.1| Ovis aries translational elongation factor 1 delta (EF-1), mRNA
          Length = 960

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 432 ccatgtcagtctcatcatcccatggcttaacatc 465
           ||||||| |||||||||||||| ||||| |||||
Sbjct: 685 ccatgtccgtctcatcatcccaaggcttcacatc 652



to top

>dbj|AK130207.1| Homo sapiens cDNA FLJ26697 fis, clone PCD00618
          Length = 994

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 432 ccatgtcagtctcatcatcccatggcttaa 461
           |||||| ||||||||||||||| |||||||
Sbjct: 697 ccatgttagtctcatcatcccaaggcttaa 668



to top

>gb|AY849611.1| Magnaporthe grisea elongation factor 1-beta-like protein mRNA,
           complete cds
          Length = 974

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 410 cggacagcttcctctagcttgaccatgtcagtctcatcatcccatggctt 459
           ||||||||  |||| |||| ||||||||  |||||||||||||| |||||
Sbjct: 598 cggacagcagcctcgagctcgaccatgttggtctcatcatcccaaggctt 549



to top

>dbj|D13339.1|BMOEF1BP Bombyx mori mRNA for elongation factor 1 beta'
          Length = 794

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 443 tcatcatcccatggcttaacatcaag 468
           ||||||||||||||||| ||||||||
Sbjct: 510 tcatcatcccatggcttgacatcaag 485



to top

>ref|NM_121249.2| Arabidopsis thaliana translation elongation factor AT5G12110 mRNA,
           complete cds
          Length = 892

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 275 agatggtcttcaatcagagtgtcaacagagacnaggtcatcaatgatggtcatcat 330
           |||||||||||||| ||  |||| ||||| || ||||||||||  || ||||||||
Sbjct: 625 agatggtcttcaatgaggttgtccacagacacaaggtcatcaacaattgtcatcat 570



to top

>gb|L25599.1| Caenorhabditis elegans cosmid F54H12, complete sequence
          Length = 19168

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 440   gtctcatcatcccatggcttaacatcaag 468
             |||||||| ||||||||||| ||||||||
Sbjct: 14766 gtctcatcgtcccatggctttacatcaag 14794



to top

>emb|AJ249596.1|ATH249596 Arabidopsis thaliana mRNA for elongation factor 1B alpha-subunit
           (eEF1Balpha1 gene)
          Length = 692

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 275 agatggtcttcaatcagagtgtcaacagagacnaggtcatcaatgatggtcatcat 330
           |||||||||||||| ||  |||| ||||| || ||||||||||  || ||||||||
Sbjct: 625 agatggtcttcaatgaggttgtccacagacacaaggtcatcaacaattgtcatcat 570



to top

>emb|AL139379.14| Human DNA sequence from clone RP11-358P11 on chromosome 13 Contains a
             CpG island, complete sequence
          Length = 166237

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 90    cacagggcagaatatgttatg 110
             |||||||||||||||||||||
Sbjct: 59256 cacagggcagaatatgttatg 59276



to top

>dbj|AB254814.1| Cryptomeria japonica mRNA for putative elongation factor, complete
           cds
          Length = 916

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 433 catgtcagtctcatcatcccatggcttaacatc 465
           |||||| ||||||||||||||||| || |||||
Sbjct: 517 catgtccgtctcatcatcccatggtttgacatc 485



to top

>gb|BT024774.1| Arabidopsis thaliana At5g12110 mRNA, complete cds
          Length = 687

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 275 agatggtcttcaatcagagtgtcaacagagacnaggtcatcaatgatggtcatcat 330
           |||||||||||||| ||  |||| ||||| || ||||||||||  || ||||||||
Sbjct: 623 agatggtcttcaatgaggttgtccacagacacaaggtcatcaacaattgtcatcat 568



to top

>ref|NM_070415.3| Caenorhabditis elegans Y41E3.10 (Y41E3.10) mRNA, complete cds
          Length = 951

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 210 tttagattttgttgaaggcaacaat 234
           ||||||| |||||||||||||||||
Sbjct: 811 tttagatcttgttgaaggcaacaat 787



 Score = 40.1 bits (20), Expect = 7.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 437 tcagtctcatcatcccatggcttaacatcaag 468
           |||||||| |||||||||||||| || |||||
Sbjct: 590 tcagtctcgtcatcccatggctttacgtcaag 559



to top

>ref|NM_066336.2| Caenorhabditis elegans F54H12.6 (F54H12.6) mRNA, complete cds
          Length = 809

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 440 gtctcatcatcccatggcttaacatcaag 468
           |||||||| ||||||||||| ||||||||
Sbjct: 535 gtctcatcgtcccatggctttacatcaag 507



to top

>dbj|AK017796.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:5730529A16 product:ELONGATION
           FACTOR 1-DELTA (EF-1-DELTA) homolog [Mus musculus], full
           insert sequence
          Length = 1665

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 432 ccatgtcagtctcatcatccc 452
           |||||||||||||||||||||
Sbjct: 702 ccatgtcagtctcatcatccc 682



to top

>gb|BT002990.1| Arabidopsis thaliana clone RAFL15-16-K06 (R20516) putative
           elongation factor 1B alpha-subunit (At5g12110) mRNA,
           partial cds
          Length = 862

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 275 agatggtcttcaatcagagtgtcaacagagacnaggtcatcaatgatggtcatcat 330
           |||||||||||||| ||  |||| ||||| || ||||||||||  || ||||||||
Sbjct: 569 agatggtcttcaatgaggttgtccacagacacaaggtcatcaacaattgtcatcat 514



to top

>dbj|AB007727.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXC9
          Length = 79590

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                     
Query: 275   agatggtcttcaatcagagtgtcaacagagacnaggtcatcaatgatggtcatcat 330
             |||||||||||||| ||  |||| ||||| || ||||||||||  || ||||||||
Sbjct: 24172 agatggtcttcaatgaggttgtccacagacacaaggtcatcaacaattgtcatcat 24117



to top

>emb|AJ249598.1|ATH249598 Arabidopsis thaliana mRNA for elongation factor 1B alpha-subunit
           (eEF1Balpha1 gene) alternative splicing
          Length = 791

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 275 agatggtcttcaatcagagtgtcaacagagacnaggtcatcaatgatggtcatcat 330
           |||||||||||||| ||  |||| ||||| || ||||||||||  || ||||||||
Sbjct: 724 agatggtcttcaatgaggttgtccacagacacaaggtcatcaacaattgtcatcat 669



to top

>emb|Z95559.1|CEY41E3 Caenorhabditis elegans YAC Y41E3, complete sequence
          Length = 150641

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 210   tttagattttgttgaaggcaacaat 234
             ||||||| |||||||||||||||||
Sbjct: 88628 tttagatcttgttgaaggcaacaat 88604



 Score = 40.1 bits (20), Expect = 7.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 437   tcagtctcatcatcccatggcttaacatcaag 468
             |||||||| |||||||||||||| || |||||
Sbjct: 88407 tcagtctcgtcatcccatggctttacgtcaag 88376



to top

>emb|AL844555.8| Mouse DNA sequence from clone RP23-251E2 on chromosome 2, complete
              sequence
          Length = 122211

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 188    gcaatcacgaacctcgggaag 208
              |||||||||||||||||||||
Sbjct: 112667 gcaatcacgaacctcgggaag 112647



to top

>ref|XM_520696.1| PREDICTED: Pan troglodytes similar to bA526D8.4 (novel KRAB box
            containing C2H2 type zinc finger protein) (LOC465235),
            mRNA
          Length = 3627

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 432  ccatgtcagtctcatcatcccatggctt 459
            |||||||||||||||| ||||| |||||
Sbjct: 3493 ccatgtcagtctcatcgtcccaaggctt 3466



to top

>gb|AC165254.2| Mus musculus BAC clone RP23-285H4 from chromosome 13, complete sequence
          Length = 229672

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 481    cttgccagattctttcttct 500
              ||||||||||||||||||||
Sbjct: 126257 cttgccagattctttcttct 126276



to top

>gb|BC003899.1| Mus musculus eukaryotic translation elongation factor 1 beta 2,
           mRNA (cDNA clone MGC:6763 IMAGE:3600850), complete cds
          Length = 814

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 404 atgcttcggacagcttcctctagcttgaccatgtcagtctcatcatcccatggctt 459
           ||||||||||||   |||||||| ||   |||||| |||||||||||||| |||||
Sbjct: 571 atgcttcggacacactcctctagttttgtcatgtccgtctcatcatcccaaggctt 516



to top

>ref|NM_018796.2| Mus musculus eukaryotic translation elongation factor 1 beta 2
           (Eef1b2), mRNA
          Length = 857

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 404 atgcttcggacagcttcctctagcttgaccatgtcagtctcatcatcccatggctt 459
           ||||||||||||   |||||||| ||   |||||| |||||||||||||| |||||
Sbjct: 587 atgcttcggacacactcctctagttttgtcatgtccgtctcatcatcccaaggctt 532



to top

>ref|XM_653674.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN1162.2), mRNA
          Length = 687

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 439 agtctcatcatcccatggcttaac 462
           ||||||||||||||| ||||||||
Sbjct: 468 agtctcatcatcccaaggcttaac 445



to top

>ref|XM_453023.1| Kluyveromyces lactis NRRL Y-1140, KLLA0C18469g predicted mRNA
          Length = 624

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 446 tcatcccatggcttaacatc 465
           ||||||||||||||||||||
Sbjct: 398 tcatcccatggcttaacatc 379



to top

>ref|NM_001010925.1| Homo sapiens ankyrin repeat domain 19 (ANKRD19), mRNA
          Length = 2285

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 432  ccatgtcagtctcatcatcccatggctt 459
            |||||||||||||||| ||||| |||||
Sbjct: 1175 ccatgtcagtctcatcgtcccaaggctt 1202



to top

>ref|XM_753723.1| Ustilago maydis 521 hypothetical protein (UM02669.1) partial mRNA
          Length = 1002

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 431 accatgtcagtctcatcatc 450
           ||||||||||||||||||||
Sbjct: 175 accatgtcagtctcatcatc 194



to top

>gb|AY444796.1| Pisum sativum translational elongation factor 1 subunit Bbeta
           (eEF1Bbeta) mRNA, complete cds
          Length = 709

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 215 attttgttgaaggcaacaatgtcacagctctggatgtactcgtt 258
           |||||||||||||| |||||||| || || ||||  ||||||||
Sbjct: 705 attttgttgaaggccacaatgtcgcaactttggacatactcgtt 662



to top

>emb|AL136981.22| Human DNA sequence from clone RP11-526D8 on chromosome 9 Contains the 5'
              end of the gene for coiled-coil protein (BICD2) (KIAA0699),
              a novel gene, a eukaryotic translation elongation factor 1
              delta (guanine nucleotide exchange protein) (EEF1D)
              pseudogene, the gene for a novel KRAB box-containing C2H2
              type zinc finger protein, a novel gene, a pseudogene
              similar to part of sorting nexin associated golgi protein 1
              (SNAG1), a novel pseudogene, a melanoma antigen pseudogene
              and three CpG islands, complete sequence
          Length = 182280

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 432    ccatgtcagtctcatcatcccatggctt 459
              |||||||||||||||| ||||| |||||
Sbjct: 106673 ccatgtcagtctcatcgtcccaaggctt 106700



to top

>gb|AC108713.2| Homo sapiens 3q BAC RP11-115O13 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 158987

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   ttagattttgttgaaggcaa 230
             ||||||||||||||||||||
Sbjct: 75390 ttagattttgttgaaggcaa 75371



to top

>gb|BC028712.1| Homo sapiens ankyrin repeat domain 19, mRNA (cDNA clone MGC:27029
            IMAGE:4837806), complete cds
          Length = 2351

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 432  ccatgtcagtctcatcatcccatggctt 459
            |||||||||||||||| ||||| |||||
Sbjct: 1365 ccatgtcagtctcatcgtcccaaggctt 1392



to top

>emb|CR382123.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome C of strain NRRL Y-1140
               of Kluyveromyces lactis
          Length = 1753957

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 446     tcatcccatggcttaacatc 465
               ||||||||||||||||||||
Sbjct: 1632215 tcatcccatggcttaacatc 1632196



to top

>emb|AL645950.13| Mouse DNA sequence from clone RP23-13C17 on chromosome 1 Contains the
             Eef1b2 gene for eukaryotic translation elongation factor 1
             beta 2, the Ndufs1 gene for NADH dehydrogenase
             (ubiquinone) Fe-S protein 1 (Ndufs1), the Gpr1 gene for
             G-protein coupled receptor 1, the 5' end of a novel gene,
             two novel genes and two CpG islands, complete sequence
          Length = 138564

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                     
Query: 404   atgcttcggacagcttcctctagcttgaccatgtcagtctcatcatcccatggctt 459
             ||||||||||||   |||||||| ||   |||||| |||||||||||||| |||||
Sbjct: 74368 atgcttcggacacactcctctagttttgtcatgtccgtctcatcatcccaaggctt 74313



to top

>emb|AL031863.1|DMCEG0003 Drosophila melanogaster cosmid EG0003
          Length = 37688

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 210   tttagattttgttgaaggcaacaatgtc 237
             ||||||| |||||||||||| |||||||
Sbjct: 10843 tttagatcttgttgaaggcagcaatgtc 10870



to top

>gb|AF523586.1| Gavia immer clone TUMWGi6.1.102 microsatellite sequence
          Length = 358

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 285 caatcagagtgtcaacagag 304
           ||||||||||||||||||||
Sbjct: 37  caatcagagtgtcaacagag 18



to top

>dbj|AK093497.1| Homo sapiens cDNA FLJ36178 fis, clone TESTI2026534
          Length = 1899

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 432  ccatgtcagtctcatcatcccatggctt 459
            |||||||||||||||| ||||| |||||
Sbjct: 993  ccatgtcagtctcatcgtcccaaggctt 1020



to top

>ref|NM_080069.3| Drosophila melanogaster Elongation factor 1 CG6341-RA (Ef1beta),
           mRNA
          Length = 885

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 210 tttagattttgttgaaggcaacaatgtc 237
           ||||||| |||||||||||| |||||||
Sbjct: 789 tttagatcttgttgaaggcagcaatgtc 762



to top

>gb|AC099030.1| Drosophila melanogaster, chromosome 2R, region 53F-54X, BAC clone
             BACR09M08, complete sequence
          Length = 179283

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 210   tttagattttgttgaaggcaacaatgtc 237
             ||||||| |||||||||||| |||||||
Sbjct: 18256 tttagatcttgttgaaggcagcaatgtc 18229



to top

>gb|AC099021.1| Drosophila melanogaster, chromosome 2R, region 53E-54X, BAC clone
              BACR03E17, complete sequence
          Length = 160338

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 210    tttagattttgttgaaggcaacaatgtc 237
              ||||||| |||||||||||| |||||||
Sbjct: 122905 tttagatcttgttgaaggcagcaatgtc 122878



to top

>emb|AL773587.11| Mouse DNA sequence from clone RP23-38J2 on chromosome X, complete
             sequence
          Length = 175713

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 328   cataatctggagcttcttga 347
             ||||||||||||||||||||
Sbjct: 13807 cataatctggagcttcttga 13788



to top

>dbj|AK168191.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730064L01 product:eukaryotic translation
           elongation factor 1 beta 2, full insert sequence
          Length = 801

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 404 atgcttcggacagcttcctctagcttgaccatgtcagtctcatcatcccatggctt 459
           ||||||||||||   |||||||| ||   |||||| |||||||||||||| |||||
Sbjct: 577 atgcttcggacacactcctctagttttgtcatgtccgtctcatcatcccaaggctt 522



to top

>gb|BC040791.1| Mus musculus RIKEN cDNA B230208H17 gene, mRNA (cDNA clone
           IMAGE:3594799), partial cds
          Length = 3908

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 28  acgatgcaaacaacactcag 47
           ||||||||||||||||||||
Sbjct: 853 acgatgcaaacaacactcag 834



to top

>gb|BC006855.1| Mus musculus RIKEN cDNA B230208H17 gene, mRNA (cDNA clone
           IMAGE:3594799), partial cds
          Length = 3908

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 28  acgatgcaaacaacactcag 47
           ||||||||||||||||||||
Sbjct: 853 acgatgcaaacaacactcag 834



to top

>gb|AF029844.2|AF029844 Mus musculus elongation factor 1-beta homolog mRNA, complete cds
          Length = 779

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 404 atgcttcggacagcttcctctagcttgaccatgtcagtctcatcatcccatggctt 459
           ||||||||||||   |||||||| ||   |||||| |||||||||||||| |||||
Sbjct: 541 atgcttcggacacactcctctagttttgtcatgtccgtctcatcatcccaaggctt 486


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,338,242
Number of Sequences: 3902068
Number of extensions: 4338242
Number of successful extensions: 81608
Number of sequences better than 10.0: 270
Number of HSP's better than 10.0 without gapping: 270
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 81075
Number of HSP's gapped (non-prelim): 523
length of query: 523
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 500
effective length of database: 17,143,297,704
effective search space: 8571648852000
effective search space used: 8571648852000
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top