>emb|AL354897.11| Human DNA sequence from clone RP11-323N23 on chromosome 9 Contains a
             pseudogene similar to part of ubiquitin-conjugating enzyme
             E2, complete sequence
          Length = 129992

 Score = 46.1 bits (23), Expect = 0.036
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 2     ctttccccccttcatttattcat 24
             |||||||||||||||||||||||
Sbjct: 63362 ctttccccccttcatttattcat 63340

>gb|AC133494.4| Mus musculus BAC clone RP24-443B5 from chromosome 7, complete
            sequence
          Length = 182616

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 11   cttcatttattcatccctgt 30
            ||||||||||||||||||||
Sbjct: 8134 cttcatttattcatccctgt 8115

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 11       cttcatttattcatccctgt 30
                ||||||||||||||||||||
Sbjct: 14183614 cttcatttattcatccctgt 14183633

>gb|AC092682.2| Homo sapiens BAC clone RP11-734C21 from 2, complete sequence
          Length = 188920

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 6      ccccccttcatttattcatc 25
              ||||||||||||||||||||
Sbjct: 121142 ccccccttcatttattcatc 121123

>dbj|AP004992.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0022O02
          Length = 176625

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 11    cttcatttattcatccctgt 30
             ||||||||||||||||||||
Sbjct: 27078 cttcatttattcatccctgt 27097

>gb|AE004295.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 203
            of 251 of the complete chromosome
          Length = 9973

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 46   caccatcacgaccatattg 64
            |||||||||||||||||||
Sbjct: 6327 caccatcacgaccatattg 6345

>gb|AC154881.6| Mus musculus chromosome 15, clone RP24-259H19, complete sequence
          Length = 180231

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 17     ttattcatccctgtgtagg 35
              |||||||||||||||||||
Sbjct: 118139 ttattcatccctgtgtagg 118157

>dbj|AK077285.1| Mus musculus 11 days pregnant adult female ovary and uterus cDNA,
           RIKEN full-length enriched library, clone:5033405L05
           product:unclassifiable, full insert sequence
          Length = 1482

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 62  ttgccacacgggcaagcag 80
           |||||||||||||||||||
Sbjct: 637 ttgccacacgggcaagcag 619

>gb|AC155641.8| Mus musculus 10 BAC RP24-121N1 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 195480

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 27    ctgtgtaggggttgtgttc 45
             |||||||||||||||||||
Sbjct: 54806 ctgtgtaggggttgtgttc 54788

>emb|CR749772.5| Zebrafish DNA sequence from clone DKEY-260P18 in linkage group 19,
             complete sequence
          Length = 91686

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 1     gctttccccccttcatttattca 23
             |||||||||||||| ||||||||
Sbjct: 68745 gctttccccccttcctttattca 68767

>gb|AC103935.10| Mus musculus chromosome 8, clone RP23-431O7, complete sequence
          Length = 205702

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 62    ttgccacacgggcaagcag 80
             |||||||||||||||||||
Sbjct: 77019 ttgccacacgggcaagcag 77001

>emb|AL831761.9| Mouse DNA sequence from clone RP23-318H16 on chromosome 4, complete
             sequence
          Length = 179556

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 2     ctttccccccttcatttattcat 24
             ||||||||||||||| |||||||
Sbjct: 32982 ctttccccccttcatctattcat 33004


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,101,598
Number of Sequences: 3902068
Number of extensions: 1101598
Number of successful extensions: 92262
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 92227
Number of HSP's gapped (non-prelim): 35
length of query: 178
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 156
effective length of database: 17,147,199,772
effective search space: 2674963164432
effective search space used: 2674963164432
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)