ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart09c03
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AB118018.1| Oryza sativa (japonica cultivar-group) bip132 mR... 204 2e-49
2dbj|AK101273.1| Oryza sativa (japonica cultivar-group) cDNA clon... 204 2e-49
3gb|AY111278.1| Zea mays CL31341_-1 mRNA sequence 127 3e-26
4dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 100 8e-18
5gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 100 8e-18
6emb|AL713940.4|CNS07YPM Oryza sativa chromosome 12, . BAC OJ1327... 100 8e-18
7gb|AC174357.6| Medicago truncatula clone mth2-26c10, complete se... 56 1e-04
8gb|AC126781.22| Medicago truncatula clone mth2-12m15, complete s... 56 1e-04
9gb|AC010068.8| Drosophila melanogaster 3L BAC RP98-15K24 (Roswel... 52 0.002
10ref|NM_168941.2| Drosophila melanogaster Nopp140 CG7421-RA, tran... 52 0.002
11ref|NM_168940.1| Drosophila melanogaster Nopp140 CG7421-RB, tran... 52 0.002
12gb|AY061181.1| Drosophila melanogaster LD14807 full length cDNA 52 0.002
13gb|BT021407.1| Drosophila melanogaster LD06749 full insert cDNA 52 0.002
14gb|AE003595.3| Drosophila melanogaster chromosome 3L, section 76... 52 0.002
15gb|AF162774.2| Drosophila melanogaster Nopp140-like nucleolar pr... 52 0.002
16ref|NM_125094.2| Arabidopsis thaliana unknown protein AT5G57120 ... 44 0.40
17gb|AY127952.1| Arabidopsis thaliana AT5g57120/MUL3_6 mRNA, compl... 44 0.40
18gb|AY056089.1| Arabidopsis thaliana AT5g57120/MUL3_6 mRNA, compl... 44 0.40
19gb|AY045686.1| Arabidopsis thaliana AT5g57120/MUL3_6 mRNA, compl... 44 0.40
20gb|AY037212.1| Arabidopsis thaliana AT5g57120/MUL3_6 mRNA, compl... 44 0.40
21gb|AY084589.1| Arabidopsis thaliana clone 11265 mRNA, complete s... 44 0.40
22dbj|AP006140.1| Lotus japonicus genomic DNA, chromosome 4, clone... 44 0.40
23emb|AL157820.27| Human DNA sequence from clone RP11-8D7 on chrom... 42 1.6
24gb|AC155998.2| Xenopus tropicalis clone ISB1-313L20, complete se... 42 1.6
25ref|XM_457674.1| Debaryomyces hansenii CBS767 hypothetical prote... 40 6.2
26gb|AC151903.3| Mus musculus BAC clone RP23-216I7 from chromosome... 40 6.2
27gb|BT006020.1| Drosophila melanogaster GM04911 full insert cDNA 40 6.2
28gb|AC122479.3| Mus musculus BAC clone RP24-344E5 from chromosome... 40 6.2
29emb|CR382134.1| Debaryomyces hansenii chromosome B of strain CBS... 40 6.2
30ref|NM_001039730.1| Xenopus tropicalis nucleolar and coiled-body... 40 6.2
31emb|AL121800.1|DMBN5I9 Drosophila melanogaster BAC clone BACN5I9 40 6.2
32emb|AL592065.7| Mouse DNA sequence from clone RP23-50E4 on chrom... 40 6.2
33emb|AL731821.10| Mouse DNA sequence from clone RP23-81G15 on chr... 40 6.2
34gb|AC108480.3| Drosophila melanogaster X BAC RP98-2A13 (Roswell ... 40 6.2
35dbj|AK137575.1| Mus musculus adult male bone cDNA, RIKEN full-le... 40 6.2
36gb|AC004806.2| Homo sapiens 12 BAC RP11-360E11 (Roswell Park Can... 40 6.2
37gb|AC097715.3| Homo sapiens BAC clone RP11-563A13 from 2, comple... 40 6.2
38emb|AL773558.14| Zebrafish DNA sequence from clone CH211-207M11 ... 40 6.2
39emb|AJ011432.1|RNO011432 Rattus norvegicus gdnf gene 40 6.2
40emb|CR848207.2| Xenopus tropicalis finished cDNA, clone TGas105h10 40 6.2
41gb|AE003427.3| Drosophila melanogaster chromosome X, section 11 ... 40 6.2
42gb|AF023840.1|AF023840 Homo sapiens natural killer group protein... 40 6.2
43gb|BC064870.1| Xenopus tropicalis nucleolar and coiled-body phos... 40 6.2 
>dbj|AB118018.1| Oryza sativa (japonica cultivar-group) bip132 mRNA for BRI1-KD
           interacting protein 132, partial cds
          Length = 1131

 Score =  204 bits (103), Expect = 2e-49
 Identities = 187/215 (86%)
 Strand = Plus / Minus

                                                                       
Query: 244 gcgatcactcgtcgtctgaattgttaaacttaatcgagtgggtttgtagatcaatgaacc 303
           ||||||||||||| ||||||| ||| ||||| || ||||||||||||| ||| ||   ||
Sbjct: 869 gcgatcactcgtcatctgaatcgttgaacttgattgagtgggtttgtaaatcgatctgcc 810

                                                                       
Query: 304 cacccttgtaggttccgcgcttcttcttggtcttctcgtgcctaaaatcccttcctctaa 363
           ||||| |||||||||| |||||||||||||||||||| || |||||  ||||||||||||
Sbjct: 809 cacccctgtaggttccacgcttcttcttggtcttctcatgtctaaagccccttcctctaa 750

                                                                       
Query: 364 cttgtccaagaatctcctgtgccttcgcaccgtacccagagtcagcaccacccttagccc 423
           |||| ||||||| ||| |||||||| ||||| ||||||||||| ||||||||||||||||
Sbjct: 749 cttgcccaagaacctcttgtgcctttgcaccatacccagagtctgcaccacccttagccc 690

                                              
Query: 424 aatacgaattatcttgtagtctttcatcagcaaat 458
           |||| || ||||| || || || ||||||||||||
Sbjct: 689 aatatgagttatcctgaagcctatcatcagcaaat 655
to top
>dbj|AK101273.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033033A11, full
            insert sequence
          Length = 1604

 Score =  204 bits (103), Expect = 2e-49
 Identities = 187/215 (86%)
 Strand = Plus / Minus

                                                                        
Query: 244  gcgatcactcgtcgtctgaattgttaaacttaatcgagtgggtttgtagatcaatgaacc 303
            ||||||||||||| ||||||| ||| ||||| || ||||||||||||| ||| ||   ||
Sbjct: 1361 gcgatcactcgtcatctgaatcgttgaacttgattgagtgggtttgtaaatcgatctgcc 1302

                                                                        
Query: 304  cacccttgtaggttccgcgcttcttcttggtcttctcgtgcctaaaatcccttcctctaa 363
            ||||| |||||||||| |||||||||||||||||||| || |||||  ||||||||||||
Sbjct: 1301 cacccctgtaggttccacgcttcttcttggtcttctcatgtctaaagccccttcctctaa 1242

                                                                        
Query: 364  cttgtccaagaatctcctgtgccttcgcaccgtacccagagtcagcaccacccttagccc 423
            |||| ||||||| ||| |||||||| ||||| ||||||||||| ||||||||||||||||
Sbjct: 1241 cttgcccaagaacctcttgtgcctttgcaccatacccagagtctgcaccacccttagccc 1182

                                               
Query: 424  aatacgaattatcttgtagtctttcatcagcaaat 458
            |||| || ||||| || || || ||||||||||||
Sbjct: 1181 aatatgagttatcctgaagcctatcatcagcaaat 1147
to top
>gb|AY111278.1| Zea mays CL31341_-1 mRNA sequence
          Length = 625

 Score =  127 bits (64), Expect = 3e-26
 Identities = 173/211 (81%)
 Strand = Plus / Plus

                                                                       
Query: 248 tcactcgtcgtctgaattgttaaacttaatcgagtgggtttgtagatcaatgaacccacc 307
           |||||||||||||||||| |  ||||| |||||||||||||| || || ||   ||| ||
Sbjct: 245 tcactcgtcgtctgaattctcgaacttgatcgagtgggtttgcaggtcgatttgcccgcc 304

                                                                       
Query: 308 cttgtaggttccgcgcttcttcttggtcttctcgtgcctaaaatcccttcctctaacttg 367
           | ||||||| || |||||||||||||| ||||||||||||||     ||||  | |||||
Sbjct: 305 cctgtaggtgccacgcttcttcttggttttctcgtgcctaaannnnnttcccttgacttg 364

                                                                       
Query: 368 tccaagaatctcctgtgccttcgcaccgtacccagagtcagcaccacccttagcccaata 427
            ||||| |||||||||||||| || ||||| || | ||| || |||||||||||||||||
Sbjct: 365 gccaaggatctcctgtgcctttgcgccgtaaccggtgtctgcgccacccttagcccaata 424

                                          
Query: 428 cgaattatcttgtagtctttcatcagcaaat 458
           ||| ||||| || || || ||||| ||||||
Sbjct: 425 cgagttatcctgaagcctgtcatctgcaaat 455
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 92/106 (86%)
 Strand = Plus / Minus

                                                                            
Query: 244      gcgatcactcgtcgtctgaattgttaaacttaatcgagtgggtttgtagatcaatgaacc 303
                ||||||||||||| ||||||| ||| ||||| || ||||||||||||| ||| ||   ||
Sbjct: 26026469 gcgatcactcgtcatctgaatcgttgaacttgattgagtgggtttgtaaatcgatctgcc 26026410

                                                              
Query: 304      cacccttgtaggttccgcgcttcttcttggtcttctcgtgcctaaa 349
                ||||| |||||||||| |||||||||||||||||||| || |||||
Sbjct: 26026409 cacccctgtaggttccacgcttcttcttggtcttctcatgtctaaa 26026364



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                            
Query: 353      ccttcctctaacttgtccaagaatctcctgtgccttcgcaccgtacccagagtcagcacc 412
                ||||||||||||||| ||||||| ||| |||||||| ||||| ||||||||||| |||||
Sbjct: 26026236 ccttcctctaacttgcccaagaacctcttgtgcctttgcaccatacccagagtctgcacc 26026177

                     
Query: 413      accct 417
                |||||
Sbjct: 26026176 accct 26026172



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                            
Query: 415      ccttagcccaatacgaattatcttgtagtctttcatcagcaaat 458
                ||||||||||||| || ||||| || || || ||||||||||||
Sbjct: 26025596 ccttagcccaatatgagttatcctgaagcctatcatcagcaaat 26025553
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 92/106 (86%)
 Strand = Plus / Minus

                                                                            
Query: 244      gcgatcactcgtcgtctgaattgttaaacttaatcgagtgggtttgtagatcaatgaacc 303
                ||||||||||||| ||||||| ||| ||||| || ||||||||||||| ||| ||   ||
Sbjct: 25954645 gcgatcactcgtcatctgaatcgttgaacttgattgagtgggtttgtaaatcgatctgcc 25954586

                                                              
Query: 304      cacccttgtaggttccgcgcttcttcttggtcttctcgtgcctaaa 349
                ||||| |||||||||| |||||||||||||||||||| || |||||
Sbjct: 25954585 cacccctgtaggttccacgcttcttcttggtcttctcatgtctaaa 25954540



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                            
Query: 353      ccttcctctaacttgtccaagaatctcctgtgccttcgcaccgtacccagagtcagcacc 412
                ||||||||||||||| ||||||| ||| |||||||| ||||| ||||||||||| |||||
Sbjct: 25954412 ccttcctctaacttgcccaagaacctcttgtgcctttgcaccatacccagagtctgcacc 25954353

                     
Query: 413      accct 417
                |||||
Sbjct: 25954352 accct 25954348



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                            
Query: 415      ccttagcccaatacgaattatcttgtagtctttcatcagcaaat 458
                ||||||||||||| || ||||| || || || ||||||||||||
Sbjct: 25953772 ccttagcccaatatgagttatcctgaagcctatcatcagcaaat 25953729
to top
>emb|AL713940.4|CNS07YPM Oryza sativa chromosome 12, . BAC OJ1327_A12 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 161806

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 92/106 (86%)
 Strand = Plus / Plus

                                                                         
Query: 244   gcgatcactcgtcgtctgaattgttaaacttaatcgagtgggtttgtagatcaatgaacc 303
             ||||||||||||| ||||||| ||| ||||| || ||||||||||||| ||| ||   ||
Sbjct: 85202 gcgatcactcgtcatctgaatcgttgaacttgattgagtgggtttgtaaatcgatctgcc 85261

                                                           
Query: 304   cacccttgtaggttccgcgcttcttcttggtcttctcgtgcctaaa 349
             ||||| |||||||||| |||||||||||||||||||| || |||||
Sbjct: 85262 cacccctgtaggttccacgcttcttcttggtcttctcatgtctaaa 85307



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                         
Query: 353   ccttcctctaacttgtccaagaatctcctgtgccttcgcaccgtacccagagtcagcacc 412
             ||||||||||||||| ||||||| ||| |||||||| ||||| ||||||||||| |||||
Sbjct: 85435 ccttcctctaacttgcccaagaacctcttgtgcctttgcaccatacccagagtctgcacc 85494

                  
Query: 413   accct 417
             |||||
Sbjct: 85495 accct 85499



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                         
Query: 415   ccttagcccaatacgaattatcttgtagtctttcatcagcaaat 458
             ||||||||||||| || ||||| || || || ||||||||||||
Sbjct: 86075 ccttagcccaatatgagttatcctgaagcctatcatcagcaaat 86118
to top
>gb|AC174357.6| Medicago truncatula clone mth2-26c10, complete sequence
          Length = 98743

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 88/108 (81%)
 Strand = Plus / Plus

                                                                         
Query: 248   tcactcgtcgtctgaattgttaaacttaatcgagtgggtttgtagatcaatgaacccacc 307
             |||||| || |||||||  ||||||||||  |||||||  |||| |||||| |  |||||
Sbjct: 95178 tcactcctcatctgaataattaaacttaactgagtgggaatgtaaatcaataagtccacc 95237

                                                             
Query: 308   cttgtaggttccgcgcttcttcttggtcttctcgtgcctaaaatccct 355
             | | ||||| || || |||||||||||||| ||||| | |||||||||
Sbjct: 95238 cctataggtcccacgtttcttcttggtcttttcgtggcgaaaatccct 95285
to top
>gb|AC126781.22| Medicago truncatula clone mth2-12m15, complete sequence
          Length = 116119

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 88/108 (81%)
 Strand = Plus / Minus

                                                                          
Query: 248    tcactcgtcgtctgaattgttaaacttaatcgagtgggtttgtagatcaatgaacccacc 307
              |||||| || |||||||  ||||||||||  |||||||  |||| |||||| |  |||||
Sbjct: 105883 tcactcctcatctgaataattaaacttaactgagtgggaatgtaaatcaataagtccacc 105824

                                                              
Query: 308    cttgtaggttccgcgcttcttcttggtcttctcgtgcctaaaatccct 355
              | | ||||| || || |||||||||||||| ||||| | |||||||||
Sbjct: 105823 cctataggtcccacgtttcttcttggtcttttcgtggcgaaaatccct 105776
to top
>gb|AC010068.8| Drosophila melanogaster 3L BAC RP98-15K24 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 178607

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 318   ccgcgcttcttcttggtcttctcgtg 343
             ||||||||||||||||||||||||||
Sbjct: 50329 ccgcgcttcttcttggtcttctcgtg 50304
to top
>ref|NM_168941.2| Drosophila melanogaster Nopp140 CG7421-RA, transcript variant A
            (Nopp140), mRNA
          Length = 3104

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 318  ccgcgcttcttcttggtcttctcgtg 343
            ||||||||||||||||||||||||||
Sbjct: 2497 ccgcgcttcttcttggtcttctcgtg 2472
to top
>ref|NM_168940.1| Drosophila melanogaster Nopp140 CG7421-RB, transcript variant B
            (Nopp140), mRNA
          Length = 2747

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 318  ccgcgcttcttcttggtcttctcgtg 343
            ||||||||||||||||||||||||||
Sbjct: 2140 ccgcgcttcttcttggtcttctcgtg 2115
to top
>gb|AY061181.1| Drosophila melanogaster LD14807 full length cDNA
          Length = 1585

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 318 ccgcgcttcttcttggtcttctcgtg 343
           ||||||||||||||||||||||||||
Sbjct: 961 ccgcgcttcttcttggtcttctcgtg 936
to top
>gb|BT021407.1| Drosophila melanogaster LD06749 full insert cDNA
          Length = 3072

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 318  ccgcgcttcttcttggtcttctcgtg 343
            ||||||||||||||||||||||||||
Sbjct: 2457 ccgcgcttcttcttggtcttctcgtg 2432
to top
>gb|AE003595.3| Drosophila melanogaster chromosome 3L, section 76 of 83 of the complete
              sequence
          Length = 294272

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 318    ccgcgcttcttcttggtcttctcgtg 343
              ||||||||||||||||||||||||||
Sbjct: 255589 ccgcgcttcttcttggtcttctcgtg 255564
to top
>gb|AF162774.2| Drosophila melanogaster Nopp140-like nucleolar protein (Nopp140)
            mRNA, complete cds
          Length = 3028

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 318  ccgcgcttcttcttggtcttctcgtg 343
            ||||||||||||||||||||||||||
Sbjct: 2399 ccgcgcttcttcttggtcttctcgtg 2374
to top
>ref|NM_125094.2| Arabidopsis thaliana unknown protein AT5G57120 mRNA, complete cds
          Length = 1333

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                      
Query: 310  tgtaggttccgcgcttcttcttggtcttctcgtgcctaaaatcccttcctctaacttg 367
            ||||| |||| || |||||||| |||||||| || |  |||||||||||||| |||||
Sbjct: 1041 tgtagcttcctcgtttcttcttcgtcttctcatgtcggaaatcccttcctctcacttg 984
to top
>gb|AY127952.1| Arabidopsis thaliana AT5g57120/MUL3_6 mRNA, complete cds
          Length = 993

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 310 tgtaggttccgcgcttcttcttggtcttctcgtgcctaaaatcccttcctctaacttg 367
           ||||| |||| || |||||||| |||||||| || |  |||||||||||||| |||||
Sbjct: 928 tgtagcttcctcgtttcttcttcgtcttctcatgtcggaaatcccttcctctcacttg 871
to top
>gb|AY056089.1| Arabidopsis thaliana AT5g57120/MUL3_6 mRNA, complete cds
          Length = 549

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 310 tgtaggttccgcgcttcttcttggtcttctcgtgcctaaaatcccttcctctaacttg 367
           ||||| |||| || |||||||| |||||||| || |  |||||||||||||| |||||
Sbjct: 484 tgtagcttcctcgtttcttcttcgtcttctcatgtcggaaatcccttcctctcacttg 427
to top
>gb|AY045686.1| Arabidopsis thaliana AT5g57120/MUL3_6 mRNA, complete cds
          Length = 1258

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                      
Query: 310  tgtaggttccgcgcttcttcttggtcttctcgtgcctaaaatcccttcctctaacttg 367
            ||||| |||| || |||||||| |||||||| || |  |||||||||||||| |||||
Sbjct: 1037 tgtagcttcctcgtttcttcttcgtcttctcatgtcggaaatcccttcctctcacttg 980
to top
>gb|AY037212.1| Arabidopsis thaliana AT5g57120/MUL3_6 mRNA, complete cds
          Length = 1279

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                      
Query: 310  tgtaggttccgcgcttcttcttggtcttctcgtgcctaaaatcccttcctctaacttg 367
            ||||| |||| || |||||||| |||||||| || |  |||||||||||||| |||||
Sbjct: 1036 tgtagcttcctcgtttcttcttcgtcttctcatgtcggaaatcccttcctctcacttg 979
to top
>gb|AY084589.1| Arabidopsis thaliana clone 11265 mRNA, complete sequence
          Length = 1258

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                      
Query: 310  tgtaggttccgcgcttcttcttggtcttctcgtgcctaaaatcccttcctctaacttg 367
            ||||| |||| || |||||||| |||||||| || |  |||||||||||||| |||||
Sbjct: 1041 tgtagcttcctcgtttcttcttcgtcttctcatgtcggaaatcccttcctctcacttg 984
to top
>dbj|AP006140.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT37A01, TM0244,
             complete sequence
          Length = 102724

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                       
Query: 353   ccttcctctaacttgtccaagaatctcctgtgccttcgcacc 394
             ||||||||||||||| |||||||| || ||||| || |||||
Sbjct: 88860 ccttcctctaacttggccaagaatttcttgtgcttttgcacc 88819



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 267   ttaaacttaatcgagtgggtttgtagatcaat 298
             |||||||| || ||||||| ||||||||||||
Sbjct: 89299 ttaaactttattgagtgggattgtagatcaat 89268
to top
>emb|AL157820.27| Human DNA sequence from clone RP11-8D7 on chromosome 13 Contains the 5'
             end of a novel gene, the  ING1 gene for Inhibitor of
             growth family member 1 and three CpG islands, complete
             sequence
          Length = 97465

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 99    caaaacagaaagggcaggata 119
             |||||||||||||||||||||
Sbjct: 89636 caaaacagaaagggcaggata 89616
to top
>gb|AC155998.2| Xenopus tropicalis clone ISB1-313L20, complete sequence
          Length = 86223

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 40    aaaatggtacgtctcactgag 60
             |||||||||||||||||||||
Sbjct: 52718 aaaatggtacgtctcactgag 52698
to top
>ref|XM_457674.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0B16775g)
            partial mRNA
          Length = 4527

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 126  ttcaatgcttttgcttcttt 145
            ||||||||||||||||||||
Sbjct: 1687 ttcaatgcttttgcttcttt 1706
to top
>gb|AC151903.3| Mus musculus BAC clone RP23-216I7 from chromosome 14, complete sequence
          Length = 232727

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   atggggaaatgtcacaagac 230
             ||||||||||||||||||||
Sbjct: 38280 atggggaaatgtcacaagac 38299
to top
>gb|BT006020.1| Drosophila melanogaster GM04911 full insert cDNA
          Length = 2069

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 122 acaattcaatgcttttgctt 141
           ||||||||||||||||||||
Sbjct: 850 acaattcaatgcttttgctt 869
to top
>gb|AC122479.3| Mus musculus BAC clone RP24-344E5 from chromosome 14, complete sequence
          Length = 185254

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   atggggaaatgtcacaagac 230
             ||||||||||||||||||||
Sbjct: 56739 atggggaaatgtcacaagac 56720
to top
>emb|CR382134.1| Debaryomyces hansenii chromosome B of strain CBS767 of Debaryomyces
               hansenii
          Length = 1349926

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 126     ttcaatgcttttgcttcttt 145
               ||||||||||||||||||||
Sbjct: 1322806 ttcaatgcttttgcttcttt 1322787
to top
>ref|NM_001039730.1| Xenopus tropicalis nucleolar and coiled-body phosphoprotein 1
            (nolc1), mRNA
          Length = 3167

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 324  ttcttcttggtcttctcgtg 343
            ||||||||||||||||||||
Sbjct: 2711 ttcttcttggtcttctcgtg 2692
to top
>emb|AL121800.1|DMBN5I9 Drosophila melanogaster BAC clone BACN5I9
          Length = 96433

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 122   acaattcaatgcttttgctt 141
             ||||||||||||||||||||
Sbjct: 10167 acaattcaatgcttttgctt 10148
to top
>emb|AL592065.7| Mouse DNA sequence from clone RP23-50E4 on chromosome 11 Contains the
             3' end of a novel gene, two novel genes, the 5' end of the
             Brip1 gene for BRCA1 interacting protein C-terminal
             helicase 1 and a mitochondrial F0 complex H+ transporting
             ATP synthase subunit g (Atp5l) pseudogene, complete
             sequence
          Length = 200624

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 213   ggggaaatgtcacaagactt 232
             ||||||||||||||||||||
Sbjct: 82763 ggggaaatgtcacaagactt 82744
to top
>emb|AL731821.10| Mouse DNA sequence from clone RP23-81G15 on chromosome 4, complete
              sequence
          Length = 126671

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 170    ttcttcctttcagcaagact 189
              ||||||||||||||||||||
Sbjct: 104222 ttcttcctttcagcaagact 104241
to top
>gb|AC108480.3| Drosophila melanogaster X BAC RP98-2A13 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 175996

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 122    acaattcaatgcttttgctt 141
              ||||||||||||||||||||
Sbjct: 157371 acaattcaatgcttttgctt 157352
to top
>dbj|AK137575.1| Mus musculus adult male bone cDNA, RIKEN full-length enriched
            library, clone:9830145M22 product:hypothetical protein,
            full insert sequence
          Length = 2315

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 213  ggggaaatgtcacaagactt 232
            ||||||||||||||||||||
Sbjct: 1329 ggggaaatgtcacaagactt 1348
to top
>gb|AC004806.2| Homo sapiens 12 BAC RP11-360E11 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 131027

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 3     aacccaataatatttcattt 22
             ||||||||||||||||||||
Sbjct: 35130 aacccaataatatttcattt 35111
to top
>gb|AC097715.3| Homo sapiens BAC clone RP11-563A13 from 2, complete sequence
          Length = 143642

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 161  tgccttcacttcttcctttc 180
            ||||||||||||||||||||
Sbjct: 6810 tgccttcacttcttcctttc 6791
to top
>emb|AL773558.14| Zebrafish DNA sequence from clone CH211-207M11 in linkage group 16,
              complete sequence
          Length = 196875

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 119    acaacaattcaatgcttttg 138
              ||||||||||||||||||||
Sbjct: 144733 acaacaattcaatgcttttg 144714
to top
>emb|AJ011432.1|RNO011432 Rattus norvegicus gdnf gene
          Length = 19571

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 315   gttccgcgcttcttcttggt 334
             ||||||||||||||||||||
Sbjct: 10199 gttccgcgcttcttcttggt 10218
to top
>emb|CR848207.2| Xenopus tropicalis finished cDNA, clone TGas105h10
          Length = 3167

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 324  ttcttcttggtcttctcgtg 343
            ||||||||||||||||||||
Sbjct: 2711 ttcttcttggtcttctcgtg 2692
to top
>gb|AE003427.3| Drosophila melanogaster chromosome X, section 11 of 74 of the complete
             sequence
          Length = 213230

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 122   acaattcaatgcttttgctt 141
             ||||||||||||||||||||
Sbjct: 47045 acaattcaatgcttttgctt 47064
to top
>gb|AF023840.1|AF023840 Homo sapiens natural killer group protein 2-A (NKG2-A) gene, complete
            cds
          Length = 17549

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 275  aatcgagtgggtttgtagatcaat 298
            |||| |||||||||||||||||||
Sbjct: 3272 aatctagtgggtttgtagatcaat 3295
to top
>gb|BC064870.1| Xenopus tropicalis nucleolar and coiled-body phosphoprotein 1, mRNA
            (cDNA clone IMAGE:5335805), partial cds
          Length = 3154

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 324  ttcttcttggtcttctcgtg 343
            ||||||||||||||||||||
Sbjct: 2685 ttcttcttggtcttctcgtg 2666


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,554,628
Number of Sequences: 3902068
Number of extensions: 4554628
Number of successful extensions: 88257
Number of sequences better than 10.0: 43
Number of HSP's better than 10.0 without gapping: 43
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 88163
Number of HSP's gapped (non-prelim): 93
length of query: 458
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 436
effective length of database: 17,147,199,772
effective search space: 7476179100592
effective search space used: 7476179100592
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top