ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart09b06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC113991.4| Mus musculus chromosome 3, clone RP24-138E17, com... 40 1.3
2gb|AC115049.6| Mus musculus chromosome 3, clone RP24-332L11, com... 40 1.3
3gb|AC159019.4| Pan troglodytes BAC clone CH251-550K12 from chrom... 40 1.3
4emb|Z98200.9|HS111B22 Human DNA sequence from clone RP1-111B22 o... 40 1.3
5ref|XM_647954.1| Entamoeba histolytica HM-1:IMSS hypothetical pr... 38 5.0
6gb|AC100861.2| Homo sapiens chromosome 8, clone RP11-1149O23, co... 38 5.0
7emb|AL929261.27| Zebrafish DNA sequence from clone CH211-245H5 i... 38 5.0
8gb|AC007756.5|AC007756 Drosophila melanogaster, chromosome 3R, r... 38 5.0
9gb|AC090197.23| Homo sapiens chromosome 8, clone RP11-177H13, co... 38 5.0
10gb|AE003730.3| Drosophila melanogaster chromosome 3R, section 68... 38 5.0

>gb|AC113991.4| Mus musculus chromosome 3, clone RP24-138E17, complete sequence
          Length = 138057

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    tggacaacatacatctttat 66
             ||||||||||||||||||||
Sbjct: 29313 tggacaacatacatctttat 29294



to top

>gb|AC115049.6| Mus musculus chromosome 3, clone RP24-332L11, complete sequence
          Length = 165247

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 47   tggacaacatacatctttat 66
            ||||||||||||||||||||
Sbjct: 3647 tggacaacatacatctttat 3666



to top

>gb|AC159019.4| Pan troglodytes BAC clone CH251-550K12 from chromosome unknown, complete
              sequence
          Length = 196429

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 43     caagtggacaacatacatctttat 66
              ||||| ||||||||||||||||||
Sbjct: 104225 caagttgacaacatacatctttat 104202



to top

>emb|Z98200.9|HS111B22 Human DNA sequence from clone RP1-111B22 on chromosome 6q16-21 Contains a
              ribosomal protein L3 (RPL3) pseudogenee, the OSTM1 gene for
              osteopetrosis associated transmembrane, the 5' end of a
              novel gene and three CpG islands, complete sequence
          Length = 153382

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 43     caagtggacaacatacatctttat 66
              ||||| ||||||||||||||||||
Sbjct: 133939 caagttgacaacatacatctttat 133916



to top

>ref|XM_647954.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (95.t00022)
            partial mRNA
          Length = 2682

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 50   acaacatacatctttatta 68
            |||||||||||||||||||
Sbjct: 2428 acaacatacatctttatta 2446



to top

>gb|AC100861.2| Homo sapiens chromosome 8, clone RP11-1149O23, complete sequence
          Length = 164692

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 81    catacatttttatttccgtttat 103
             ||||||||||||||| |||||||
Sbjct: 36256 catacatttttatttgcgtttat 36234



to top

>emb|AL929261.27| Zebrafish DNA sequence from clone CH211-245H5 in linkage group 24,
              complete sequence
          Length = 193600

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 50     acaacatacatctttatta 68
              |||||||||||||||||||
Sbjct: 151322 acaacatacatctttatta 151304



to top

>gb|AC007756.5|AC007756 Drosophila melanogaster, chromosome 3R, region 92E-92E, BAC clone
             BACR10P06, complete sequence
          Length = 170105

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 84    acatttttatttccgttta 102
             |||||||||||||||||||
Sbjct: 80663 acatttttatttccgttta 80645



to top

>gb|AC090197.23| Homo sapiens chromosome 8, clone RP11-177H13, complete sequence
          Length = 179322

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 81    catacatttttatttccgtttat 103
             ||||||||||||||| |||||||
Sbjct: 49147 catacatttttatttgcgtttat 49169



to top

>gb|AE003730.3| Drosophila melanogaster chromosome 3R, section 68 of 118 of the complete
              sequence
          Length = 221402

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 84     acatttttatttccgttta 102
              |||||||||||||||||||
Sbjct: 173047 acatttttatttccgttta 173029


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,034,748
Number of Sequences: 3902068
Number of extensions: 1034748
Number of successful extensions: 73323
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 73298
Number of HSP's gapped (non-prelim): 25
length of query: 111
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 90
effective length of database: 17,151,101,840
effective search space: 1543599165600
effective search space used: 1543599165600
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top