ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart08g10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_479931.1| Oryza sativa (japonica cultivar-group), mRNA 170 3e-39
2dbj|D21130.1|RICYK704 Oryza sativa (japonica cultivar-group) YK7... 170 3e-39
3dbj|AK064857.1| Oryza sativa (japonica cultivar-group) cDNA clon... 170 3e-39
4dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 168 1e-38
5dbj|AP004591.3| Oryza sativa (japonica cultivar-group) genomic D... 168 1e-38
6emb|Y07959.1|ZMRPP0 Z.mays mRNA for acidic ribosomal protein P0 163 7e-37
7gb|AC123528.2| Oryza sativa chromosome 11 clone OSJNBa0078E03, ... 161 3e-36
8dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 161 3e-36
9gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 161 3e-36
10gb|BT016531.1| Zea mays clone Contig364 mRNA sequence 155 2e-34
11ref|XM_479932.1| Oryza sativa (japonica cultivar-group), mRNA 141 2e-30
12dbj|AK062008.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 2e-30
13dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 137 4e-29
14gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 137 4e-29
15emb|BX000508.1|CNS08CDY Oryza sativa chromosome 12, . BAC OJ1575... 137 4e-29
16emb|BX000498.1|CNS08CDO Oryza sativa chromosome 12, . BAC OSJNBa... 137 4e-29
17gb|BT018921.1| Zea mays clone Contig30.F mRNA sequence 94 5e-16
18dbj|AB236824.1| Trifolium pratense RNA for putative 60S acidic r... 66 1e-07
19emb|X15206.1|CRCRE2 C.rubrum mRNA for light-induced 34kD protein 62 2e-06
20gb|L46848.1|SOYARPP Glycine max acidic ribosomal protein P0 mRNA... 60 7e-06
21ref|NM_129559.2| Arabidopsis thaliana structural constituent of ... 58 3e-05
22gb|AY070448.1| Arabidopsis thaliana At2g40010 mRNA sequence 58 3e-05
23dbj|AB236811.1| Trifolium pratense RNA for putative 60S acidic r... 58 3e-05
24gb|AF002109.3| Arabidopsis thaliana chromosome 2 clone T28M21 ma... 58 3e-05
25emb|BX816288.1|CNS0AE9F Arabidopsis thaliana Full-length cDNA Co... 58 3e-05
26gb|BT001919.1| Arabidopsis thaliana clone C105444 putative 60S a... 58 3e-05
27ref|NM_111754.2| Arabidopsis thaliana structural constituent of ... 56 1e-04
28gb|AC011436.7|ATAC011436 Arabidopsis thaliana chromosome III BAC... 56 1e-04
29gb|AC009326.8|ATAC009326 Arabidopsis thaliana chromosome III P1 ... 56 1e-04
30gb|AY059117.1| Arabidopsis thaliana putative 60S acidic ribosoma... 56 1e-04
31gb|AF370225.1| Arabidopsis thaliana putative 60S acidic ribosoma... 56 1e-04
32emb|BX824039.1|CNS0A6RI Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
33emb|BX823923.1|CNS0A6KD Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
34gb|AY086582.1| Arabidopsis thaliana clone 2595 mRNA, complete se... 56 1e-04
35gb|BT016538.1| Zea mays clone Contig371 mRNA sequence 54 4e-04
36gb|DQ235177.1| Solanum tuberosum clone 157H11 acidic ribosomal p... 52 0.002
37gb|AC010009.7| Drosophila melanogaster 3L BAC RP98-23D16 (Roswel... 52 0.002
38gb|AC010011.5| Drosophila melanogaster 3L BAC RP98-17D14 (Roswel... 52 0.002
39ref|NM_079487.2| Drosophila melanogaster Ribosomal protein LP0 C... 52 0.002
40gb|AY075528.1| Drosophila melanogaster RE74511 full length cDNA 52 0.002
41emb|BX819391.1|CNS0A9W8 Arabidopsis thaliana Full-length cDNA Co... 52 0.002
42gb|BT021447.1| Drosophila melanogaster GH01513 full insert cDNA 52 0.002
43gb|AE003596.5| Drosophila melanogaster chromosome 3L, section 77... 52 0.002
44gb|M25772.1|DROAP3A Drosophila melanogaster DNA repair protein (... 52 0.002
45ref|NM_111960.2| Arabidopsis thaliana structural constituent of ... 50 0.007
46emb|BX071599.1|CNS09RER Single read from an extremity of a full-... 50 0.007
47emb|BX052086.1|CNS09CCQ Single read from an extremity of a full-... 50 0.007
48emb|BX052085.1|CNS09CCP Single read from an extremity of a full-... 50 0.007
49gb|AY091201.1| Arabidopsis thaliana putative 60S acidic ribosoma... 50 0.007
50gb|AY056150.1| Arabidopsis thaliana putative 60S acidic ribosoma... 50 0.007
51gb|AC073395.6|AC073395 Arabidopsis thaliana chromosome 3 BAC F11... 50 0.007
52gb|AY087728.1| Arabidopsis thaliana clone 38036 mRNA, complete s... 50 0.007
53gb|AC135667.5| Mus musculus BAC clone RP24-536G18 from chromosom... 48 0.027
54gb|DQ235176.1| Solanum tuberosum clone 156H10 P0 ribosomal prote... 48 0.027
55gb|AC122117.10| Mus musculus chromosome 18, clone RP23-61O22, co... 48 0.027
56gb|AC164402.3| Mus musculus chromosome 15, clone RP23-463G20, co... 48 0.027
57gb|BC042186.1| Homo sapiens cDNA clone IMAGE:5393404, partial cds 48 0.027
58emb|Z84486.1|HS528L19 Human DNA sequence from clone RP3-528L19 o... 48 0.027
59ref|XM_795562.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 48 0.027
60dbj|AK021773.1| Homo sapiens cDNA FLJ11711 fis, clone HEMBA1005152 48 0.027
61gb|AC069368.14| Homo sapiens chromosome 15, clone CTD-2017F17, c... 48 0.027
62gb|AC019084.9| Homo sapiens BAC clone RP11-354O2 from 7, complet... 48 0.027
63gb|AC153881.4| Mus musculus 10 BAC RP23-257B9 (Roswell Park Canc... 48 0.027
64dbj|AB178287.1| Neospora caninum NcRP1 mRNA for ribosomal protei... 48 0.027
65gb|DQ306774.1| Hevea brasiliensis isolate SSH45 mRNA sequence 48 0.027
66gb|DQ306752.1| Hevea brasiliensis isolate SSH23 mRNA sequence 48 0.027
67emb|AL928893.10| Mouse DNA sequence from clone RP23-55I14 on chr... 48 0.027
68gb|DQ241840.1| Solanum tuberosum clone 181G12 P0 ribosomal prote... 48 0.027
69gb|AC106843.11| Mus musculus chromosome 15, clone RP24-151M4, co... 48 0.027
70gb|AC114644.10| Mus musculus chromosome 1, clone RP24-128L10, co... 46 0.11
71gb|AC132899.11| Mus musculus chromosome 15, clone RP24-367P22, c... 46 0.11
72gb|AC118688.10| Mus musculus chromosome 5, clone RP23-302F24, co... 46 0.11
73ref|XM_467718.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.11
74ref|XM_464973.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.11
75gb|AC115846.7| Mus musculus chromosome 1, clone RP24-245O4, comp... 46 0.11
76gb|BT018010.1| Zea mays clone EL01N0528A08.c mRNA sequence 46 0.11
77gb|AC106169.5| Rattus norvegicus x BAC CH230-105D14 (Children's ... 46 0.11
78gb|DQ440047.1| Aedes aegypti clone AE-294 60S acidic ribosomal p... 46 0.11
79ref|XM_656186.1| Aspergillus nidulans FGSC A4 hypothetical prote... 46 0.11
80gb|AF039040.1| Caenorhabditis elegans cosmid T22B11, complete se... 46 0.11
81gb|AC157650.2| Mus musculus BAC clone RP24-573N21 from chromosom... 46 0.11
82gb|AC121604.3| Mus musculus BAC clone RP23-312E2 from chromosome... 46 0.11
83gb|AC131785.3| Mus musculus BAC clone RP24-397D13 from chromosom... 46 0.11
84gb|AC126670.4| Mus musculus BAC clone RP24-469G14 from chromosom... 46 0.11
85gb|AC127374.4| Mus musculus BAC clone RP23-46G11 from chromosome... 46 0.11
86gb|AC123558.5| Mus musculus BAC clone RP23-336N16 from chromosom... 46 0.11
87gb|AC121862.3| Mus musculus BAC clone RP24-110E10 from chromosom... 46 0.11
88gb|AC122246.5| Mus musculus BAC clone RP23-152K13 from 1, comple... 46 0.11
89gb|AC125344.2| Mus musculus BAC clone RP24-332H21 from 12, compl... 46 0.11
90emb|CR637846.2|CNS0ER4S Tetraodon nigroviridis full-length cDNA 46 0.11
91emb|AL596188.6| Human DNA sequence from clone CTA-31J9 on chromo... 46 0.11
92emb|AL157388.12| Human DNA sequence from clone RP11-215A21 on ch... 46 0.11
93gb|AY239227.1| Eimeria maxima TFP250 mRNA, complete cds 46 0.11
94emb|BX070622.1|CNS09QNM Single read from an extremity of a full-... 46 0.11
95emb|BX010374.1|CNS08G62 Single read from an extremity of a full-... 46 0.11
96emb|CR938347.1| Single read from an extremity of a full-length c... 46 0.11
97emb|CR937313.1| Single read from an extremity of a cDNA clone ma... 46 0.11
98emb|CR937312.1| Single read from an extremity of a cDNA clone ma... 46 0.11
99gb|AC163649.3| Mus musculus BAC clone RP24-372B10 from chromosom... 46 0.11
100gb|AC110377.5| Mus musculus BAC clone RP23-460A13 from chromosom... 46 0.11
101ref|NM_001028223.2| Caenorhabditis elegans T22B11.4b (T22B11.4) ... 46 0.11
102ref|NM_001028222.2| Caenorhabditis elegans T22B11.4a (T22B11.4) ... 46 0.11
103dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.11
104dbj|AP004815.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.11
105dbj|AP004800.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.11
106dbj|AP005533.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.11
107dbj|AP004001.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.11
108dbj|AK071385.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.11
109dbj|AK058613.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.11
110tpe|BN000560.1| TPA: TPA_inf: Oryza sativa (japonica cultivar-gr... 46 0.11
111gb|AC117614.12| Mus musculus chromosome 5, clone RP23-110C17, co... 46 0.11
112gb|AC140416.2| Mus musculus BAC clone RP24-347A16 from 6, comple... 46 0.11
113gb|AC122486.4| Mus musculus BAC clone RP24-380B9 from 12, comple... 46 0.11
114gb|AC124344.6| Mus musculus BAC clone RP24-448A7 from 3, complet... 46 0.11
115gb|AC132407.3| Mus musculus BAC clone RP23-343G12 from 8, comple... 46 0.11
116gb|U62752.1|ZMU62752 Zea mays acidic ribosomal protein P1a (rpp1... 46 0.11
117gb|U40147.1|ZMU40147 Zea mays ribosomal protein L12 mRNA, comple... 46 0.11
118gb|DQ270163.1| Cricetulus barabensis clone L5 microsatellite seq... 46 0.11
119emb|AL596331.15| Mouse DNA sequence from clone RP23-81G14 on chr... 46 0.11
120emb|AL627236.11| Mouse DNA sequence from clone RP23-384G12 on ch... 46 0.11
121gb|L24094.1|GORADPRB Gorilla gorilla ADP-ribosyltransferase (NAD... 46 0.11
122gb|AC114554.8| Mus musculus chromosome 5, clone RP23-414E14, com... 44 0.43
123gb|DQ213908.1| Taeniopygia guttata clone 0061P0002B01 mRNA sequence 44 0.43
124gb|AC128859.4| Rattus norvegicus 10 BAC CH230-436I22 (Children's... 44 0.43
125gb|AY674236.1| Ixodes pacificus clone IP_7_60_92_569_CLU ribosom... 44 0.43
126gb|AC124614.11| Mus musculus chromosome 10, clone RP24-417L12, c... 44 0.43
127gb|AC114674.10| Mus musculus chromosome 9, clone RP24-209N21, co... 44 0.43
128gb|AC140426.3| Mus musculus BAC clone RP24-98A17 from chromosome... 44 0.43
129gb|AY391258.1| Oxyrrhis marina heat shock protein 90 gene, parti... 44 0.43
130gb|AC133514.4| Mus musculus BAC clone RP23-212F6 from chromosome... 44 0.43
131gb|AC125057.5| Mus musculus BAC clone RP23-399K1 from chromosome... 44 0.43
132gb|AC125128.3| Mus musculus BAC clone RP24-289N17 from chromosom... 44 0.43
133emb|Z70280.1|HSV210E9 Human DNA sequence from clone GHc-210E9 on... 44 0.43
134emb|BX649553.6| Human DNA sequence from clone RP4-674K6 on chrom... 44 0.43
135emb|AL160162.11| Human DNA sequence from clone RP1-200K18 on chr... 44 0.43
136emb|AL138809.18| Human DNA sequence from clone RP5-981M18 on chr... 44 0.43
137emb|AL662806.20| Mouse DNA sequence from clone RP23-273O7 on chr... 44 0.43
138gb|AC164578.5| Mus musculus BAC RP23-15E20 (Roswell Park Cancer... 44 0.43
139emb|AL645971.12| Mouse DNA sequence from clone RP23-378J19 on ch... 44 0.43
140emb|AL928566.4| Mouse DNA sequence from clone RP23-311A20 on chr... 44 0.43
141dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 44 0.43
142gb|AC127520.5| Homo sapiens chromosome 15, clone RP11-825M14, co... 44 0.43
143gb|AC150899.3| Mus musculus BAC clone RP23-179F8 from chromosome... 44 0.43
144gb|AC009063.8| Homo sapiens chromosome 16 clone RP11-298D21, com... 44 0.43
145gb|DQ066213.1| Ixodes scapularis isolate ISUFL22 60S acidic ribo... 44 0.43
146gb|DQ066207.1| Ixodes scapularis isolate ISUFL46 ribosomal prote... 44 0.43
147gb|AC158658.4| Mus musculus 6 BAC RP23-400L4 (Roswell Park Cance... 44 0.43
148gb|AC012320.6|AC012320 Homo sapiens chromosome 16 clone RP11-280... 44 0.43
149gb|AC097586.3| Sus scrofa clone RP44-394E19, complete sequence 44 0.43
150gb|AC068831.17| Homo sapiens chromosome 15, clone RP11-2O19, com... 44 0.43
151gb|AF227622.1|AF227622 Euphorbia esula 60S acidic ribosomal prot... 44 0.43
152emb|AJ322895.1|HSA322895 Homo sapiens genomic sequence surroundi... 44 0.43
153dbj|AP000722.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 44 0.43
154gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 44 0.43
155dbj|AP003124.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 44 0.43
156dbj|AP002469.3| Homo sapiens genomic DNA, chromosome 11q, clone:... 44 0.43
157dbj|AP002762.4| Homo sapiens genomic DNA, chromosome 11 clone:RP... 44 0.43
158emb|AL671672.4| Mouse DNA sequence from clone RP23-461E2 on chro... 44 0.43
159emb|AL844609.6| Mouse DNA sequence from clone RP23-356F8 on chro... 44 0.43
160emb|AL731783.10| Mouse DNA sequence from clone RP23-124E18 on ch... 44 0.43
161ref|NM_125750.3| Arabidopsis thaliana unknown protein AT5G63550 ... 42 1.7
162gb|AC168056.3| Mus musculus BAC clone RP24-189B1 from chromosome... 42 1.7
163ref|NM_187845.1| Oryza sativa (japonica cultivar-group), Ozsa828... 42 1.7
164gb|AC163684.5| Mus musculus BAC clone RP23-8N10 from chromosome ... 42 1.7
165ref|NM_001017204.2| Xenopus tropicalis hypothetical protein LOC5... 42 1.7
166gb|AC104414.8| Mus musculus chromosome 3, clone RP23-99I7, compl... 42 1.7
167gb|BT018956.1| Zea mays clone Contig167.F mRNA sequence 42 1.7
168gb|AC102270.8| Mus musculus chromosome 3, clone RP24-266A23, com... 42 1.7
169gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chr... 42 1.7
170gb|AF039037.2| Caenorhabditis elegans cosmid R02C2, complete seq... 42 1.7
171gb|AC110567.10| Mus musculus chromosome 5, clone RP23-304I24, co... 42 1.7
172gb|AY550907.1| Mus musculus embryonic stem cell-related protein ... 42 1.7
173ref|NM_001006887.2| Xenopus tropicalis polymerase (RNA) II (DNA ... 42 1.7
174ref|NM_026560.2| Mus musculus cell division cycle associated 8 (... 42 1.7
175gb|AC164588.4| Mus musculus chromosome 5, clone RP24-304H2, comp... 42 1.7
176gb|AC161042.4| Mus musculus chromosome 8, clone RP24-278L20, com... 42 1.7
177gb|AC111125.11| Mus musculus chromosome 9, clone RP23-331P8, com... 42 1.7
178ref|XM_755686.1| Ustilago maydis 521 hypothetical protein (UM046... 42 1.7
179emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 42 1.7
180emb|CR974571.9| Mouse DNA sequence from clone RP23-145P19 on chr... 42 1.7
181ref|XM_572834.1| Cryptococcus neoformans var. neoformans JEC21 p... 42 1.7
182gb|AC122199.4| Mus musculus BAC clone RP23-57C9 from chromosome ... 42 1.7
183ref|XM_812376.1| Trypanosoma cruzi strain CL Brener hypothetical... 42 1.7
184emb|CR729373.2|CNS0GPQB Tetraodon nigroviridis full-length cDNA 42 1.7
185gb|AC011992.3| Homo sapiens BAC clone CTD-2327A23 from 7, comple... 42 1.7
186gb|DQ334167.1| Drosophila miranda CG3620 gene, partial cds 42 1.7
187emb|AL138847.14| Human DNA sequence from clone RP5-849H19 on chr... 42 1.7
188emb|BX053470.1|CNS09DF6 Single read from an extremity of a full-... 42 1.7
189emb|BX053469.1|CNS09DF5 Single read from an extremity of a full-... 42 1.7
190emb|BX072032.1|CNS09RQS Single read from an extremity of a full-... 42 1.7
191emb|BX072030.1|CNS09RQQ Single read from an extremity of a full-... 42 1.7
192emb|BX072029.1|CNS09RQP Single read from an extremity of a full-... 42 1.7
193emb|BX071994.1|CNS09RPQ Single read from an extremity of a full-... 42 1.7
194emb|BX071993.1|CNS09RPP Single read from an extremity of a full-... 42 1.7
195emb|BX071848.1|CNS09RLO Single read from an extremity of a full-... 42 1.7
196emb|BX071847.1|CNS09RLN Single read from an extremity of a full-... 42 1.7
197emb|BX071748.1|CNS09RIW Single read from an extremity of a full-... 42 1.7
198emb|BX071747.1|CNS09RIV Single read from an extremity of a full-... 42 1.7
199emb|BX071519.1|CNS09RCJ Single read from an extremity of a full-... 42 1.7
200emb|BX071226.1|CNS09R4E Single read from an extremity of a full-... 42 1.7
201emb|BX071176.1|CNS09R30 Single read from an extremity of a full-... 42 1.7
202emb|BX071175.1|CNS09R2Z Single read from an extremity of a full-... 42 1.7
203emb|BX071446.1|CNS09RAI Single read from an extremity of a full-... 42 1.7
204emb|BX071445.1|CNS09RAH Single read from an extremity of a full-... 42 1.7
205emb|BX071387.1|CNS09R8V Single read from an extremity of a full-... 42 1.7
206emb|BX071040.1|CNS09QZ8 Single read from an extremity of a full-... 42 1.7
207emb|BX071039.1|CNS09QZ7 Single read from an extremity of a full-... 42 1.7
208emb|BX070974.1|CNS09QXE Single read from an extremity of a full-... 42 1.7
209emb|BX070973.1|CNS09QXD Single read from an extremity of a full-... 42 1.7
210emb|BX070931.1|CNS09QW7 Single read from an extremity of a full-... 42 1.7
211emb|BX070930.1|CNS09QW6 Single read from an extremity of a full-... 42 1.7
212emb|BX070901.1|CNS09QVD Single read from an extremity of a full-... 42 1.7
213emb|BX070900.1|CNS09QVC Single read from an extremity of a full-... 42 1.7
214emb|BX070752.1|CNS09QR8 Single read from an extremity of a full-... 42 1.7
215emb|BX070751.1|CNS09QR7 Single read from an extremity of a full-... 42 1.7
216emb|BX070746.1|CNS09QR2 Single read from an extremity of a full-... 42 1.7
217emb|BX070745.1|CNS09QR1 Single read from an extremity of a full-... 42 1.7
218emb|BX070623.1|CNS09QNN Single read from an extremity of a full-... 42 1.7
219emb|BX070542.1|CNS09QLE Single read from an extremity of a full-... 42 1.7
220emb|BX070100.1|CNS09Q94 Single read from an extremity of a full-... 42 1.7
221emb|BX070099.1|CNS09Q93 Single read from an extremity of a full-... 42 1.7
222emb|BX069969.1|CNS09Q5H Single read from an extremity of a full-... 42 1.7
223emb|BX069968.1|CNS09Q5G Single read from an extremity of a full-... 42 1.7
224emb|BX069824.1|CNS09Q1G Single read from an extremity of a full-... 42 1.7
225emb|BX069823.1|CNS09Q1F Single read from an extremity of a full-... 42 1.7
226emb|BX069792.1|CNS09Q0K Single read from an extremity of a full-... 42 1.7
227emb|BX061099.1|CNS09JB3 Single read from an extremity of a full-... 42 1.7
228emb|BX061098.1|CNS09JB2 Single read from an extremity of a full-... 42 1.7
229emb|BX061090.1|CNS09JAU Single read from an extremity of a full-... 42 1.7
230emb|BX061062.1|CNS09JA2 Single read from an extremity of a full-... 42 1.7
231emb|BX061061.1|CNS09JA1 Single read from an extremity of a full-... 42 1.7
232emb|BX069589.1|CNS09PUX Single read from an extremity of a full-... 42 1.7
233emb|BX069404.1|CNS09PPS Single read from an extremity of a full-... 42 1.7
234emb|BX069403.1|CNS09PPR Single read from an extremity of a full-... 42 1.7
235emb|BX069337.1|CNS09PNX Single read from an extremity of a full-... 42 1.7
236emb|BX069336.1|CNS09PNW Single read from an extremity of a full-... 42 1.7
237emb|BX069236.1|CNS09PL4 Single read from an extremity of a full-... 42 1.7
238emb|BX069143.1|CNS09PIJ Single read from an extremity of a full-... 42 1.7
239emb|BX069142.1|CNS09PII Single read from an extremity of a full-... 42 1.7
240emb|BX068989.1|CNS09PE9 Single read from an extremity of a full-... 42 1.7
241emb|BX068988.1|CNS09PE8 Single read from an extremity of a full-... 42 1.7
242emb|BX068834.1|CNS09P9Y Single read from an extremity of a full-... 42 1.7
243emb|BX068833.1|CNS09P9X Single read from an extremity of a full-... 42 1.7
244emb|BX068816.1|CNS09P9G Single read from an extremity of a full-... 42 1.7
245emb|BX068815.1|CNS09P9F Single read from an extremity of a full-... 42 1.7
246emb|BX068608.1|CNS09P3O Single read from an extremity of a full-... 42 1.7
247emb|BX068586.1|CNS09P32 Single read from an extremity of a full-... 42 1.7
248emb|BX068585.1|CNS09P31 Single read from an extremity of a full-... 42 1.7
249emb|BX068472.1|CNS09OZW Single read from an extremity of a full-... 42 1.7
250emb|BX068471.1|CNS09OZV Single read from an extremity of a full-... 42 1.7
251emb|BX068230.1|CNS09OT6 Single read from an extremity of a full-... 42 1.7
252emb|BX068020.1|CNS09ONC Single read from an extremity of a full-... 42 1.7
253emb|BX068019.1|CNS09ONB Single read from an extremity of a full-... 42 1.7
254emb|BX067975.1|CNS09OM3 Single read from an extremity of a full-... 42 1.7
255emb|BX067974.1|CNS09OM2 Single read from an extremity of a full-... 42 1.7
256emb|BX067842.1|CNS09OIE Single read from an extremity of a full-... 42 1.7
257emb|BX067776.1|CNS09OGK Single read from an extremity of a full-... 42 1.7
258emb|BX067775.1|CNS09OGJ Single read from an extremity of a full-... 42 1.7
259emb|BX067753.1|CNS09OFX Single read from an extremity of a full-... 42 1.7
260emb|BX067752.1|CNS09OFW Single read from an extremity of a full-... 42 1.7
261emb|BX067708.1|CNS09OEO Single read from an extremity of a full-... 42 1.7
262emb|BX067707.1|CNS09OEN Single read from an extremity of a full-... 42 1.7
263emb|BX067488.1|CNS09O8K Single read from an extremity of a full-... 42 1.7
264emb|BX067430.1|CNS09O6Y Single read from an extremity of a full-... 42 1.7
265emb|BX067429.1|CNS09O6X Single read from an extremity of a full-... 42 1.7
266emb|BX066993.1|CNS09NUT Single read from an extremity of a full-... 42 1.7
267emb|BX067216.1|CNS09O10 Single read from an extremity of a full-... 42 1.7
268emb|BX067180.1|CNS09O00 Single read from an extremity of a full-... 42 1.7
269emb|BX067179.1|CNS09NZZ Single read from an extremity of a full-... 42 1.7
270emb|BX066855.1|CNS09NQZ Single read from an extremity of a full-... 42 1.7
271emb|BX066854.1|CNS09NQY Single read from an extremity of a full-... 42 1.7
272emb|BX066837.1|CNS09NQH Single read from an extremity of a full-... 42 1.7
273emb|BX066836.1|CNS09NQG Single read from an extremity of a full-... 42 1.7
274emb|BX066624.1|CNS09NKK Single read from an extremity of a full-... 42 1.7
275emb|BX066598.1|CNS09NJU Single read from an extremity of a full-... 42 1.7
276emb|BX066597.1|CNS09NJT Single read from an extremity of a full-... 42 1.7
277emb|BX066427.1|CNS09NF3 Single read from an extremity of a full-... 42 1.7
278emb|BX066426.1|CNS09NF2 Single read from an extremity of a full-... 42 1.7
279emb|BX066413.1|CNS09NEP Single read from an extremity of a full-... 42 1.7
280emb|BX066412.1|CNS09NEO Single read from an extremity of a full-... 42 1.7
281emb|BX066330.1|CNS09NCE Single read from an extremity of a full-... 42 1.7
282emb|BX065817.1|CNS09MY5 Single read from an extremity of a full-... 42 1.7
283emb|BX065714.1|CNS09MVA Single read from an extremity of a full-... 42 1.7
284emb|BX065713.1|CNS09MV9 Single read from an extremity of a full-... 42 1.7
285emb|BX065466.1|CNS09MOE Single read from an extremity of a full-... 42 1.7
286emb|BX065465.1|CNS09MOD Single read from an extremity of a full-... 42 1.7
287emb|BX065360.1|CNS09MLG Single read from an extremity of a full-... 42 1.7
288emb|BX065335.1|CNS09MKR Single read from an extremity of a full-... 42 1.7
289emb|BX065334.1|CNS09MKQ Single read from an extremity of a full-... 42 1.7
290emb|BX065250.1|CNS09MIE Single read from an extremity of a full-... 42 1.7
291emb|BX065249.1|CNS09MID Single read from an extremity of a full-... 42 1.7
292emb|BX065043.1|CNS09MCN Single read from an extremity of a full-... 42 1.7
293emb|BX065016.1|CNS09MBW Single read from an extremity of a full-... 42 1.7
294emb|BX065015.1|CNS09MBV Single read from an extremity of a full-... 42 1.7
295emb|BX065006.1|CNS09MBM Single read from an extremity of a full-... 42 1.7
296emb|BX065005.1|CNS09MBL Single read from an extremity of a full-... 42 1.7
297emb|BX064953.1|CNS09MA5 Single read from an extremity of a full-... 42 1.7
298emb|BX064952.1|CNS09MA4 Single read from an extremity of a full-... 42 1.7
299emb|BX064761.1|CNS09M4T Single read from an extremity of a full-... 42 1.7
300emb|BX064760.1|CNS09M4S Single read from an extremity of a full-... 42 1.7
301emb|BX064726.1|CNS09M3U Single read from an extremity of a full-... 42 1.7
302emb|BX064725.1|CNS09M3T Single read from an extremity of a full-... 42 1.7
303emb|BX064602.1|CNS09M0E Single read from an extremity of a full-... 42 1.7
304emb|BX064296.1|CNS09LRW Single read from an extremity of a full-... 42 1.7
305emb|BX064285.1|CNS09LRL Single read from an extremity of a full-... 42 1.7
306emb|BX064284.1|CNS09LRK Single read from an extremity of a full-... 42 1.7
307emb|BX064165.1|CNS09LO9 Single read from an extremity of a full-... 42 1.7
308emb|BX064164.1|CNS09LO8 Single read from an extremity of a full-... 42 1.7
309emb|BX064121.1|CNS09LN1 Single read from an extremity of a full-... 42 1.7
310emb|BX064120.1|CNS09LN0 Single read from an extremity of a full-... 42 1.7
311emb|BX064069.1|CNS09LLL Single read from an extremity of a full-... 42 1.7
312emb|BX064068.1|CNS09LLK Single read from an extremity of a full-... 42 1.7
313emb|BX063873.1|CNS09LG5 Single read from an extremity of a full-... 42 1.7
314emb|BX063872.1|CNS09LG4 Single read from an extremity of a full-... 42 1.7
315emb|BX063467.1|CNS09L4V Single read from an extremity of a full-... 42 1.7
316emb|BX063466.1|CNS09L4U Single read from an extremity of a full-... 42 1.7
317emb|BX063421.1|CNS09L3L Single read from an extremity of a full-... 42 1.7
318emb|BX063228.1|CNS09KY8 Single read from an extremity of a full-... 42 1.7
319emb|BX063227.1|CNS09KY7 Single read from an extremity of a full-... 42 1.7
320emb|BX062791.1|CNS09KM3 Single read from an extremity of a full-... 42 1.7
321emb|BX062553.1|CNS09KFH Single read from an extremity of a full-... 42 1.7
322emb|BX062552.1|CNS09KFG Single read from an extremity of a full-... 42 1.7
323emb|BX062547.1|CNS09KFB Single read from an extremity of a full-... 42 1.7
324emb|BX062388.1|CNS09KAW Single read from an extremity of a full-... 42 1.7
325emb|BX062387.1|CNS09KAV Single read from an extremity of a full-... 42 1.7
326emb|BX062300.1|CNS09K8G Single read from an extremity of a full-... 42 1.7
327emb|BX062299.1|CNS09K8F Single read from an extremity of a full-... 42 1.7
328emb|BX062298.1|CNS09K8E Single read from an extremity of a full-... 42 1.7
329emb|BX062297.1|CNS09K8D Single read from an extremity of a full-... 42 1.7
330emb|BX062170.1|CNS09K4U Single read from an extremity of a full-... 42 1.7
331emb|BX062048.1|CNS09K1G Single read from an extremity of a full-... 42 1.7
332emb|BX061878.1|CNS09JWQ Single read from an extremity of a full-... 42 1.7
333emb|BX061190.1|CNS09JDM Single read from an extremity of a full-... 42 1.7
334emb|BX061138.1|CNS09JC6 Single read from an extremity of a full-... 42 1.7
335emb|BX061137.1|CNS09JC5 Single read from an extremity of a full-... 42 1.7
336emb|BX061133.1|CNS09JC1 Single read from an extremity of a full-... 42 1.7
337emb|BX060643.1|CNS09IYF Single read from an extremity of a full-... 42 1.7
338emb|BX060642.1|CNS09IYE Single read from an extremity of a full-... 42 1.7
339emb|BX060528.1|CNS09IV8 Single read from an extremity of a full-... 42 1.7
340emb|BX060527.1|CNS09IV7 Single read from an extremity of a full-... 42 1.7
341emb|BX060489.1|CNS09IU5 Single read from an extremity of a full-... 42 1.7
342emb|BX060488.1|CNS09IU4 Single read from an extremity of a full-... 42 1.7
343emb|BX060444.1|CNS09ISW Single read from an extremity of a full-... 42 1.7
344emb|BX060443.1|CNS09ISV Single read from an extremity of a full-... 42 1.7
345emb|BX060186.1|CNS09ILQ Single read from an extremity of a full-... 42 1.7
346emb|BX060185.1|CNS09ILP Single read from an extremity of a full-... 42 1.7
347emb|BX059917.1|CNS09IE9 Single read from an extremity of a full-... 42 1.7
348emb|BX059759.1|CNS09I9V Single read from an extremity of a full-... 42 1.7
349emb|BX059758.1|CNS09I9U Single read from an extremity of a full-... 42 1.7
350emb|BX059742.1|CNS09I9E Single read from an extremity of a full-... 42 1.7
351emb|BX059741.1|CNS09I9D Single read from an extremity of a full-... 42 1.7
352emb|BX059588.1|CNS09I54 Single read from an extremity of a full-... 42 1.7
353emb|BX059587.1|CNS09I53 Single read from an extremity of a full-... 42 1.7
354emb|BX059586.1|CNS09I52 Single read from an extremity of a full-... 42 1.7
355emb|BX059585.1|CNS09I51 Single read from an extremity of a full-... 42 1.7
356emb|BX059470.1|CNS09I1U Single read from an extremity of a full-... 42 1.7
357emb|BX059469.1|CNS09I1T Single read from an extremity of a full-... 42 1.7
358emb|BX059306.1|CNS09HXA Single read from an extremity of a full-... 42 1.7
359emb|BX059305.1|CNS09HX9 Single read from an extremity of a full-... 42 1.7
360emb|BX059221.1|CNS09HUX Single read from an extremity of a full-... 42 1.7
361emb|BX059220.1|CNS09HUW Single read from an extremity of a full-... 42 1.7
362emb|BX059096.1|CNS09HRG Single read from an extremity of a full-... 42 1.7
363emb|BX059095.1|CNS09HRF Single read from an extremity of a full-... 42 1.7
364emb|BX058840.1|CNS09HKC Single read from an extremity of a full-... 42 1.7
365emb|BX058839.1|CNS09HKB Single read from an extremity of a full-... 42 1.7
366emb|BX058822.1|CNS09HJU Single read from an extremity of a full-... 42 1.7
367emb|BX058821.1|CNS09HJT Single read from an extremity of a full-... 42 1.7
368emb|BX058761.1|CNS09HI5 Single read from an extremity of a full-... 42 1.7
369emb|BX058760.1|CNS09HI4 Single read from an extremity of a full-... 42 1.7
370emb|BX058741.1|CNS09HHL Single read from an extremity of a full-... 42 1.7
371emb|BX058730.1|CNS09HHA Single read from an extremity of a full-... 42 1.7
372emb|BX058729.1|CNS09HH9 Single read from an extremity of a full-... 42 1.7
373emb|BX058204.1|CNS09H2O Single read from an extremity of a full-... 42 1.7
374emb|BX058203.1|CNS09H2N Single read from an extremity of a full-... 42 1.7
375emb|BX056755.1|CNS09FYF Single read from an extremity of a full-... 42 1.7
376emb|BX056754.1|CNS09FYE Single read from an extremity of a full-... 42 1.7
377emb|BX057925.1|CNS09GUX Single read from an extremity of a full-... 42 1.7
378emb|BX057924.1|CNS09GUW Single read from an extremity of a full-... 42 1.7
379emb|BX057870.1|CNS09GTE Single read from an extremity of a full-... 42 1.7
380emb|BX057797.1|CNS09GRD Single read from an extremity of a full-... 42 1.7
381emb|BX057749.1|CNS09GQ1 Single read from an extremity of a full-... 42 1.7
382emb|BX057632.1|CNS09GMS Single read from an extremity of a full-... 42 1.7
383emb|BX057606.1|CNS09GM2 Single read from an extremity of a full-... 42 1.7
384emb|BX057219.1|CNS09GBB Single read from an extremity of a full-... 42 1.7
385emb|BX057218.1|CNS09GBA Single read from an extremity of a full-... 42 1.7
386emb|BX057075.1|CNS09G7B Single read from an extremity of a full-... 42 1.7
387emb|BX056997.1|CNS09G55 Single read from an extremity of a full-... 42 1.7
388emb|BX056959.1|CNS09G43 Single read from an extremity of a full-... 42 1.7
389emb|BX056915.1|CNS09G2V Single read from an extremity of a full-... 42 1.7
390emb|BX056543.1|CNS09FSJ Single read from an extremity of a full-... 42 1.7
391emb|BX056542.1|CNS09FSI Single read from an extremity of a full-... 42 1.7
392emb|BX056484.1|CNS09FQW Single read from an extremity of a full-... 42 1.7
393emb|BX055809.1|CNS09F85 Single read from an extremity of a full-... 42 1.7
394emb|BX055808.1|CNS09F84 Single read from an extremity of a full-... 42 1.7
395emb|BX056321.1|CNS09FMD Single read from an extremity of a full-... 42 1.7
396emb|BX056300.1|CNS09FLS Single read from an extremity of a full-... 42 1.7
397emb|BX056288.1|CNS09FLG Single read from an extremity of a full-... 42 1.7
398emb|BX056287.1|CNS09FLF Single read from an extremity of a full-... 42 1.7
399emb|BX056286.1|CNS09FLE Single read from an extremity of a full-... 42 1.7
400emb|BX056285.1|CNS09FLD Single read from an extremity of a full-... 42 1.7
401emb|BX056283.1|CNS09FLB Single read from an extremity of a full-... 42 1.7
402emb|BX055726.1|CNS09F5U Single read from an extremity of a full-... 42 1.7
403emb|BX055722.1|CNS09F5Q Single read from an extremity of a full-... 42 1.7
404emb|BX055721.1|CNS09F5P Single read from an extremity of a full-... 42 1.7
405emb|BX055604.1|CNS09F2G Single read from an extremity of a full-... 42 1.7
406emb|BX055568.1|CNS09F1G Single read from an extremity of a full-... 42 1.7
407emb|BX055148.1|CNS09EPS Single read from an extremity of a full-... 42 1.7
408emb|BX055147.1|CNS09EPR Single read from an extremity of a full-... 42 1.7
409emb|BX053215.1|CNS09D83 Single read from an extremity of a full-... 42 1.7
410emb|BX053146.1|CNS09D66 Single read from an extremity of a full-... 42 1.7
411emb|BX052949.1|CNS09D0P Single read from an extremity of a full-... 42 1.7
412emb|BX052947.1|CNS09D0N Single read from an extremity of a full-... 42 1.7
413emb|BX052946.1|CNS09D0M Single read from an extremity of a full-... 42 1.7
414emb|BX054655.1|CNS09EC3 Single read from an extremity of a full-... 42 1.7
415emb|BX054654.1|CNS09EC2 Single read from an extremity of a full-... 42 1.7
416emb|BX054541.1|CNS09E8X Single read from an extremity of a full-... 42 1.7
417emb|BX054540.1|CNS09E8W Single read from an extremity of a full-... 42 1.7
418emb|BX054436.1|CNS09E60 Single read from an extremity of a full-... 42 1.7
419emb|BX054247.1|CNS09E0R Single read from an extremity of a full-... 42 1.7
420emb|BX054246.1|CNS09E0Q Single read from an extremity of a full-... 42 1.7
421emb|BX054187.1|CNS09DZ3 Single read from an extremity of a full-... 42 1.7
422emb|BX054186.1|CNS09DZ2 Single read from an extremity of a full-... 42 1.7
423emb|BX054115.1|CNS09DX3 Single read from an extremity of a full-... 42 1.7
424emb|BX054114.1|CNS09DX2 Single read from an extremity of a full-... 42 1.7
425emb|BX054049.1|CNS09DV9 Single read from an extremity of a full-... 42 1.7
426emb|BX053890.1|CNS09DQU Single read from an extremity of a full-... 42 1.7
427emb|BX053889.1|CNS09DQT Single read from an extremity of a full-... 42 1.7
428emb|BX053752.1|CNS09DN0 Single read from an extremity of a full-... 42 1.7
429emb|BX053705.1|CNS09DLP Single read from an extremity of a full-... 42 1.7
430emb|BX053704.1|CNS09DLO Single read from an extremity of a full-... 42 1.7
431emb|BX053693.1|CNS09DLD Single read from an extremity of a full-... 42 1.7
432emb|BX053533.1|CNS09DGX Single read from an extremity of a full-... 42 1.7
433emb|BX053532.1|CNS09DGW Single read from an extremity of a full-... 42 1.7
434emb|BX053516.1|CNS09DGG Single read from an extremity of a full-... 42 1.7
435emb|BX052875.1|CNS09CYN Single read from an extremity of a full-... 42 1.7
436emb|BX052874.1|CNS09CYM Single read from an extremity of a full-... 42 1.7
437emb|BX052835.1|CNS09CXJ Single read from an extremity of a full-... 42 1.7
438emb|BX052778.1|CNS09CVY Single read from an extremity of a full-... 42 1.7
439emb|BX052777.1|CNS09CVX Single read from an extremity of a full-... 42 1.7
440emb|BX052725.1|CNS09CUH Single read from an extremity of a full-... 42 1.7
441emb|BX052369.1|CNS09CKL Single read from an extremity of a full-... 42 1.7
442emb|BX052368.1|CNS09CKK Single read from an extremity of a full-... 42 1.7
443emb|BX052264.1|CNS09CHO Single read from an extremity of a full-... 42 1.7
444emb|BX052263.1|CNS09CHN Single read from an extremity of a full-... 42 1.7
445emb|BX052064.1|CNS09CC4 Single read from an extremity of a full-... 42 1.7
446emb|BX051751.1|CNS09C3F Single read from an extremity of a full-... 42 1.7
447emb|BX051600.1|CNS09BZ8 Single read from an extremity of a full-... 42 1.7
448emb|BX051578.1|CNS09BYM Single read from an extremity of a full-... 42 1.7
449emb|BX051577.1|CNS09BYL Single read from an extremity of a full-... 42 1.7
450emb|BX051510.1|CNS09BWQ Single read from an extremity of a full-... 42 1.7
451emb|BX051509.1|CNS09BWP Single read from an extremity of a full-... 42 1.7
452emb|BX051473.1|CNS09BVP Single read from an extremity of a full-... 42 1.7
453emb|BX051472.1|CNS09BVO Single read from an extremity of a full-... 42 1.7
454emb|BX051302.1|CNS09BQY Single read from an extremity of a full-... 42 1.7
455emb|BX051301.1|CNS09BQX Single read from an extremity of a full-... 42 1.7
456emb|BX050245.1|CNS09AXL Single read from an extremity of a full-... 42 1.7
457emb|BX050197.1|CNS09AW9 Single read from an extremity of a full-... 42 1.7
458emb|BX050804.1|CNS09BD4 Single read from an extremity of a full-... 42 1.7
459emb|BX050762.1|CNS09BBY Single read from an extremity of a full-... 42 1.7
460emb|BX050724.1|CNS09BAW Single read from an extremity of a full-... 42 1.7
461emb|BX050712.1|CNS09BAK Single read from an extremity of a full-... 42 1.7
462emb|BX050711.1|CNS09BAJ Single read from an extremity of a full-... 42 1.7
463emb|BX050703.1|CNS09BAB Single read from an extremity of a full-... 42 1.7
464emb|BX050702.1|CNS09BAA Single read from an extremity of a full-... 42 1.7
465emb|BX050680.1|CNS09B9O Single read from an extremity of a full-... 42 1.7
466emb|BX050679.1|CNS09B9N Single read from an extremity of a full-... 42 1.7
467emb|BX050553.1|CNS09B65 Single read from an extremity of a full-... 42 1.7
468emb|BX050546.1|CNS09B5Y Single read from an extremity of a full-... 42 1.7
469emb|BX050545.1|CNS09B5X Single read from an extremity of a full-... 42 1.7
470emb|BX050515.1|CNS09B53 Single read from an extremity of a full-... 42 1.7
471emb|BX050480.1|CNS09B44 Single read from an extremity of a full-... 42 1.7
472emb|BX050438.1|CNS09B2Y Single read from an extremity of a full-... 42 1.7
473emb|BX050437.1|CNS09B2X Single read from an extremity of a full-... 42 1.7
474emb|BX050413.1|CNS09B29 Single read from an extremity of a full-... 42 1.7
475emb|BX050412.1|CNS09B28 Single read from an extremity of a full-... 42 1.7
476emb|BX050291.1|CNS09AYV Single read from an extremity of a full-... 42 1.7
477emb|BX049857.1|CNS09AMT Single read from an extremity of a full-... 42 1.7
478emb|BX049856.1|CNS09AMS Single read from an extremity of a full-... 42 1.7
479emb|BX049758.1|CNS09AK2 Single read from an extremity of a full-... 42 1.7
480emb|BX049729.1|CNS09AJ9 Single read from an extremity of a full-... 42 1.7
481emb|BX049728.1|CNS09AJ8 Single read from an extremity of a full-... 42 1.7
482emb|BX049675.1|CNS09AHR Single read from an extremity of a full-... 42 1.7
483emb|BX031000.1|CNS08W30 Single read from an extremity of a full-... 42 1.7
484emb|BX030942.1|CNS08W1E Single read from an extremity of a full-... 42 1.7
485emb|BX030941.1|CNS08W1D Single read from an extremity of a full-... 42 1.7
486emb|BX030930.1|CNS08W12 Single read from an extremity of a full-... 42 1.7
487emb|BX030929.1|CNS08W11 Single read from an extremity of a full-... 42 1.7
488emb|BX030904.1|CNS08W0C Single read from an extremity of a full-... 42 1.7
489emb|BX030903.1|CNS08W0B Single read from an extremity of a full-... 42 1.7
490emb|BX049525.1|CNS09ADL Single read from an extremity of a full-... 42 1.7
491emb|BX049241.1|CNS09A5P Single read from an extremity of a full-... 42 1.7
492emb|BX049188.1|CNS09A48 Single read from an extremity of a full-... 42 1.7
493emb|BX049187.1|CNS09A47 Single read from an extremity of a full-... 42 1.7
494emb|BX048751.1|CNS099S3 Single read from an extremity of a full-... 42 1.7
495emb|BX048434.1|CNS099JA Single read from an extremity of a full-... 42 1.7
496emb|BX048433.1|CNS099J9 Single read from an extremity of a full-... 42 1.7
497emb|BX048235.1|CNS099DR Single read from an extremity of a full-... 42 1.7
498emb|BX048200.1|CNS099CS Single read from an extremity of a full-... 42 1.7
499emb|BX048199.1|CNS099CR Single read from an extremity of a full-... 42 1.7
500emb|BX048000.1|CNS09978 Single read from an extremity of a full-... 42 1.7

>ref|XM_479931.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1236

 Score =  170 bits (86), Expect = 3e-39
 Identities = 167/194 (86%)
 Strand = Plus / Minus

                                                                       
Query: 295 aacttgctcgggtccttgaggtactccttgatcttatcagcatggtcatacgagtagtct 354
           |||||||| ||||| || |  |||||||||||||||||||||||    |||||||| || 
Sbjct: 962 aacttgctggggtctttcaaatactccttgatcttatcagcatgtgggtacgagtattcg 903

                                                                       
Query: 355 gtctccaaagcgaccgcaagaacattcttgtatgcattgaggaacatgtgcggtgcagca 414
           ||||||| ||| || ||||| |||||||||||  |||||||||||||||| |||||||||
Sbjct: 902 gtctccacagcaacagcaagcacattcttgtacccattgaggaacatgtgtggtgcagca 843

                                                                       
Query: 415 gccatggtggggtatgagatcgccagggacagtgaggcaaccatggaaacaccagaagca 474
           || || || ||||| ||||| |||||||| | |||||||||||| |||||||||||||||
Sbjct: 842 gcaatagttgggtacgagattgccagggagactgaggcaaccatagaaacaccagaagca 783

                         
Query: 475 aacttgtccatcag 488
           ||||| ||||||||
Sbjct: 782 aacttctccatcag 769



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 196  ccatctgattcctcctcgggttcttccttcttctcctcctccttg 240
            ||||| || ||||||||||| |||||||||||||| |||||||||
Sbjct: 1061 ccatcggactcctcctcgggctcttccttcttctcttcctccttg 1017



to top

>dbj|D21130.1|RICYK704 Oryza sativa (japonica cultivar-group) YK704 mRNA for acidic
           ribosomal protein P0, complete cds
          Length = 1220

 Score =  170 bits (86), Expect = 3e-39
 Identities = 167/194 (86%)
 Strand = Plus / Minus

                                                                       
Query: 295 aacttgctcgggtccttgaggtactccttgatcttatcagcatggtcatacgagtagtct 354
           |||||||| ||||| || |  |||||||||||||||||||||||    |||||||| || 
Sbjct: 944 aacttgctggggtctttcaaatactccttgatcttatcagcatgtgggtacgagtattcg 885

                                                                       
Query: 355 gtctccaaagcgaccgcaagaacattcttgtatgcattgaggaacatgtgcggtgcagca 414
           ||||||| ||| || ||||| |||||||||||  |||||||||||||||| |||||||||
Sbjct: 884 gtctccacagcaacagcaagcacattcttgtacccattgaggaacatgtgtggtgcagca 825

                                                                       
Query: 415 gccatggtggggtatgagatcgccagggacagtgaggcaaccatggaaacaccagaagca 474
           || || || ||||| ||||| |||||||| | |||||||||||| |||||||||||||||
Sbjct: 824 gcaatagttgggtacgagattgccagggagactgaggcaaccatagaaacaccagaagca 765

                         
Query: 475 aacttgtccatcag 488
           ||||| ||||||||
Sbjct: 764 aacttctccatcag 751



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 196  ccatctgattcctcctcgggttcttccttcttctcctcctccttg 240
            ||||| || ||||||||||| |||||||||||||| |||||||||
Sbjct: 1043 ccatcggactcctcctcgggctcttccttcttctcttcctccttg 999



to top

>dbj|AK064857.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000H12, full
           insert sequence
          Length = 1236

 Score =  170 bits (86), Expect = 3e-39
 Identities = 167/194 (86%)
 Strand = Plus / Minus

                                                                       
Query: 295 aacttgctcgggtccttgaggtactccttgatcttatcagcatggtcatacgagtagtct 354
           |||||||| ||||| || |  |||||||||||||||||||||||    |||||||| || 
Sbjct: 962 aacttgctggggtctttcaaatactccttgatcttatcagcatgtgggtacgagtattcg 903

                                                                       
Query: 355 gtctccaaagcgaccgcaagaacattcttgtatgcattgaggaacatgtgcggtgcagca 414
           ||||||| ||| || ||||| |||||||||||  |||||||||||||||| |||||||||
Sbjct: 902 gtctccacagcaacagcaagcacattcttgtacccattgaggaacatgtgtggtgcagca 843

                                                                       
Query: 415 gccatggtggggtatgagatcgccagggacagtgaggcaaccatggaaacaccagaagca 474
           || || || ||||| ||||| |||||||| | |||||||||||| |||||||||||||||
Sbjct: 842 gcaatagttgggtacgagattgccagggagactgaggcaaccatagaaacaccagaagca 783

                         
Query: 475 aacttgtccatcag 488
           ||||| ||||||||
Sbjct: 782 aacttctccatcag 769



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 196  ccatctgattcctcctcgggttcttccttcttctcctcctccttg 240
            ||||| || ||||||||||| |||||||||||||| |||||||||
Sbjct: 1061 ccatcggactcctcctcgggctcttccttcttctcttcctccttg 1017



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score =  168 bits (85), Expect = 1e-38
 Identities = 151/173 (87%)
 Strand = Plus / Plus

                                                                           
Query: 316     tactccttgatcttatcagcatggtcatacgagtagtctgtctccaaagcgaccgcaaga 375
               |||||||||||||||||||||||    |||||||| || ||||||| ||| || ||||| 
Sbjct: 1714802 tactccttgatcttatcagcatgtgggtacgagtattcggtctccacagcaacagcaagc 1714861

                                                                           
Query: 376     acattcttgtatgcattgaggaacatgtgcggtgcagcagccatggtggggtatgagatc 435
               |||||||||||  |||||||||||||||| ||||||||||| || || ||||| ||||| 
Sbjct: 1714862 acattcttgtacccattgaggaacatgtgtggtgcagcagcaatagttgggtacgagatt 1714921

                                                                    
Query: 436     gccagggacagtgaggcaaccatggaaacaccagaagcaaacttgtccatcag 488
               |||||||| | |||||||||||| |||||||||||||||||||| ||||||||
Sbjct: 1714922 gccagggagactgaggcaaccatagaaacaccagaagcaaacttctccatcag 1714974



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                            
Query: 196     ccatctgattcctcctcgggttcttccttcttctcctcctccttg 240
               ||||| || ||||||||||| |||||||||||||| |||||||||
Sbjct: 1714252 ccatcggactcctcctcgggctcttccttcttctcttcctccttg 1714296



to top

>dbj|AP004591.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0582D05
          Length = 150483

 Score =  168 bits (85), Expect = 1e-38
 Identities = 151/173 (87%)
 Strand = Plus / Plus

                                                                          
Query: 316    tactccttgatcttatcagcatggtcatacgagtagtctgtctccaaagcgaccgcaaga 375
              |||||||||||||||||||||||    |||||||| || ||||||| ||| || ||||| 
Sbjct: 114302 tactccttgatcttatcagcatgtgggtacgagtattcggtctccacagcaacagcaagc 114361

                                                                          
Query: 376    acattcttgtatgcattgaggaacatgtgcggtgcagcagccatggtggggtatgagatc 435
              |||||||||||  |||||||||||||||| ||||||||||| || || ||||| ||||| 
Sbjct: 114362 acattcttgtacccattgaggaacatgtgtggtgcagcagcaatagttgggtacgagatt 114421

                                                                   
Query: 436    gccagggacagtgaggcaaccatggaaacaccagaagcaaacttgtccatcag 488
              |||||||| | |||||||||||| |||||||||||||||||||| ||||||||
Sbjct: 114422 gccagggagactgaggcaaccatagaaacaccagaagcaaacttctccatcag 114474



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                           
Query: 196    ccatctgattcctcctcgggttcttccttcttctcctcctccttg 240
              ||||| || ||||||||||| |||||||||||||| |||||||||
Sbjct: 113752 ccatcggactcctcctcgggctcttccttcttctcttcctccttg 113796



to top

>emb|Y07959.1|ZMRPP0 Z.mays mRNA for acidic ribosomal protein P0
          Length = 1253

 Score =  163 bits (82), Expect = 7e-37
 Identities = 166/194 (85%)
 Strand = Plus / Minus

                                                                       
Query: 295 aacttgctcgggtccttgaggtactccttgatcttatcagcatggtcatacgagtagtct 354
           |||||||| |||||||||||||||||||||||||| ||||||||    ||||||||||||
Sbjct: 965 aacttgcttgggtccttgaggtactccttgatcttgtcagcatgtgggtacgagtagtct 906

                                                                       
Query: 355 gtctccaaagcgaccgcaagaacattcttgtatgcattgaggaacatgtgcggtgcagca 414
           ||||| | ||| || ||||| |||||||||||  |||||| ||||||||| ||  |||||
Sbjct: 905 gtctcgacagcaacagcaagcacattcttgtacccattgatgaacatgtggggcacagca 846

                                                                       
Query: 415 gccatggtggggtatgagatcgccagggacagtgaggcaaccatggaaacaccagaagca 474
           || | ||| ||||| ||||||||||| ||||| |||||||||||||| |||||||  |||
Sbjct: 845 gcaagggtcgggtacgagatcgccagtgacagggaggcaaccatggagacaccagtggca 786

                         
Query: 475 aacttgtccatcag 488
           ||||| || |||||
Sbjct: 785 aacttctcaatcag 772



to top

>gb|AC123528.2| Oryza sativa chromosome 11 clone  OSJNBa0078E03, complete sequence
          Length = 149493

 Score =  161 bits (81), Expect = 3e-36
 Identities = 150/173 (86%)
 Strand = Plus / Plus

                                                                        
Query: 316  tactccttgatcttatcagcatggtcatacgagtagtctgtctccaaagcgaccgcaaga 375
            |||||||||||||||||||||||    || ||||| || ||||||| ||| || ||||| 
Sbjct: 4180 tactccttgatcttatcagcatgtgggtatgagtattcggtctccacagcaacagcaagc 4239

                                                                        
Query: 376  acattcttgtatgcattgaggaacatgtgcggtgcagcagccatggtggggtatgagatc 435
            |||||||||||  |||||||||||||||| || |||||||| || || ||||||||||| 
Sbjct: 4240 acattcttgtacccattgaggaacatgtgtggcgcagcagcaatagttgggtatgagatt 4299

                                                                 
Query: 436  gccagggacagtgaggcaaccatggaaacaccagaagcaaacttgtccatcag 488
            |||||||||| |||||||||||| ||||||||||| |||||||| ||||||||
Sbjct: 4300 gccagggacactgaggcaaccatcgaaacaccagatgcaaacttctccatcag 4352



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                
Query: 205  tcctcctcgggttcttccttcttctcctcctccttg 240
            ||||||||||| |||||||||||||| |||||||||
Sbjct: 3673 tcctcctcgggctcttccttcttctcttcctccttg 3708



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  161 bits (81), Expect = 3e-36
 Identities = 150/173 (86%)
 Strand = Plus / Plus

                                                                           
Query: 316     tactccttgatcttatcagcatggtcatacgagtagtctgtctccaaagcgaccgcaaga 375
               |||||||||||||||||||||||    || ||||| || ||||||| ||| || ||||| 
Sbjct: 1648466 tactccttgatcttatcagcatgtgggtatgagtattcggtctccacagcaacagcaagc 1648525

                                                                           
Query: 376     acattcttgtatgcattgaggaacatgtgcggtgcagcagccatggtggggtatgagatc 435
               |||||||||||  |||||||||||||||| || |||||||| || || ||||||||||| 
Sbjct: 1648526 acattcttgtacccattgaggaacatgtgtggcgcagcagcaatagttgggtatgagatt 1648585

                                                                    
Query: 436     gccagggacagtgaggcaaccatggaaacaccagaagcaaacttgtccatcag 488
               |||||||||| |||||||||||| ||||||||||| |||||||| ||||||||
Sbjct: 1648586 gccagggacactgaggcaaccatcgaaacaccagatgcaaacttctccatcag 1648638



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                   
Query: 205     tcctcctcgggttcttccttcttctcctcctccttg 240
               ||||||||||| |||||||||||||| |||||||||
Sbjct: 1647959 tcctcctcgggctcttccttcttctcttcctccttg 1647994



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 306      gtccttgaggtactccttga 325
                ||||||||||||||||||||
Sbjct: 26815212 gtccttgaggtactccttga 26815193



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  161 bits (81), Expect = 3e-36
 Identities = 150/173 (86%)
 Strand = Plus / Plus

                                                                           
Query: 316     tactccttgatcttatcagcatggtcatacgagtagtctgtctccaaagcgaccgcaaga 375
               |||||||||||||||||||||||    || ||||| || ||||||| ||| || ||||| 
Sbjct: 1646187 tactccttgatcttatcagcatgtgggtatgagtattcggtctccacagcaacagcaagc 1646246

                                                                           
Query: 376     acattcttgtatgcattgaggaacatgtgcggtgcagcagccatggtggggtatgagatc 435
               |||||||||||  |||||||||||||||| || |||||||| || || ||||||||||| 
Sbjct: 1646247 acattcttgtacccattgaggaacatgtgtggcgcagcagcaatagttgggtatgagatt 1646306

                                                                    
Query: 436     gccagggacagtgaggcaaccatggaaacaccagaagcaaacttgtccatcag 488
               |||||||||| |||||||||||| ||||||||||| |||||||| ||||||||
Sbjct: 1646307 gccagggacactgaggcaaccatcgaaacaccagatgcaaacttctccatcag 1646359



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                   
Query: 205     tcctcctcgggttcttccttcttctcctcctccttg 240
               ||||||||||| |||||||||||||| |||||||||
Sbjct: 1645680 tcctcctcgggctcttccttcttctcttcctccttg 1645715



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 306      gtccttgaggtactccttga 325
                ||||||||||||||||||||
Sbjct: 27142444 gtccttgaggtactccttga 27142425



to top

>gb|BT016531.1| Zea mays clone Contig364 mRNA sequence
          Length = 1230

 Score =  155 bits (78), Expect = 2e-34
 Identities = 165/194 (85%)
 Strand = Plus / Minus

                                                                       
Query: 295 aacttgctcgggtccttgaggtactccttgatcttatcagcatggtcatacgagtagtct 354
           |||||||| |||||||||||||||||||||||||| ||||||||    || |||||||||
Sbjct: 946 aacttgcttgggtccttgaggtactccttgatcttgtcagcatgtgggtatgagtagtct 887

                                                                       
Query: 355 gtctccaaagcgaccgcaagaacattcttgtatgcattgaggaacatgtgcggtgcagca 414
           ||||| | ||| || ||||| |||||||||||  |||||| ||||||||| ||  |||||
Sbjct: 886 gtctcgacagcaacagcaagcacattcttgtacccattgatgaacatgtggggcacagca 827

                                                                       
Query: 415 gccatggtggggtatgagatcgccagggacagtgaggcaaccatggaaacaccagaagca 474
           || | ||| ||||| ||||||||||| ||||| |||||||||||||| |||||||  |||
Sbjct: 826 gcaagggtcgggtacgagatcgccagtgacagggaggcaaccatggagacaccagtggca 767

                         
Query: 475 aacttgtccatcag 488
           ||||| || |||||
Sbjct: 766 aacttctcaatcag 753



to top

>ref|XM_479932.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 451

 Score =  141 bits (71), Expect = 2e-30
 Identities = 149/175 (85%)
 Strand = Plus / Minus

                                                                       
Query: 295 aacttgctcgggtccttgaggtactccttgatcttatcagcatggtcatacgagtagtct 354
           |||||||| ||||| || |  |||||||||||||||||||||||    |||||||| || 
Sbjct: 175 aacttgctggggtctttcaaatactccttgatcttatcagcatgtgggtacgagtattcg 116

                                                                       
Query: 355 gtctccaaagcgaccgcaagaacattcttgtatgcattgaggaacatgtgcggtgcagca 414
           ||||||| ||| || ||||| |||||||||||  |||||||||||||||| |||||||||
Sbjct: 115 gtctccacagcaacagcaagcacattcttgtacccattgaggaacatgtgtggtgcagca 56

                                                                  
Query: 415 gccatggtggggtatgagatcgccagggacagtgaggcaaccatggaaacaccag 469
           || || || ||||| ||||| |||||||| | |||||||||||| ||||||||||
Sbjct: 55  gcaatagttgggtacgagattgccagggagactgaggcaaccatagaaacaccag 1



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 196 ccatctgattcctcctcgggttcttccttcttctcctcctccttg 240
           ||||| || ||||||||||| |||||||||||||| |||||||||
Sbjct: 274 ccatcggactcctcctcgggctcttccttcttctcttcctccttg 230



to top

>dbj|AK062008.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-043-E02, full
           insert sequence
          Length = 451

 Score =  141 bits (71), Expect = 2e-30
 Identities = 149/175 (85%)
 Strand = Plus / Minus

                                                                       
Query: 295 aacttgctcgggtccttgaggtactccttgatcttatcagcatggtcatacgagtagtct 354
           |||||||| ||||| || |  |||||||||||||||||||||||    |||||||| || 
Sbjct: 175 aacttgctggggtctttcaaatactccttgatcttatcagcatgtgggtacgagtattcg 116

                                                                       
Query: 355 gtctccaaagcgaccgcaagaacattcttgtatgcattgaggaacatgtgcggtgcagca 414
           ||||||| ||| || ||||| |||||||||||  |||||||||||||||| |||||||||
Sbjct: 115 gtctccacagcaacagcaagcacattcttgtacccattgaggaacatgtgtggtgcagca 56

                                                                  
Query: 415 gccatggtggggtatgagatcgccagggacagtgaggcaaccatggaaacaccag 469
           || || || ||||| ||||| |||||||| | |||||||||||| ||||||||||
Sbjct: 55  gcaatagttgggtacgagattgccagggagactgaggcaaccatagaaacaccag 1



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 196 ccatctgattcctcctcgggttcttccttcttctcctcctccttg 240
           ||||| || ||||||||||| |||||||||||||| |||||||||
Sbjct: 274 ccatcggactcctcctcgggctcttccttcttctcttcctccttg 230



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score =  137 bits (69), Expect = 4e-29
 Identities = 147/173 (84%)
 Strand = Plus / Plus

                                                                           
Query: 316     tactccttgatcttatcagcatggtcatacgagtagtctgtctccaaagcgaccgcaaga 375
               |||||||||||||| ||||||||    || ||||| || ||||||| ||| || || || 
Sbjct: 1601677 tactccttgatcttgtcagcatgtgggtatgagtattcggtctccacagcaacagcgagc 1601736

                                                                           
Query: 376     acattcttgtatgcattgaggaacatgtgcggtgcagcagccatggtggggtatgagatc 435
               |||||||||||  |||||||||||||||| || ||||| || || || ||||||||||| 
Sbjct: 1601737 acattcttgtacccattgaggaacatgtgtggcgcagctgcgatagttgggtatgagatt 1601796

                                                                    
Query: 436     gccagggacagtgaggcaaccatggaaacaccagaagcaaacttgtccatcag 488
               |||||||||| |||||||||||| ||||||||||| |||||||| ||||||||
Sbjct: 1601797 gccagggacactgaggcaaccatcgaaacaccagatgcaaacttctccatcag 1601849



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                      
Query: 202     gattcctcctcgggttcttccttcttctcctcctccttg 240
               ||||| |||||||| |||||||||||||| |||||||||
Sbjct: 1601163 gattcttcctcgggctcttccttcttctcttcctccttg 1601201



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 218      cttccttcttctcctcctcct 238
                |||||||||||||||||||||
Sbjct: 27302625 cttccttcttctcctcctcct 27302645



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 220      tccttcttctcctcctcctt 239
                ||||||||||||||||||||
Sbjct: 24833327 tccttcttctcctcctcctt 24833308



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  137 bits (69), Expect = 4e-29
 Identities = 147/173 (84%)
 Strand = Plus / Plus

                                                                           
Query: 316     tactccttgatcttatcagcatggtcatacgagtagtctgtctccaaagcgaccgcaaga 375
               |||||||||||||| ||||||||    || ||||| || ||||||| ||| || || || 
Sbjct: 1601677 tactccttgatcttgtcagcatgtgggtatgagtattcggtctccacagcaacagcgagc 1601736

                                                                           
Query: 376     acattcttgtatgcattgaggaacatgtgcggtgcagcagccatggtggggtatgagatc 435
               |||||||||||  |||||||||||||||| || ||||| || || || ||||||||||| 
Sbjct: 1601737 acattcttgtacccattgaggaacatgtgtggcgcagctgcgatagttgggtatgagatt 1601796

                                                                    
Query: 436     gccagggacagtgaggcaaccatggaaacaccagaagcaaacttgtccatcag 488
               |||||||||| |||||||||||| ||||||||||| |||||||| ||||||||
Sbjct: 1601797 gccagggacactgaggcaaccatcgaaacaccagatgcaaacttctccatcag 1601849



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                      
Query: 202     gattcctcctcgggttcttccttcttctcctcctccttg 240
               ||||| |||||||| |||||||||||||| |||||||||
Sbjct: 1601163 gattcttcctcgggctcttccttcttctcttcctccttg 1601201



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 218      cttccttcttctcctcctcct 238
                |||||||||||||||||||||
Sbjct: 27228225 cttccttcttctcctcctcct 27228245



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 220      tccttcttctcctcctcctt 239
                ||||||||||||||||||||
Sbjct: 24761533 tccttcttctcctcctcctt 24761514



to top

>emb|BX000508.1|CNS08CDY Oryza sativa chromosome 12, . BAC OJ1575_G05 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 91883

 Score =  137 bits (69), Expect = 4e-29
 Identities = 147/173 (84%)
 Strand = Plus / Minus

                                                                         
Query: 316   tactccttgatcttatcagcatggtcatacgagtagtctgtctccaaagcgaccgcaaga 375
             |||||||||||||| ||||||||    || ||||| || ||||||| ||| || || || 
Sbjct: 91245 tactccttgatcttgtcagcatgtgggtatgagtattcggtctccacagcaacagcgagc 91186

                                                                         
Query: 376   acattcttgtatgcattgaggaacatgtgcggtgcagcagccatggtggggtatgagatc 435
             |||||||||||  |||||||||||||||| || ||||| || || || ||||||||||| 
Sbjct: 91185 acattcttgtacccattgaggaacatgtgtggcgcagctgcgatagttgggtatgagatt 91126

                                                                  
Query: 436   gccagggacagtgaggcaaccatggaaacaccagaagcaaacttgtccatcag 488
             |||||||||| |||||||||||| ||||||||||| |||||||| ||||||||
Sbjct: 91125 gccagggacactgaggcaaccatcgaaacaccagatgcaaacttctccatcag 91073



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                    
Query: 202   gattcctcctcgggttcttccttcttctcctcctccttg 240
             ||||| |||||||| |||||||||||||| |||||||||
Sbjct: 91759 gattcttcctcgggctcttccttcttctcttcctccttg 91721



to top

>emb|BX000498.1|CNS08CDO Oryza sativa chromosome 12, . BAC OSJNBa0009F13 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 183385

 Score =  137 bits (69), Expect = 4e-29
 Identities = 147/173 (84%)
 Strand = Plus / Minus

                                                                         
Query: 316   tactccttgatcttatcagcatggtcatacgagtagtctgtctccaaagcgaccgcaaga 375
             |||||||||||||| ||||||||    || ||||| || ||||||| ||| || || || 
Sbjct: 24055 tactccttgatcttgtcagcatgtgggtatgagtattcggtctccacagcaacagcgagc 23996

                                                                         
Query: 376   acattcttgtatgcattgaggaacatgtgcggtgcagcagccatggtggggtatgagatc 435
             |||||||||||  |||||||||||||||| || ||||| || || || ||||||||||| 
Sbjct: 23995 acattcttgtacccattgaggaacatgtgtggcgcagctgcgatagttgggtatgagatt 23936

                                                                  
Query: 436   gccagggacagtgaggcaaccatggaaacaccagaagcaaacttgtccatcag 488
             |||||||||| |||||||||||| ||||||||||| |||||||| ||||||||
Sbjct: 23935 gccagggacactgaggcaaccatcgaaacaccagatgcaaacttctccatcag 23883



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                    
Query: 202   gattcctcctcgggttcttccttcttctcctcctccttg 240
             ||||| |||||||| |||||||||||||| |||||||||
Sbjct: 24569 gattcttcctcgggctcttccttcttctcttcctccttg 24531



to top

>gb|BT018921.1| Zea mays clone Contig30.F mRNA sequence
          Length = 820

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 143/175 (81%)
 Strand = Plus / Minus

                                                                       
Query: 295 aacttgctcgggtccttgaggtactccttgatcttatcagcatggtcatacgagtagtct 354
           ||||||||||||||||||||||||||||||||||| || || ||    ||||||||||| 
Sbjct: 466 aacttgctcgggtccttgaggtactccttgatcttgtcggcgtgtgggtacgagtagtcc 407

                                                                       
Query: 355 gtctccaaagcgaccgcaagaacattcttgtatgcattgaggaacatgtgcggtgcagca 414
           ||||||| ||| || ||||| || ||||||||  ||||||  |||||||| ||  |||||
Sbjct: 406 gtctccacagcaacagcaagcacgttcttgtacccattgataaacatgtggggcacagca 347

                                                                  
Query: 415 gccatggtggggtatgagatcgccagggacagtgaggcaaccatggaaacaccag 469
           || | ||| ||||| || |  |||||||| || || || |||||||| |||||||
Sbjct: 346 gcaagggtcgggtacgataatgccagggaaagagaagcgaccatggagacaccag 292



to top

>dbj|AB236824.1| Trifolium pratense RNA for putative 60S acidic ribosomal protein
           P0, complete cds, clone: C2319
          Length = 1345

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 81/97 (83%)
 Strand = Plus / Minus

                                                                       
Query: 372 aagaacattcttgtatgcattgaggaacatgtgcggtgcagcagccatggtggggtatga 431
           ||||||||||||||| ||||||| ||||||||| |||||||| || |  || ||||| ||
Sbjct: 912 aagaacattcttgtaggcattgacgaacatgtgaggtgcagctgcaagtgttgggtaaga 853

                                                
Query: 432 gatcgccagggacagtgaggcaaccatggaaacacca 468
           ||| ||||  || ||||| | |||||| |||||||||
Sbjct: 852 gatggccaacgaaagtgaagtaaccattgaaacacca 816



to top

>emb|X15206.1|CRCRE2 C.rubrum mRNA for light-induced 34kD protein
          Length = 1332

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                        
Query: 164  cttagtcgtcaaacagactgaatcccatctcgccatctgattcctcctcgggttcttcct 223
            |||| |||||||| |||||||| || || ||  |||||||||| ||||| ||||||||||
Sbjct: 1206 cttaatcgtcaaagagactgaaaccgatgtcatcatctgattcttcctcaggttcttcct 1147

                       
Query: 224  tcttctcctcc 234
            |||| ||||||
Sbjct: 1146 tcttttcctcc 1136



to top

>gb|L46848.1|SOYARPP Glycine max acidic ribosomal protein P0 mRNA, complete cds
          Length = 1247

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 90/110 (81%)
 Strand = Plus / Minus

                                                                       
Query: 370 gcaagaacattcttgtatgcattgaggaacatgtgcggtgcagcagccatggtggggtat 429
           ||||||||||||||||| |||||||  |||||||| ||||| ||||| |  || || |||
Sbjct: 885 gcaagaacattcttgtaggcattgacaaacatgtgtggtgctgcagcaagtgttggatat 826

                                                             
Query: 430 gagatcgccagggacagtgaggcaaccatggaaacaccagaagcaaactt 479
           || || ||||  || ||||| | |||||| || ||||||| |||||||||
Sbjct: 825 gaaatagccaatgaaagtgaagtaaccattgagacaccagcagcaaactt 776



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 214  ggttcttccttcttctcctcctccttg 240
            |||||||||||||| ||||||||||||
Sbjct: 1044 ggttcttccttcttttcctcctccttg 1018



to top

>ref|NM_129559.2| Arabidopsis thaliana structural constituent of ribosome AT2G40010
           mRNA, complete cds
          Length = 1153

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 370 gcaagaacattcttgtatgcattgaggaacatgtgcggtgcagcagccatggtggggtat 429
           |||||||| |||||||| ||||||||||||||||| || ||||| || | ||| ||||| 
Sbjct: 758 gcaagaacgttcttgtaagcattgaggaacatgtgaggcgcagctgctacggttgggtaa 699

                
Query: 430 gagat 434
           |||||
Sbjct: 698 gagat 694



to top

>gb|AY070448.1| Arabidopsis thaliana At2g40010 mRNA sequence
          Length = 1373

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 370 gcaagaacattcttgtatgcattgaggaacatgtgcggtgcagcagccatggtggggtat 429
           |||||||| |||||||| ||||||||||||||||| || ||||| || | ||| ||||| 
Sbjct: 962 gcaagaacgttcttgtaagcattgaggaacatgtgaggcgcagctgctacggttgggtaa 903

                
Query: 430 gagat 434
           |||||
Sbjct: 902 gagat 898



to top

>dbj|AB236811.1| Trifolium pratense RNA for putative 60S acidic ribosomal protein
           P0, complete cds, clone: C212
          Length = 1326

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 80/97 (82%)
 Strand = Plus / Minus

                                                                       
Query: 372 aagaacattcttgtatgcattgaggaacatgtgcggtgcagcagccatggtggggtatga 431
           ||||||||||||||| ||||| | ||||||||| |||||||| || |  || ||||| ||
Sbjct: 919 aagaacattcttgtaggcattcacgaacatgtgaggtgcagctgcaagtgttgggtaaga 860

                                                
Query: 432 gatcgccagggacagtgaggcaaccatggaaacacca 468
           ||| ||||  || ||||| | |||||| |||||||||
Sbjct: 859 gatggccaacgaaagtgaagtaaccattgaaacacca 823



to top

>gb|AF002109.3| Arabidopsis thaliana chromosome 2 clone T28M21 map CIC10A06, complete
             sequence
          Length = 108847

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                         
Query: 370   gcaagaacattcttgtatgcattgaggaacatgtgcggtgcagcagccatggtggggtat 429
             |||||||| |||||||| ||||||||||||||||| || ||||| || | ||| ||||| 
Sbjct: 77517 gcaagaacgttcttgtaagcattgaggaacatgtgaggcgcagctgctacggttgggtaa 77576

                  
Query: 430   gagat 434
             |||||
Sbjct: 77577 gagat 77581



to top

>emb|BX816288.1|CNS0AE9F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH39ZH02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1296

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 370 gcaagaacattcttgtatgcattgaggaacatgtgcggtgcagcagccatggtggggtat 429
           |||||||| |||||||| ||||||||||||||||| || ||||| || | ||| ||||| 
Sbjct: 716 gcaagaacgttcttgtaagcattgaggaacatgtgaggcgcagctgctacggttgggtaa 775

                
Query: 430 gagat 434
           |||||
Sbjct: 776 gagat 780



to top

>gb|BT001919.1| Arabidopsis thaliana clone C105444 putative 60S acidic ribosomal
           protein P0 (At2g40010) mRNA, complete cds
          Length = 985

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 370 gcaagaacattcttgtatgcattgaggaacatgtgcggtgcagcagccatggtggggtat 429
           |||||||| |||||||| ||||||||||||||||| || ||||| || | ||| ||||| 
Sbjct: 758 gcaagaacgttcttgtaagcattgaggaacatgtgaggcgcagctgctacggttgggtaa 699

                
Query: 430 gagat 434
           |||||
Sbjct: 698 gagat 694



to top

>ref|NM_111754.2| Arabidopsis thaliana structural constituent of ribosome AT3G09200
           mRNA, complete cds
          Length = 1307

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 377 cattcttgtatgcattgaggaacatgtgcggtgcagcagc 416
           |||||||||| ||||||| |||||| ||||||||||||||
Sbjct: 818 cattcttgtacgcattgatgaacatatgcggtgcagcagc 779



to top

>gb|AC011436.7|ATAC011436 Arabidopsis thaliana chromosome III BAC F3L24 genomic sequence,
             complete sequence
          Length = 106688

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                     
Query: 377   cattcttgtatgcattgaggaacatgtgcggtgcagcagc 416
             |||||||||| ||||||| |||||| ||||||||||||||
Sbjct: 20252 cattcttgtacgcattgatgaacatatgcggtgcagcagc 20291



to top

>gb|AC009326.8|ATAC009326 Arabidopsis thaliana chromosome III P1 MZB10 genomic sequence, complete
             sequence
          Length = 85561

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                     
Query: 377   cattcttgtatgcattgaggaacatgtgcggtgcagcagc 416
             |||||||||| ||||||| |||||| ||||||||||||||
Sbjct: 84575 cattcttgtacgcattgatgaacatatgcggtgcagcagc 84614



to top

>gb|AY059117.1| Arabidopsis thaliana putative 60S acidic ribosomal protein P0
           (At3g09200) mRNA, complete cds
          Length = 994

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 377 cattcttgtatgcattgaggaacatgtgcggtgcagcagc 416
           |||||||||| ||||||| |||||| ||||||||||||||
Sbjct: 748 cattcttgtacgcattgatgaacatatgcggtgcagcagc 709



to top

>gb|AF370225.1| Arabidopsis thaliana putative 60S acidic ribosomal protein P0
           (At3g09200) mRNA, complete cds
          Length = 1160

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 377 cattcttgtatgcattgaggaacatgtgcggtgcagcagc 416
           |||||||||| ||||||| |||||| ||||||||||||||
Sbjct: 818 cattcttgtacgcattgatgaacatatgcggtgcagcagc 779



to top

>emb|BX824039.1|CNS0A6RI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH17ZF06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1185

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 377 cattcttgtatgcattgaggaacatgtgcggtgcagcagc 416
           |||||||||| ||||||| |||||| ||||||||||||||
Sbjct: 802 cattcttgtacgcattgatgaacatatgcggtgcagcagc 763



to top

>emb|BX823923.1|CNS0A6KD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS92ZG11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1136

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 377 cattcttgtatgcattgaggaacatgtgcggtgcagcagc 416
           |||||||||| ||||||| |||||| ||||||||||||||
Sbjct: 785 cattcttgtacgcattgatgaacatatgcggtgcagcagc 746



to top

>gb|AY086582.1| Arabidopsis thaliana clone 2595 mRNA, complete sequence
          Length = 1199

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 377 cattcttgtatgcattgaggaacatgtgcggtgcagcagc 416
           |||||||||| ||||||| |||||| ||||||||||||||
Sbjct: 816 cattcttgtacgcattgatgaacatatgcggtgcagcagc 777



to top

>gb|BT016538.1| Zea mays clone Contig371 mRNA sequence
          Length = 707

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 175 aacagactgaatcccatctcgccatctgattcctcctcgggttcttccttcttctcctc 233
           ||||| ||||| ||||| ||| |||| || ||||||| ||| |||||||||||||||||
Sbjct: 414 aacaggctgaagcccatgtcgtcatcagactcctccttgggctcttccttcttctcctc 356



to top

>gb|DQ235177.1| Solanum tuberosum clone 157H11 acidic ribosomal protein P1a-like
           mRNA, complete cds
          Length = 567

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 172 tcaaacagactgaatcccatctcgccatctgattcctcctcgggttcttccttcttctcc 231
           |||||||||||||||||||| ||| ||||   ||| |||| ||| ||||||||||| |||
Sbjct: 393 tcaaacagactgaatcccatatcgtcatcactttcttccttgggctcttccttcttttcc 334

             
Query: 232 tc 233
           ||
Sbjct: 333 tc 332



to top

>gb|AC010009.7| Drosophila melanogaster 3L BAC RP98-23D16 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 195757

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                   
Query: 290    cggcnaacttgctcgggtccttgaggtactccttgat 326
              |||| |||||||| |||||||||| ||||||||||||
Sbjct: 186062 cggcgaacttgctggggtccttgatgtactccttgat 186098



to top

>gb|AC010011.5| Drosophila melanogaster 3L BAC RP98-17D14 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 167026

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                   
Query: 290    cggcnaacttgctcgggtccttgaggtactccttgat 326
              |||| |||||||| |||||||||| ||||||||||||
Sbjct: 140120 cggcgaacttgctggggtccttgatgtactccttgat 140084



to top

>ref|NM_079487.2| Drosophila melanogaster Ribosomal protein LP0 CG7490-RA (RpLP0),
           mRNA
          Length = 1262

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 290 cggcnaacttgctcgggtccttgaggtactccttgat 326
           |||| |||||||| |||||||||| ||||||||||||
Sbjct: 964 cggcgaacttgctggggtccttgatgtactccttgat 928



to top

>gb|AY075528.1| Drosophila melanogaster RE74511 full length cDNA
          Length = 1277

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 290 cggcnaacttgctcgggtccttgaggtactccttgat 326
           |||| |||||||| |||||||||| ||||||||||||
Sbjct: 964 cggcgaacttgctggggtccttgatgtactccttgat 928



to top

>emb|BX819391.1|CNS0A9W8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB74ZC11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 961

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 370 gcaagaacattcttgtatgcattgaggaacatgt 403
           |||||||| |||||||| ||||||||||||||||
Sbjct: 614 gcaagaacgttcttgtaagcattgaggaacatgt 581



to top

>gb|BT021447.1| Drosophila melanogaster GH01513 full insert cDNA
          Length = 1674

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 290  cggcnaacttgctcgggtccttgaggtactccttgat 326
            |||| |||||||| |||||||||| ||||||||||||
Sbjct: 1350 cggcgaacttgctggggtccttgatgtactccttgat 1314



to top

>gb|AE003596.5| Drosophila melanogaster chromosome 3L, section 77 of 83 of the complete
              sequence
          Length = 249021

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                   
Query: 290    cggcnaacttgctcgggtccttgaggtactccttgat 326
              |||| |||||||| |||||||||| ||||||||||||
Sbjct: 202487 cggcgaacttgctggggtccttgatgtactccttgat 202451



to top

>gb|M25772.1|DROAP3A Drosophila melanogaster DNA repair protein (AP3) mRNA, complete cds
          Length = 1193

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 290 cggcnaacttgctcgggtccttgaggtactccttgat 326
           |||| |||||||| |||||||||| ||||||||||||
Sbjct: 896 cggcgaacttgctggggtccttgatgtactccttgat 860



to top

>ref|NM_111960.2| Arabidopsis thaliana structural constituent of ribosome AT3G11250
           mRNA, complete cds
          Length = 1239

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 377 cattcttgtatgcattgaggaacatgtgcggtgcagc 413
           |||||||||| ||||||| |||||| |||||||||||
Sbjct: 841 cattcttgtaggcattgatgaacatatgcggtgcagc 805



to top

>emb|BX071599.1|CNS09RER Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 322

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||||||||||| | |||||||||
Sbjct: 96  cggcgaacttgctcgggtccttgatgaactccttga 131



to top

>emb|BX052086.1|CNS09CCQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||||||||||| | |||||||||
Sbjct: 398 cggcgaacttgctcgggtccttgatgaactccttga 433



to top

>emb|BX052085.1|CNS09CCP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1013

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||||||||||| | |||||||||
Sbjct: 906 cggcgaacttgctcgggtccttgatgaactccttga 871



to top

>gb|AY091201.1| Arabidopsis thaliana putative 60S acidic ribosomal protein
           (At3g11250) mRNA, complete cds
          Length = 1003

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 377 cattcttgtatgcattgaggaacatgtgcggtgcagc 413
           |||||||||| ||||||| |||||| |||||||||||
Sbjct: 748 cattcttgtaggcattgatgaacatatgcggtgcagc 712



to top

>gb|AY056150.1| Arabidopsis thaliana putative 60S acidic ribosomal protein
           (At3g11250) mRNA, complete cds
          Length = 1174

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 377 cattcttgtatgcattgaggaacatgtgcggtgcagc 413
           |||||||||| ||||||| |||||| |||||||||||
Sbjct: 811 cattcttgtaggcattgatgaacatatgcggtgcagc 775



to top

>gb|AC073395.6|AC073395 Arabidopsis thaliana chromosome 3 BAC F11B9 genomic sequence, complete
             sequence
          Length = 103517

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                  
Query: 377   cattcttgtatgcattgaggaacatgtgcggtgcagc 413
             |||||||||| ||||||| |||||| |||||||||||
Sbjct: 59669 cattcttgtaggcattgatgaacatatgcggtgcagc 59633



to top

>gb|AY087728.1| Arabidopsis thaliana clone 38036 mRNA, complete sequence
          Length = 1185

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 377 cattcttgtatgcattgaggaacatgtgcggtgcagc 413
           |||||||||| ||||||| |||||| |||||||||||
Sbjct: 788 cattcttgtaggcattgatgaacatatgcggtgcagc 752



to top

>gb|AC135667.5| Mus musculus BAC clone RP24-536G18 from chromosome 13, complete
             sequence
          Length = 166185

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 216   ttcttccttcttctcctcctcctt 239
             ||||||||||||||||||||||||
Sbjct: 82831 ttcttccttcttctcctcctcctt 82808



to top

>gb|DQ235176.1| Solanum tuberosum clone 156H10 P0 ribosomal protein-like mRNA,
            complete cds
          Length = 1254

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                        
Query: 172  tcaaacagactgaatcccatctcgccatctgattcctcctcgggttcttccttcttctcc 231
            ||||||| |||||| ||||| ||  |||||||  ||||  | || |||||||||||||||
Sbjct: 1122 tcaaacaaactgaaacccatgtcatcatctgagacctcagcaggctcttccttcttctcc 1063

                    
Query: 232  tcctcctt 239
            ||||||||
Sbjct: 1062 tcctcctt 1055



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 376 acattcttgtatgcattgaggaacatgtgcggtgcagcagc 416
           ||||||||||| || |||  ||||||||| |||||||||||
Sbjct: 915 acattcttgtaggcgttggtgaacatgtgtggtgcagcagc 875



to top

>gb|AC122117.10| Mus musculus chromosome 18, clone RP23-61O22, complete sequence
          Length = 207024

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 216    ttcttccttcttctcctcctcctt 239
              ||||||||||||||||||||||||
Sbjct: 120186 ttcttccttcttctcctcctcctt 120163



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 220    tccttcttctcctcctcctt 239
              ||||||||||||||||||||
Sbjct: 119856 tccttcttctcctcctcctt 119837



to top

>gb|AC164402.3| Mus musculus chromosome 15, clone RP23-463G20, complete sequence
          Length = 196916

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 458   tggaaacaccagaagcaaacttgtccat 485
             |||||||||||||||||| |||||||||
Sbjct: 95996 tggaaacaccagaagcaagcttgtccat 96023



to top

>gb|BC042186.1| Homo sapiens cDNA clone IMAGE:5393404, partial cds
          Length = 814

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 216 ttcttccttcttctcctcctcctt 239
           ||||||||||||||||||||||||
Sbjct: 693 ttcttccttcttctcctcctcctt 670



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 216 ttcttccttcttctcctcctcctt 239
           ||||||||||||||||||||||||
Sbjct: 525 ttcttccttcttctcctcctcctt 502



to top

>emb|Z84486.1|HS528L19 Human DNA sequence from clone RP3-528L19 on chromosome 6q23 Contains
             part of the SGK gene for serum/glucocorticoid regulated
             kinase, complete sequence
          Length = 87013

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 216   ttcttccttcttctcctcctcctt 239
             ||||||||||||||||||||||||
Sbjct: 10013 ttcttccttcttctcctcctcctt 9990



to top

>ref|XM_795562.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC591398 (LOC591398), mRNA
          Length = 2148

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 216 ttcttccttcttctcctcctcctt 239
           ||||||||||||||||||||||||
Sbjct: 753 ttcttccttcttctcctcctcctt 730



to top

>dbj|AK021773.1| Homo sapiens cDNA FLJ11711 fis, clone HEMBA1005152
          Length = 1839

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 216  ttcttccttcttctcctcctcctt 239
            ||||||||||||||||||||||||
Sbjct: 1292 ttcttccttcttctcctcctcctt 1269



to top

>gb|AC069368.14| Homo sapiens chromosome 15, clone CTD-2017F17, complete sequence
          Length = 132080

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 216   ttcttccttcttctcctcctcctt 239
             ||||||||||||||||||||||||
Sbjct: 15516 ttcttccttcttctcctcctcctt 15493



to top

>gb|AC019084.9| Homo sapiens BAC clone RP11-354O2 from 7, complete sequence
          Length = 201215

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 216   ttcttccttcttctcctcctcctt 239
             ||||||||||||||||||||||||
Sbjct: 84922 ttcttccttcttctcctcctcctt 84945



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 216   ttcttccttcttctcctcctcct 238
             |||||||||||||||||||||||
Sbjct: 85172 ttcttccttcttctcctcctcct 85194



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 216   ttcttccttcttctcctcctcct 238
             |||||||||||||||||||||||
Sbjct: 84770 ttcttccttcttctcctcctcct 84792



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 216   ttcttccttcttctcctcctc 236
             |||||||||||||||||||||
Sbjct: 85098 ttcttccttcttctcctcctc 85118



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 216   ttcttccttcttctcctcctc 236
             |||||||||||||||||||||
Sbjct: 85061 ttcttccttcttctcctcctc 85081



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 216   ttcttccttcttctcctcctc 236
             |||||||||||||||||||||
Sbjct: 84637 ttcttccttcttctcctcctc 84657



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 216   ttcttccttcttctcctcctcctt 239
             ||||||||||| ||||||||||||
Sbjct: 85150 ttcttccttctcctcctcctcctt 85173



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 216   ttcttccttcttctcctcctcctt 239
             ||||||||||| ||||||||||||
Sbjct: 84689 ttcttccttctcctcctcctcctt 84712



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   ttccttcttctcctcctcct 238
             ||||||||||||||||||||
Sbjct: 84609 ttccttcttctcctcctcct 84628



to top

>gb|AC153881.4| Mus musculus 10 BAC RP23-257B9 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 208992

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 216   ttcttccttcttctcctcctcctt 239
             ||||||||||||||||||||||||
Sbjct: 90371 ttcttccttcttctcctcctcctt 90348



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 217   tcttccttcttctcctcctcctt 239
             |||||||||||||||||||||||
Sbjct: 91168 tcttccttcttctcctcctcctt 91146



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 217   tcttccttcttctcctcctcctt 239
             |||||||||||||||||||||||
Sbjct: 91119 tcttccttcttctcctcctcctt 91097



to top

>dbj|AB178287.1| Neospora caninum NcRP1 mRNA for ribosomal protein P1, complete cds
          Length = 555

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 204 ttcctcctcgggttcttccttcttctcctcct 235
           ||||||||| || |||||||||||||||||||
Sbjct: 344 ttcctcctcaggctcttccttcttctcctcct 313



to top

>gb|DQ306774.1| Hevea brasiliensis isolate SSH45 mRNA sequence
          Length = 308

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 376 acattcttgtatgcattgaggaacatgtgcggtgcagcagccatggtggggtatga 431
           ||||||||||| ||||| | ||||||||| |||||||| ||||  || ||||||||
Sbjct: 249 acattcttgtaggcattaacgaacatgtgtggtgcagctgccagagttgggtatga 194



to top

>gb|DQ306752.1| Hevea brasiliensis isolate SSH23 mRNA sequence
          Length = 308

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 376 acattcttgtatgcattgaggaacatgtgcggtgcagcagccatggtggggtatga 431
           ||||||||||| ||||| | ||||||||| |||||||| ||||  || ||||||||
Sbjct: 249 acattcttgtaggcattaacgaacatgtgtggtgcagctgccagagttgggtatga 194



to top

>emb|AL928893.10| Mouse DNA sequence from clone RP23-55I14 on chromosome 2, complete
              sequence
          Length = 235241

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 216    ttcttccttcttctcctcctcctt 239
              ||||||||||||||||||||||||
Sbjct: 181544 ttcttccttcttctcctcctcctt 181521



to top

>gb|DQ241840.1| Solanum tuberosum clone 181G12 P0 ribosomal protein-like mRNA,
            complete cds
          Length = 1253

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                        
Query: 172  tcaaacagactgaatcccatctcgccatctgattcctcctcgggttcttccttcttctcc 231
            ||||||| |||||| ||||| ||  |||||||  ||||  | || |||||||||||||||
Sbjct: 1100 tcaaacaaactgaaacccatgtcatcatctgagacctcagcaggctcttccttcttctcc 1041

                    
Query: 232  tcctcctt 239
            ||||||||
Sbjct: 1040 tcctcctt 1033



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 376 acattcttgtatgcattgaggaacatgtgcggtgcagcagc 416
           ||||||||||| || |||  ||||||||| |||||||||||
Sbjct: 893 acattcttgtaggcgttggtgaacatgtgtggtgcagcagc 853



to top

>gb|AC106843.11| Mus musculus chromosome 15, clone RP24-151M4, complete sequence
          Length = 179117

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 458    tggaaacaccagaagcaaacttgtccat 485
              |||||||||||||||||| |||||||||
Sbjct: 142546 tggaaacaccagaagcaagcttgtccat 142519



to top

>gb|AC114644.10| Mus musculus chromosome 1, clone RP24-128L10, complete sequence
          Length = 137391

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 217   tcttccttcttctcctcctcctt 239
             |||||||||||||||||||||||
Sbjct: 11064 tcttccttcttctcctcctcctt 11086



to top

>gb|AC132899.11| Mus musculus chromosome 15, clone RP24-367P22, complete sequence
          Length = 152183

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 216   ttcttccttcttctcctcctcct 238
             |||||||||||||||||||||||
Sbjct: 57446 ttcttccttcttctcctcctcct 57424



to top

>gb|AC118688.10| Mus musculus chromosome 5, clone RP23-302F24, complete sequence
          Length = 176001

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 216    ttcttccttcttctcctcctcct 238
              |||||||||||||||||||||||
Sbjct: 172961 ttcttccttcttctcctcctcct 172939



to top

>ref|XM_467718.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1727

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 302  tcgggtccttgaggtactccttg 324
            |||||||||||||||||||||||
Sbjct: 1150 tcgggtccttgaggtactccttg 1128



to top

>ref|XM_464973.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1080

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 207 ctcctcgggttcttccttcttctcctc 233
           |||||||| ||||||||||||||||||
Sbjct: 643 ctcctcggcttcttccttcttctcctc 617



to top

>gb|AC115846.7| Mus musculus chromosome 1, clone RP24-245O4, complete sequence
          Length = 170731

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 217    tcttccttcttctcctcctcctt 239
              |||||||||||||||||||||||
Sbjct: 142719 tcttccttcttctcctcctcctt 142741



to top

>gb|BT018010.1| Zea mays clone EL01N0528A08.c mRNA sequence
          Length = 654

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 175 aacagactgaatcccatctcgccatctgattcctcctcgggttcttccttcttctcctc 233
           ||||| ||||| ||||| ||| |||| || ||||||| ||  |||||||||||||||||
Sbjct: 383 aacaggctgaagcccatgtcgtcatcagactcctccttggcctcttccttcttctcctc 325



to top

>gb|AC106169.5| Rattus norvegicus x BAC CH230-105D14 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 227592

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 216    ttcttccttcttctcctcctcct 238
              |||||||||||||||||||||||
Sbjct: 169350 ttcttccttcttctcctcctcct 169328



to top

>gb|DQ440047.1| Aedes aegypti clone AE-294 60S acidic ribosomal protein P1 mRNA,
           complete cds
          Length = 339

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 55/65 (84%), Gaps = 3/65 (4%)
 Strand = Plus / Minus

                                                                       
Query: 175 aacagactgaatcccatctcgccatctgattcctcctcgggttcttccttcttctcctcc 234
           ||||||| ||||||||| ||| |||| ||   ||||||||||||||||| ||||| ||| 
Sbjct: 332 aacagaccgaatcccatatcgtcatcgga---ctcctcgggttcttcctccttcttctct 276

                
Query: 235 tcctt 239
           |||||
Sbjct: 275 tcctt 271



to top

>ref|XM_656186.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN3674.2), mRNA
          Length = 1671

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 217  tcttccttcttctcctcctcctt 239
            |||||||||||||||||||||||
Sbjct: 1067 tcttccttcttctcctcctcctt 1045



to top

>gb|AF039040.1| Caenorhabditis elegans cosmid T22B11, complete sequence
          Length = 35564

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 216   ttcttccttcttctcctcctcct 238
             |||||||||||||||||||||||
Sbjct: 10364 ttcttccttcttctcctcctcct 10342



to top

>gb|AC157650.2| Mus musculus BAC clone RP24-573N21 from chromosome 14, complete
             sequence
          Length = 186859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 217   tcttccttcttctcctcctcctt 239
             |||||||||||||||||||||||
Sbjct: 28541 tcttccttcttctcctcctcctt 28563



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 217   tcttccttcttctcctcctcctt 239
             |||||||||||||||||||||||
Sbjct: 28433 tcttccttcttctcctcctcctt 28455



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 217   tcttccttcttctcctcctcctt 239
             |||||||||||||||||||||||
Sbjct: 28013 tcttccttcttctcctcctcctt 28035



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 217   tcttccttcttctcctcctcctt 239
             |||||||||||||||||||||||
Sbjct: 27911 tcttccttcttctcctcctcctt 27933



to top

>gb|AC121604.3| Mus musculus BAC clone RP23-312E2 from chromosome 8, complete sequence
          Length = 209383

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 216   ttcttccttcttctcctcctcct 238
             |||||||||||||||||||||||
Sbjct: 25238 ttcttccttcttctcctcctcct 25260



to top

>gb|AC131785.3| Mus musculus BAC clone RP24-397D13 from chromosome 17, complete
             sequence
          Length = 147557

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 216   ttcttccttcttctcctcctcct 238
             |||||||||||||||||||||||
Sbjct: 86312 ttcttccttcttctcctcctcct 86334



to top

>gb|AC126670.4| Mus musculus BAC clone RP24-469G14 from chromosome 1, complete sequence
          Length = 200595

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 216    ttcttccttcttctcctcctcct 238
              |||||||||||||||||||||||
Sbjct: 150252 ttcttccttcttctcctcctcct 150230



to top

>gb|AC127374.4| Mus musculus BAC clone RP23-46G11 from chromosome 8, complete sequence
          Length = 180143

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 217    tcttccttcttctcctcctcctt 239
              |||||||||||||||||||||||
Sbjct: 138076 tcttccttcttctcctcctcctt 138054



to top

>gb|AC123558.5| Mus musculus BAC clone RP23-336N16 from chromosome 5, complete sequence
          Length = 211763

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 216    ttcttccttcttctcctcctcct 238
              |||||||||||||||||||||||
Sbjct: 167146 ttcttccttcttctcctcctcct 167168



to top

>gb|AC121862.3| Mus musculus BAC clone RP24-110E10 from chromosome 14, complete
             sequence
          Length = 178501

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 217   tcttccttcttctcctcctcctt 239
             |||||||||||||||||||||||
Sbjct: 16331 tcttccttcttctcctcctcctt 16309



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 217   tcttccttcttctcctcctcctt 239
             |||||||||||||||||||||||
Sbjct: 16229 tcttccttcttctcctcctcctt 16207



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 217   tcttccttcttctcctcctcctt 239
             |||||||||||||||||||||||
Sbjct: 16106 tcttccttcttctcctcctcctt 16084



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 217   tcttccttcttctcctcctcctt 239
             |||||||||||||||||||||||
Sbjct: 15686 tcttccttcttctcctcctcctt 15664



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 217   tcttccttcttctcctcctcctt 239
             |||||||||||||||||||||||
Sbjct: 15578 tcttccttcttctcctcctcctt 15556



to top

>gb|AC122246.5| Mus musculus BAC clone RP23-152K13 from 1, complete sequence
          Length = 203739

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 216   ttcttccttcttctcctcctcct 238
             |||||||||||||||||||||||
Sbjct: 16622 ttcttccttcttctcctcctcct 16600



to top

>gb|AC125344.2| Mus musculus BAC clone RP24-332H21 from 12, complete sequence
          Length = 179908

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 216    ttcttccttcttctcctcctcct 238
              |||||||||||||||||||||||
Sbjct: 166658 ttcttccttcttctcctcctcct 166636



to top

>emb|CR637846.2|CNS0ER4S Tetraodon nigroviridis full-length cDNA
          Length = 516

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 217 tcttccttcttctcctcctcctt 239
           |||||||||||||||||||||||
Sbjct: 428 tcttccttcttctcctcctcctt 406



to top

>emb|AL596188.6| Human DNA sequence from clone CTA-31J9 on chromosome 6 Contains the 5'
             part of a novel gene, a novel gene and a CpG island,
             complete sequence
          Length = 69676

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 217   tcttccttcttctcctcctcctt 239
             |||||||||||||||||||||||
Sbjct: 16837 tcttccttcttctcctcctcctt 16815



to top

>emb|AL157388.12| Human DNA sequence from clone RP11-215A21 on chromosome 10 Contains the
              5' end of a novel gene (MGC33215), a ribosomal protein L17
              (rpL23) (RPL17) pseudogene and three CpG islands, complete
              sequence
          Length = 183382

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 216    ttcttccttcttctcctcctcct 238
              |||||||||||||||||||||||
Sbjct: 173628 ttcttccttcttctcctcctcct 173606



to top

>gb|AY239227.1| Eimeria maxima TFP250 mRNA, complete cds
          Length = 7990

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 216  ttcttccttcttctcctcctcct 238
            |||||||||||||||||||||||
Sbjct: 7067 ttcttccttcttctcctcctcct 7045



to top

>emb|BX070622.1|CNS09QNM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 290 cggcnaacttgctcgggtccttgaggtactccttgatc 327
           |||| ||||||||||| ||||||| | |||||||||||
Sbjct: 900 cggcgaacttgctcggatccttgatgaactccttgatc 863



to top

>emb|BX010374.1|CNS08G62 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16CG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 816

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 290 cggcnaacttgctcgggtccttgaggtactccttgatc 327
           |||| ||||||||||| ||||||| | |||||||||||
Sbjct: 392 cggcgaacttgctcggatccttgatgaactccttgatc 429



to top

>emb|CR938347.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YC06AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 631

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 55/65 (84%), Gaps = 3/65 (4%)
 Strand = Plus / Minus

                                                                       
Query: 175 aacagactgaatcccatctcgccatctgattcctcctcgggttcttccttcttctcctcc 234
           ||||||| ||||||||| ||| |||| ||   ||||||||||||||||| ||||| ||| 
Sbjct: 425 aacagaccgaatcccatatcgtcatcgga---ctcctcgggttcttcctccttcttctct 369

                
Query: 235 tcctt 239
           |||||
Sbjct: 368 tcctt 364



to top

>emb|CR937313.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 5-prime end of clone
           KW0AAB2YG10AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 583

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 55/65 (84%), Gaps = 3/65 (4%)
 Strand = Plus / Minus

                                                                       
Query: 175 aacagactgaatcccatctcgccatctgattcctcctcgggttcttccttcttctcctcc 234
           ||||||| ||||||||| ||| |||| ||   ||||||||||||||||| ||||| ||| 
Sbjct: 424 aacagaccgaatcccatatcgtcatcgga---ctcctcgggttcttcctccttcttctct 368

                
Query: 235 tcctt 239
           |||||
Sbjct: 367 tcctt 363



to top

>emb|CR937312.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 3-prime end of clone
           KW0AAB2YG10BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 566

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 55/65 (84%), Gaps = 3/65 (4%)
 Strand = Plus / Plus

                                                                       
Query: 175 aacagactgaatcccatctcgccatctgattcctcctcgggttcttccttcttctcctcc 234
           ||||||| ||||||||| ||| |||| ||   ||||||||||||||||| ||||| ||| 
Sbjct: 142 aacagaccgaatcccatatcgtcatcgga---ctcctcgggttcttcctccttcttctct 198

                
Query: 235 tcctt 239
           |||||
Sbjct: 199 tcctt 203



to top

>gb|AC163649.3| Mus musculus BAC clone RP24-372B10 from chromosome 3, complete sequence
          Length = 154740

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 216   ttcttccttcttctcctcctcct 238
             |||||||||||||||||||||||
Sbjct: 50581 ttcttccttcttctcctcctcct 50603



to top

>gb|AC110377.5| Mus musculus BAC clone RP23-460A13 from chromosome 12, complete sequence
          Length = 196540

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 216    ttcttccttcttctcctcctcct 238
              |||||||||||||||||||||||
Sbjct: 146087 ttcttccttcttctcctcctcct 146109



to top

>ref|NM_001028223.2| Caenorhabditis elegans T22B11.4b (T22B11.4) mRNA, complete cds
          Length = 1935

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 216  ttcttccttcttctcctcctcct 238
            |||||||||||||||||||||||
Sbjct: 1057 ttcttccttcttctcctcctcct 1035



to top

>ref|NM_001028222.2| Caenorhabditis elegans T22B11.4a (T22B11.4) mRNA, complete cds
          Length = 1958

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 216  ttcttccttcttctcctcctcct 238
            |||||||||||||||||||||||
Sbjct: 1057 ttcttccttcttctcctcctcct 1035



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 302      tcgggtccttgaggtactccttg 324
                |||||||||||||||||||||||
Sbjct: 31019551 tcgggtccttgaggtactccttg 31019529



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                           
Query: 207      ctcctcgggttcttccttcttctcctc 233
                |||||||| ||||||||||||||||||
Sbjct: 10714608 ctcctcggcttcttccttcttctcctc 10714634



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 218     cttccttcttctcctcctcct 238
               |||||||||||||||||||||
Sbjct: 4617572 cttccttcttctcctcctcct 4617592



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 217      tcttccttcttctcctcctccttg 240
                ||||||||||||||||||| ||||
Sbjct: 22578567 tcttccttcttctcctccttcttg 22578590



to top

>dbj|AP004815.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0516G10
          Length = 148937

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 302   tcgggtccttgaggtactccttg 324
             |||||||||||||||||||||||
Sbjct: 74507 tcgggtccttgaggtactccttg 74485



to top

>dbj|AP004800.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
            clone:P0585G03
          Length = 173649

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 302  tcgggtccttgaggtactccttg 324
            |||||||||||||||||||||||
Sbjct: 8775 tcgggtccttgaggtactccttg 8753



to top

>dbj|AP005533.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBa0018M09
          Length = 157377

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 207    ctcctcgggttcttccttcttctcctc 233
              |||||||| ||||||||||||||||||
Sbjct: 132298 ctcctcggcttcttccttcttctcctc 132324



to top

>dbj|AP004001.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1115_D03
          Length = 169378

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 207   ctcctcgggttcttccttcttctcctc 233
             |||||||| ||||||||||||||||||
Sbjct: 54089 ctcctcggcttcttccttcttctcctc 54115



to top

>dbj|AK071385.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023092C13, full
            insert sequence
          Length = 1726

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 302  tcgggtccttgaggtactccttg 324
            |||||||||||||||||||||||
Sbjct: 1149 tcgggtccttgaggtactccttg 1127



to top

>dbj|AK058613.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-018-A12, full
           insert sequence
          Length = 1080

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 207 ctcctcgggttcttccttcttctcctc 233
           |||||||| ||||||||||||||||||
Sbjct: 643 ctcctcggcttcttccttcttctcctc 617



to top

>tpe|BN000560.1| TPA: TPA_inf: Oryza sativa (japonica cultivar-group) prx31 gene for
            class III peroxidase 31 precursor, exon 1
          Length = 1353

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 302  tcgggtccttgaggtactccttg 324
            |||||||||||||||||||||||
Sbjct: 1072 tcgggtccttgaggtactccttg 1050



to top

>gb|AC117614.12| Mus musculus chromosome 5, clone RP23-110C17, complete sequence
          Length = 222809

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 216    ttcttccttcttctcctcctcct 238
              |||||||||||||||||||||||
Sbjct: 125950 ttcttccttcttctcctcctcct 125928



to top

>gb|AC140416.2| Mus musculus BAC clone RP24-347A16 from 6, complete sequence
          Length = 188390

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 216    ttcttccttcttctcctcctcct 238
              |||||||||||||||||||||||
Sbjct: 152914 ttcttccttcttctcctcctcct 152892



to top

>gb|AC122486.4| Mus musculus BAC clone RP24-380B9 from 12, complete sequence
          Length = 128253

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 216 ttcttccttcttctcctcctcct 238
           |||||||||||||||||||||||
Sbjct: 537 ttcttccttcttctcctcctcct 515



to top

>gb|AC124344.6| Mus musculus BAC clone RP24-448A7 from 3, complete sequence
          Length = 219818

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 216    ttcttccttcttctcctcctcct 238
              |||||||||||||||||||||||
Sbjct: 160984 ttcttccttcttctcctcctcct 161006



to top

>gb|AC132407.3| Mus musculus BAC clone RP23-343G12 from 8, complete sequence
          Length = 205357

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 217    tcttccttcttctcctcctcctt 239
              |||||||||||||||||||||||
Sbjct: 186871 tcttccttcttctcctcctcctt 186893



to top

>gb|U62752.1|ZMU62752 Zea mays acidic ribosomal protein P1a (rpp1a) mRNA, complete cds
          Length = 573

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 175 aacagactgaatcccatctcgccatctgattcctcctcgggttcttccttcttctcctc 233
           ||||| ||||| ||||| ||| |||| || ||||||| ||  |||||||||||||||||
Sbjct: 354 aacaggctgaagcccatgtcgtcatcagactcctccttggcctcttccttcttctcctc 296



to top

>gb|U40147.1|ZMU40147 Zea mays ribosomal protein L12 mRNA, complete cds
          Length = 530

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 175 aacagactgaatcccatctcgccatctgattcctcctcgggttcttccttcttctcctc 233
           ||||| ||||| ||||| ||| |||| || ||||||| ||  |||||||||||||||||
Sbjct: 389 aacaggctgaagcccatgtcgtcatcagactcctccttggcctcttccttcttctcctc 331



to top

>gb|DQ270163.1| Cricetulus barabensis clone L5 microsatellite sequence
          Length = 748

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 216 ttcttccttcttctcctcctcct 238
           |||||||||||||||||||||||
Sbjct: 307 ttcttccttcttctcctcctcct 329



to top

>emb|AL596331.15| Mouse DNA sequence from clone RP23-81G14 on chromosome 11, complete
              sequence
          Length = 228391

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 216    ttcttccttcttctcctcctcct 238
              |||||||||||||||||||||||
Sbjct: 180930 ttcttccttcttctcctcctcct 180908



to top

>emb|AL627236.11| Mouse DNA sequence from clone RP23-384G12 on chromosome 4, complete
             sequence
          Length = 201752

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 216   ttcttccttcttctcctcctcct 238
             |||||||||||||||||||||||
Sbjct: 84235 ttcttccttcttctcctcctcct 84257



to top

>gb|L24094.1|GORADPRB Gorilla gorilla ADP-ribosyltransferase (NAD+) pseudogene, repeat
            region
          Length = 5787

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 414  agccatggtggggtatgagatcg 436
            |||||||||||||||||||||||
Sbjct: 3337 agccatggtggggtatgagatcg 3359



to top

>gb|AC114554.8| Mus musculus chromosome 5, clone RP23-414E14, complete sequence
          Length = 204467

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 217    tcttccttcttctcctcctcct 238
              ||||||||||||||||||||||
Sbjct: 125143 tcttccttcttctcctcctcct 125122



to top

>gb|DQ213908.1| Taeniopygia guttata clone 0061P0002B01 mRNA sequence
          Length = 752

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 217 tcttccttcttctcctcctcct 238
           ||||||||||||||||||||||
Sbjct: 521 tcttccttcttctcctcctcct 500



to top

>gb|AC128859.4| Rattus norvegicus 10 BAC CH230-436I22 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 156078

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 218    cttccttcttctcctcctcctt 239
              ||||||||||||||||||||||
Sbjct: 100686 cttccttcttctcctcctcctt 100707



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 220   tccttcttctcctcctccttg 240
             |||||||||||||||||||||
Sbjct: 99418 tccttcttctcctcctccttg 99438



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 220    tccttcttctcctcctcctt 239
              ||||||||||||||||||||
Sbjct: 101950 tccttcttctcctcctcctt 101969



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 220    tccttcttctcctcctcctt 239
              ||||||||||||||||||||
Sbjct: 101935 tccttcttctcctcctcctt 101954



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 220    tccttcttctcctcctcctt 239
              ||||||||||||||||||||
Sbjct: 101543 tccttcttctcctcctcctt 101562



to top

>gb|AY674236.1| Ixodes pacificus clone IP_7_60_92_569_CLU ribosomal protein, large
           P2 mRNA, complete cds
          Length = 345

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 207 ctcctcgggttcttccttcttctcctcctccttg 240
           ||||||||  ||||||||||||||||||| ||||
Sbjct: 309 ctcctcggactcttccttcttctcctccttcttg 276



to top

>gb|AC124614.11| Mus musculus chromosome 10, clone RP24-417L12, complete sequence
          Length = 173306

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 217   tcttccttcttctcctcctcct 238
             ||||||||||||||||||||||
Sbjct: 94724 tcttccttcttctcctcctcct 94703



to top

>gb|AC114674.10| Mus musculus chromosome 9, clone RP24-209N21, complete sequence
          Length = 203120

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 217   tcttccttcttctcctcctcct 238
             ||||||||||||||||||||||
Sbjct: 62058 tcttccttcttctcctcctcct 62037



to top

>gb|AC140426.3| Mus musculus BAC clone RP24-98A17 from chromosome 14, complete sequence
          Length = 189282

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 217    tcttccttcttctcctcctcct 238
              ||||||||||||||||||||||
Sbjct: 149776 tcttccttcttctcctcctcct 149797



to top

>gb|AY391258.1| Oxyrrhis marina heat shock protein 90 gene, partial cds
          Length = 1713

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 217 tcttccttcttctcctcctcct 238
           ||||||||||||||||||||||
Sbjct: 632 tcttccttcttctcctcctcct 611



to top

>gb|AC133514.4| Mus musculus BAC clone RP23-212F6 from chromosome 5, complete sequence
          Length = 208083

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 383   tgtatgcattgaggaacatgtg 404
             ||||||||||||||||||||||
Sbjct: 71896 tgtatgcattgaggaacatgtg 71917



to top

>gb|AC125057.5| Mus musculus BAC clone RP23-399K1 from chromosome 12, complete sequence
          Length = 182276

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 217   tcttccttcttctcctcctcct 238
             ||||||||||||||||||||||
Sbjct: 92099 tcttccttcttctcctcctcct 92078



to top

>gb|AC125128.3| Mus musculus BAC clone RP24-289N17 from chromosome 14, complete
             sequence
          Length = 180645

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 217   tcttccttcttctcctcctcct 238
             ||||||||||||||||||||||
Sbjct: 27107 tcttccttcttctcctcctcct 27128



to top

>emb|Z70280.1|HSV210E9 Human DNA sequence from clone GHc-210E9 on chromosome X Contains the
            5' end of the DRP2 gene for dystrophin related protein 2,
            a pseudogene similar to part of tyrosine
            3-monooxygenase/tryptophan 5-monooxygenase activation
            protein and a CpG island, complete sequence
          Length = 37194

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 217  tcttccttcttctcctcctcct 238
            ||||||||||||||||||||||
Sbjct: 3091 tcttccttcttctcctcctcct 3112



to top

>emb|BX649553.6| Human DNA sequence from clone RP4-674K6 on chromosome X, complete
             sequence
          Length = 86882

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 217   tcttccttcttctcctcctcct 238
             ||||||||||||||||||||||
Sbjct: 54250 tcttccttcttctcctcctcct 54271



to top

>emb|AL160162.11| Human DNA sequence from clone RP1-200K18 on chromosome 6 Contains a
             novel gene, complete sequence
          Length = 82329

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 218   cttccttcttctcctcctcctt 239
             ||||||||||||||||||||||
Sbjct: 43601 cttccttcttctcctcctcctt 43622



to top

>emb|AL138809.18| Human DNA sequence from clone RP5-981M18 on chromosome 20 Contains
             ESTs, STSs and GSSs, complete sequence
          Length = 94710

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 216   ttcttccttcttctcctcctcc 237
             ||||||||||||||||||||||
Sbjct: 63360 ttcttccttcttctcctcctcc 63339



to top

>emb|AL662806.20| Mouse DNA sequence from clone RP23-273O7 on chromosome 11 Contains the
             5' end of the Cyfip2 gene for cytoplasmic FMR1 interacting
             protein 2, the Itk gene for IL2-inducible T-cell kinase,
             two novel genes and a CpG island, complete sequence
          Length = 161754

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 217   tcttccttcttctcctcctcct 238
             ||||||||||||||||||||||
Sbjct: 17792 tcttccttcttctcctcctcct 17771



to top

>gb|AC164578.5| Mus musculus  BAC RP23-15E20 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 225564

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 217    tcttccttcttctcctcctcct 238
              ||||||||||||||||||||||
Sbjct: 110782 tcttccttcttctcctcctcct 110761



to top

>emb|AL645971.12| Mouse DNA sequence from clone RP23-378J19 on chromosome 11 Vontains the
             5' end of the gene for novel protein similar to human RAP1
             GTPase activating protein 1 RAP1GA1,,a novel gene and
             three CpG islands, complete sequence
          Length = 102898

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 217   tcttccttcttctcctcctcct 238
             ||||||||||||||||||||||
Sbjct: 72328 tcttccttcttctcctcctcct 72307



to top

>emb|AL928566.4| Mouse DNA sequence from clone RP23-311A20 on chromosome 4 Contains a CCHC
              domain containing zinc finger 9 (Zcchc9) pseudogene,
              complete sequence
          Length = 160214

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 218    cttccttcttctcctcctcctt 239
              ||||||||||||||||||||||
Sbjct: 100140 cttccttcttctcctcctcctt 100161



to top

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 402     gtgcggtgcagcagccatggtg 423
               ||||||||||||||||||||||
Sbjct: 4483112 gtgcggtgcagcagccatggtg 4483133



to top

>gb|AC127520.5| Homo sapiens chromosome 15, clone RP11-825M14, complete sequence
          Length = 155382

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 217    tcttccttcttctcctcctcct 238
              ||||||||||||||||||||||
Sbjct: 144306 tcttccttcttctcctcctcct 144285



to top

>gb|AC150899.3| Mus musculus BAC clone RP23-179F8 from chromosome 10, complete
           sequence
          Length = 202346

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 217 tcttccttcttctcctcctcct 238
           ||||||||||||||||||||||
Sbjct: 708 tcttccttcttctcctcctcct 687



to top

>gb|AC009063.8| Homo sapiens chromosome 16 clone RP11-298D21, complete sequence
          Length = 194237

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 217   tcttccttcttctcctcctcct 238
             ||||||||||||||||||||||
Sbjct: 92799 tcttccttcttctcctcctcct 92820



to top

>gb|DQ066213.1| Ixodes scapularis isolate ISUFL22 60S acidic ribosomal protein P0
           mRNA, complete cds
          Length = 960

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 303 cgggtccttgaggtactccttg 324
           ||||||||||||||||||||||
Sbjct: 816 cgggtccttgaggtactccttg 795



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 204 ttcctcctcgggttcttccttcttctcctcctcctt 239
           ||||||||||| |||||| |||||  ||||||||||
Sbjct: 927 ttcctcctcggattcttctttcttagcctcctcctt 892



to top

>gb|DQ066207.1| Ixodes scapularis isolate ISUFL46 ribosomal protein LP2 mRNA,
           complete cds
          Length = 345

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 207 ctcctcgggttcttccttcttctcctcctccttg 240
           |||||||| |||||| ||||||||||||| ||||
Sbjct: 309 ctcctcggattcttctttcttctcctccttcttg 276



to top

>gb|AC158658.4| Mus musculus 6 BAC RP23-400L4 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 197909

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 217   tcttccttcttctcctcctcct 238
             ||||||||||||||||||||||
Sbjct: 55670 tcttccttcttctcctcctcct 55691



to top

>gb|AC012320.6|AC012320 Homo sapiens chromosome 16 clone RP11-280N16, complete sequence
          Length = 189840

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 217   tcttccttcttctcctcctcct 238
             ||||||||||||||||||||||
Sbjct: 32958 tcttccttcttctcctcctcct 32979



to top

>gb|AC097586.3| Sus scrofa clone RP44-394E19, complete sequence
          Length = 174554

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 217    tcttccttcttctcctcctcct 238
              ||||||||||||||||||||||
Sbjct: 128990 tcttccttcttctcctcctcct 128969



to top

>gb|AC068831.17| Homo sapiens chromosome 15, clone RP11-2O19, complete sequence
          Length = 136975

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 217    tcttccttcttctcctcctcct 238
              ||||||||||||||||||||||
Sbjct: 136889 tcttccttcttctcctcctcct 136910



to top

>gb|AF227622.1|AF227622 Euphorbia esula 60S acidic ribosomal protein PO mRNA, partial cds
          Length = 1127

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 376 acattcttgtatgcattgaggaacatgtgcggtgcagcagccatggtggggtatgaga 433
           ||||||||||| ||||| | ||||||||| || |||||||| |  || ||||||||||
Sbjct: 743 acattcttgtaggcattaatgaacatgtggggggcagcagctagagttgggtatgaga 686



to top

>emb|AJ322895.1|HSA322895 Homo sapiens genomic sequence surrounding NotI site, clone NR1-OC4R
          Length = 843

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 218 cttccttcttctcctcctcctt 239
           ||||||||||||||||||||||
Sbjct: 573 cttccttcttctcctcctcctt 552



to top

>dbj|AP000722.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-675M1, complete
             sequence
          Length = 177882

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 216   ttcttccttcttctcctcctcc 237
             ||||||||||||||||||||||
Sbjct: 14264 ttcttccttcttctcctcctcc 14243



to top

>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 402     gtgcggtgcagcagccatggtg 423
               ||||||||||||||||||||||
Sbjct: 4485675 gtgcggtgcagcagccatggtg 4485696



to top

>dbj|AP003124.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-447G14, complete
              sequence
          Length = 177483

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 216    ttcttccttcttctcctcctcc 237
              ||||||||||||||||||||||
Sbjct: 105144 ttcttccttcttctcctcctcc 105123



to top

>dbj|AP002469.3| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-266E8, complete
              sequence
          Length = 158977

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 218    cttccttcttctcctcctcctt 239
              ||||||||||||||||||||||
Sbjct: 110140 cttccttcttctcctcctcctt 110161



to top

>dbj|AP002762.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-811I7, complete
            sequence
          Length = 189993

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 218  cttccttcttctcctcctcctt 239
            ||||||||||||||||||||||
Sbjct: 6975 cttccttcttctcctcctcctt 6996



to top

>emb|AL671672.4| Mouse DNA sequence from clone RP23-461E2 on chromosome 4, complete
            sequence
          Length = 191255

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 217  tcttccttcttctcctcctcct 238
            ||||||||||||||||||||||
Sbjct: 6226 tcttccttcttctcctcctcct 6205



to top

>emb|AL844609.6| Mouse DNA sequence from clone RP23-356F8 on chromosome 4, complete
             sequence
          Length = 191676

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 217   tcttccttcttctcctcctcct 238
             ||||||||||||||||||||||
Sbjct: 47864 tcttccttcttctcctcctcct 47885



to top

>emb|AL731783.10| Mouse DNA sequence from clone RP23-124E18 on chromosome 2, complete
             sequence
          Length = 207209

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 217   tcttccttcttctcctcctcct 238
             ||||||||||||||||||||||
Sbjct: 60108 tcttccttcttctcctcctcct 60129



to top

>ref|NM_125750.3| Arabidopsis thaliana unknown protein AT5G63550 mRNA, complete cds
          Length = 1871

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 217 tcttccttcttctcctcctcc 237
           |||||||||||||||||||||
Sbjct: 192 tcttccttcttctcctcctcc 172



to top

>gb|AC168056.3| Mus musculus BAC clone RP24-189B1 from chromosome 13, complete sequence
          Length = 179458

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 218    cttccttcttctcctcctcct 238
              |||||||||||||||||||||
Sbjct: 155453 cttccttcttctcctcctcct 155473



to top

>ref|NM_187845.1| Oryza sativa (japonica cultivar-group), Ozsa8289 predicted mRNA
          Length = 534

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 220 tccttcttctcctcctccttg 240
           |||||||||||||||||||||
Sbjct: 242 tccttcttctcctcctccttg 222



to top

>gb|AC163684.5| Mus musculus BAC clone RP23-8N10 from chromosome 13, complete sequence
          Length = 234717

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 218   cttccttcttctcctcctcct 238
             |||||||||||||||||||||
Sbjct: 93981 cttccttcttctcctcctcct 94001



to top

>ref|NM_001017204.2| Xenopus tropicalis hypothetical protein LOC549958 (LOC549958), mRNA
          Length = 480

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 207 ctcctcgggttcttccttcttctcctcctcctt 239
           |||||||| ||||||||||||||| || |||||
Sbjct: 380 ctcctcggattcttccttcttctcttcttcctt 348



to top

>gb|AC104414.8| Mus musculus chromosome 3, clone RP23-99I7, complete sequence
          Length = 212613

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 215    gttcttccttcttctcctcctcctt 239
              |||| ||||||||||||||||||||
Sbjct: 187965 gttcctccttcttctcctcctcctt 187989



to top

>gb|BT018956.1| Zea mays clone Contig167.F mRNA sequence
          Length = 1302

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 220 tccttcttctcctcctccttg 240
           |||||||||||||||||||||
Sbjct: 769 tccttcttctcctcctccttg 749



to top

>gb|AC102270.8| Mus musculus chromosome 3, clone RP24-266A23, complete sequence
          Length = 185321

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 215 gttcttccttcttctcctcctcctt 239
           |||| ||||||||||||||||||||
Sbjct: 863 gttcctccttcttctcctcctcctt 887



to top

>gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 9, complete
              sequence
          Length = 1178688

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 220    tccttcttctcctcctccttg 240
              |||||||||||||||||||||
Sbjct: 287940 tccttcttctcctcctccttg 287920



to top

>gb|AF039037.2| Caenorhabditis elegans cosmid R02C2, complete sequence
          Length = 24361

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 219  ttccttcttctcctcctcctt 239
            |||||||||||||||||||||
Sbjct: 7058 ttccttcttctcctcctcctt 7038



to top

>gb|AC110567.10| Mus musculus chromosome 5, clone RP23-304I24, complete sequence
          Length = 188137

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 218   cttccttcttctcctcctcct 238
             |||||||||||||||||||||
Sbjct: 70989 cttccttcttctcctcctcct 70969



to top

>gb|AY550907.1| Mus musculus embryonic stem cell-related protein mRNA, complete cds
          Length = 1616

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 215 gttcttccttcttctcctcctcctt 239
           ||||||||| |||||||||||||||
Sbjct: 644 gttcttcctccttctcctcctcctt 620



to top

>ref|NM_001006887.2| Xenopus tropicalis polymerase (RNA) II (DNA directed) polypeptide F
           (polr2f), mRNA
          Length = 765

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 207 ctcctcgggttcttccttcttctcctcctcctt 239
           |||||||| ||||||||||||||| || |||||
Sbjct: 626 ctcctcggattcttccttcttctcttcttcctt 594



to top

>ref|NM_026560.2| Mus musculus cell division cycle associated 8 (Cdca8), mRNA
          Length = 1616

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 215 gttcttccttcttctcctcctcctt 239
           ||||||||| |||||||||||||||
Sbjct: 644 gttcttcctccttctcctcctcctt 620



to top

>gb|AC164588.4| Mus musculus chromosome 5, clone RP24-304H2, complete sequence
          Length = 188602

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 216    ttcttccttcttctcctcctc 236
              |||||||||||||||||||||
Sbjct: 122074 ttcttccttcttctcctcctc 122094



to top

>gb|AC161042.4| Mus musculus chromosome 8, clone RP24-278L20, complete sequence
          Length = 174823

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 219    ttccttcttctcctcctcctt 239
              |||||||||||||||||||||
Sbjct: 139145 ttccttcttctcctcctcctt 139125



to top

>gb|AC111125.11| Mus musculus chromosome 9, clone RP23-331P8, complete sequence
          Length = 260036

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 218    cttccttcttctcctcctcct 238
              |||||||||||||||||||||
Sbjct: 106089 cttccttcttctcctcctcct 106109



to top

>ref|XM_755686.1| Ustilago maydis 521 hypothetical protein (UM04632.1) partial mRNA
          Length = 336

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 220 tccttcttctcctcctccttg 240
           |||||||||||||||||||||
Sbjct: 284 tccttcttctcctcctccttg 264



to top

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 403    tgcggtgcagcagccatggtg 423
              |||||||||||||||||||||
Sbjct: 279864 tgcggtgcagcagccatggtg 279884



to top

>emb|CR974571.9| Mouse DNA sequence from clone RP23-145P19 on chromosome 12, complete
             sequence
          Length = 219782

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 218   cttccttcttctcctcctcct 238
             |||||||||||||||||||||
Sbjct: 87985 cttccttcttctcctcctcct 87965



to top

>ref|XM_572834.1| Cryptococcus neoformans var. neoformans JEC21 polyadenylate-binding
            protein (CNI01160) partial mRNA
          Length = 2329

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 220  tccttcttctcctcctccttg 240
            |||||||||||||||||||||
Sbjct: 2139 tccttcttctcctcctccttg 2119



to top

>gb|AC122199.4| Mus musculus BAC clone RP23-57C9 from chromosome 8, complete sequence
          Length = 202975

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 216    ttcttccttcttctcctcctc 236
              |||||||||||||||||||||
Sbjct: 131092 ttcttccttcttctcctcctc 131112



to top

>ref|XM_812376.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053506227.250) partial mRNA
          Length = 1449

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 214  ggttcttccttcttctcctcctcct 238
            ||||||||||| |||||||||||||
Sbjct: 1408 ggttcttcctttttctcctcctcct 1432



to top

>emb|CR729373.2|CNS0GPQB Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 211 tcgggttcttccttcttctcctcct 235
           ||||| |||||||||||||||||||
Sbjct: 435 tcgggctcttccttcttctcctcct 411



to top

>gb|AC011992.3| Homo sapiens BAC clone CTD-2327A23 from 7, complete sequence
          Length = 80515

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aacaaacagcataactaattc 69
             |||||||||||||||||||||
Sbjct: 60766 aacaaacagcataactaattc 60786



to top

>gb|DQ334167.1| Drosophila miranda CG3620 gene, partial cds
          Length = 1053

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 220 tccttcttctcctcctccttg 240
           |||||||||||||||||||||
Sbjct: 749 tccttcttctcctcctccttg 729



to top

>emb|AL138847.14| Human DNA sequence from clone RP5-849H19 on chromosome 1p32.1-33
             Contains part of the DOCK7 gene for dedicator of
             cytokinesis 7, a ribosomal protein L13a (RPL13A) and the
             ANGPTL3 gene for angiopoietin-like 3, complete sequence
          Length = 66673

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 216   ttcttccttcttctcctcctc 236
             |||||||||||||||||||||
Sbjct: 41512 ttcttccttcttctcctcctc 41492



to top

>emb|BX053470.1|CNS09DF6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 397 cggcgaacttgctcggatccttgatgaactccttga 432



to top

>emb|BX053469.1|CNS09DF5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 906 cggcgaacttgctcggatccttgatgaactccttga 871



to top

>emb|BX072032.1|CNS09RQS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 800

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 409 cggcgaacttgctcggatccttgatgaactccttga 444



to top

>emb|BX072030.1|CNS09RQQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 458

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 401 cggcgaacttgctcggatccttgatgaactccttga 436



to top

>emb|BX072029.1|CNS09RQP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 414

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 413 cggcgaacttgctcggatccttgatgaactccttga 378



to top

>emb|BX071994.1|CNS09RPQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 396 cggcgaacttgctcggatccttgatgaactccttga 431



to top

>emb|BX071993.1|CNS09RPP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 923 cggcgaacttgctcggatccttgatgaactccttga 888



to top

>emb|BX071848.1|CNS09RLO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1000

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 398 cggcgaacttgctcggatccttgatgaactccttga 433



to top

>emb|BX071847.1|CNS09RLN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1068

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 910 cggcgaacttgctcggatccttgatgaactccttga 875



to top

>emb|BX071748.1|CNS09RIW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 410 cggcgaacttgctcggatccttgatgaactccttga 445



to top

>emb|BX071747.1|CNS09RIV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 906 cggcgaacttgctcggatccttgatgaactccttga 871



to top

>emb|BX071519.1|CNS09RCJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 411

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 19  cggcgaacttgctcggatccttgatgaactccttga 54



to top

>emb|BX071226.1|CNS09R4E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 460 cggcgaacttgctcggatccttgatgaactccttga 425



to top

>emb|BX071176.1|CNS09R30 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8CD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 785

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 384 cggcgaacttgctcggatccttgatgaactccttga 419



to top

>emb|BX071175.1|CNS09R2Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 888 cggcgaacttgctcggatccttgatgaactccttga 853



to top

>emb|BX071446.1|CNS09RAI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 777

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 425 cggcgaacttgctcggatccttgatgaactccttga 460



to top

>emb|BX071445.1|CNS09RAH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1033

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 916 cggcgaacttgctcggatccttgatgaactccttga 881



to top

>emb|BX071387.1|CNS09R8V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 482

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 38  cggcgaacttgctcggatccttgatgaactccttga 73



to top

>emb|BX071040.1|CNS09QZ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 390 cggcgaacttgctcggatccttgatgaactccttga 425



to top

>emb|BX071039.1|CNS09QZ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 898 cggcgaacttgctcggatccttgatgaactccttga 863



to top

>emb|BX070974.1|CNS09QXE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 414 cggcgaacttgctcggatccttgatgaactccttga 449



to top

>emb|BX070973.1|CNS09QXD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 912 cggcgaacttgctcggatccttgatgaactccttga 877



to top

>emb|BX070931.1|CNS09QW7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 394 cggcgaacttgctcggatccttgatgaactccttga 429



to top

>emb|BX070930.1|CNS09QW6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1029

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 905 cggcgaacttgctcggatccttgatgaactccttga 870



to top

>emb|BX070901.1|CNS09QVD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 403 cggcgaacttgctcggatccttgatgaactccttga 438



to top

>emb|BX070900.1|CNS09QVC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 910 cggcgaacttgctcggatccttgatgaactccttga 875



to top

>emb|BX070752.1|CNS09QR8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 831

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 409 cggcgaacttgctcggatccttgatgaactccttga 444



to top

>emb|BX070751.1|CNS09QR7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 902 cggcgaacttgctcggatccttgatgaactccttga 867



to top

>emb|BX070746.1|CNS09QR2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 395 cggcgaacttgctcggatccttgatgaactccttga 430



to top

>emb|BX070745.1|CNS09QR1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 837

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 779 cggcgaacttgctcggatccttgatgaactccttga 744



to top

>emb|BX070623.1|CNS09QNN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 514

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 295 aacttgctcgggtccttgaggtactccttgatc 327
           ||||||||||| ||||||| | |||||||||||
Sbjct: 31  aacttgctcggatccttgatgaactccttgatc 63



to top

>emb|BX070542.1|CNS09QLE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 817

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 394 cggcgaacttgctcggatccttgatgaactccttga 429



to top

>emb|BX070100.1|CNS09Q94 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 392 cggcgaacttgctcggatccttgatgaactccttga 427



to top

>emb|BX070099.1|CNS09Q93 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 907 cggcgaacttgctcggatccttgatgaactccttga 872



to top

>emb|BX069969.1|CNS09Q5H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 792

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 413 cggcgaacttgctcggatccttgatgaactccttga 448



to top

>emb|BX069968.1|CNS09Q5G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 781

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 567 cggcgaacttgctcggatccttgatgaactccttga 532



to top

>emb|BX069824.1|CNS09Q1G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6CE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 396 cggcgaacttgctcggatccttgatgaactccttga 431



to top

>emb|BX069823.1|CNS09Q1F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 907 cggcgaacttgctcggatccttgatgaactccttga 872



to top

>emb|BX069792.1|CNS09Q0K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 765

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 391 cggcgaacttgctcggatccttgatgaactccttga 426



to top

>emb|BX061099.1|CNS09JB3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 397 cggcgaacttgctcggatccttgatgaactccttga 432



to top

>emb|BX061098.1|CNS09JB2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 897 cggcgaacttgctcggatccttgatgaactccttga 862



to top

>emb|BX061090.1|CNS09JAU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 907 cggcgaacttgctcggatccttgatgaactccttga 872



to top

>emb|BX061062.1|CNS09JA2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 410 cggcgaacttgctcggatccttgatgaactccttga 445



to top

>emb|BX061061.1|CNS09JA1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1063

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 924 cggcgaacttgctcggatccttgatgaactccttga 889



to top

>emb|BX069589.1|CNS09PUX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 524

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 391 cggcgaacttgctcggatccttgatgaactccttga 426



to top

>emb|BX069404.1|CNS09PPS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 398 cggcgaacttgctcggatccttgatgaactccttga 433



to top

>emb|BX069403.1|CNS09PPR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 901 cggcgaacttgctcggatccttgatgaactccttga 866



to top

>emb|BX069337.1|CNS09PNX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53DH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 884

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 376 cggcgaacttgctcggatccttgatgaactccttga 411



to top

>emb|BX069336.1|CNS09PNW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 896 cggcgaacttgctcggatccttgatgaactccttga 861



to top

>emb|BX069236.1|CNS09PL4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 461

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 418 cggcgaacttgctcggatccttgatgaactccttga 453



to top

>emb|BX069143.1|CNS09PIJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 886

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 417 cggcgaacttgctcggatccttgatgaactccttga 452



to top

>emb|BX069142.1|CNS09PII Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 906 cggcgaacttgctcggatccttgatgaactccttga 871



to top

>emb|BX068989.1|CNS09PE9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 425 cggcgaacttgctcggatccttgatgaactccttga 460



to top

>emb|BX068988.1|CNS09PE8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 910 cggcgaacttgctcggatccttgatgaactccttga 875



to top

>emb|BX068834.1|CNS09P9Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53BA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 431 cggcgaacttgctcggatccttgatgaactccttga 466



to top

>emb|BX068833.1|CNS09P9X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1037

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 930 cggcgaacttgctcggatccttgatgaactccttga 895



to top

>emb|BX068816.1|CNS09P9G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 530

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 356 cggcgaacttgctcggatccttgatgaactccttga 391



to top

>emb|BX068815.1|CNS09P9F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 911 cggcgaacttgctcggatccttgatgaactccttga 876



to top

>emb|BX068608.1|CNS09P3O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 861

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 387 cggcgaacttgctcggatccttgatgaactccttga 422



to top

>emb|BX068586.1|CNS09P32 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52DF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 639

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 337 cggcgaacttgctcggatccttgatgaactccttga 372



to top

>emb|BX068585.1|CNS09P31 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 624

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 526 cggcgaacttgctcggatccttgatgaactccttga 491



to top

>emb|BX068472.1|CNS09OZW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 390 cggcgaacttgctcggatccttgatgaactccttga 425



to top

>emb|BX068471.1|CNS09OZV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1059

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 290 cggcnaacttgctcgggtccttgaggtactccttga 325
           |||| ||||||||||| ||||||| | |||||||||
Sbjct: 900 cggcgaacttgctcggatccttgatgaactccttga 865


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,616,622
Number of Sequences: 3902068
Number of extensions: 4616622
Number of successful extensions: 151208
Number of sequences better than 10.0: 1751
Number of HSP's better than 10.0 without gapping: 1761
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 145234
Number of HSP's gapped (non-prelim): 5708
length of query: 491
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 469
effective length of database: 17,147,199,772
effective search space: 8042036693068
effective search space used: 8042036693068
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top