ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart08f03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrins... 617 e-173
2gb|BT016583.1| Zea mays clone Contig416 mRNA sequence 232 9e-58
3gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds 224 2e-55
4gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein... 216 5e-53
5gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein... 208 1e-50
6gb|AY109332.1| Zea mays CL502_5 mRNA sequence 208 1e-50
7gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, comp... 168 1e-38
8ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA 161 3e-36
9ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group... 161 3e-36
10ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group... 161 3e-36
11dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clon... 161 3e-36
12dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clon... 161 3e-36
13dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 161 3e-36
14dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 161 3e-36
15dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clon... 153 7e-34
16dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA ... 145 2e-31
17dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 141 3e-30
18dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D... 141 3e-30
19gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein... 129 1e-26
20gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein... 129 1e-26
21ref|XM_466869.1| Oryza sativa (japonica cultivar-group), mRNA 121 2e-24
22dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 2e-24
23gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence 113 6e-22
24ref|NM_187081.2| Oryza sativa (japonica cultivar-group), mRNA 107 4e-20
25dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 4e-20
26gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrins... 105 1e-19
27gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds 101 2e-18
28gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protei... 101 2e-18
29gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putat... 88 3e-14
30gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1)... 88 3e-14
31ref|NM_187084.1| Oryza sativa (japonica cultivar-group), mRNA 84 5e-13
32ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group... 84 5e-13
33dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 5e-13
34gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds 82 2e-12
35ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predic... 82 2e-12
36dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin ... 82 2e-12
37dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin,... 80 8e-12
38dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd 80 8e-12
39emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet... 78 3e-11
40dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
41dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
42dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
43gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, ... 78 3e-11
44dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ... 78 3e-11
45gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence 76 1e-10
46gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-... 76 1e-10
47emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein 76 1e-10
48emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein 76 1e-10
49gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putat... 76 1e-10
50dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds 76 1e-10
51ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channe... 72 2e-09
52gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 72 2e-09
53gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 72 2e-09
54gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 72 2e-09
55dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
56emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
57emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
58dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
59gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water chann... 70 8e-09
60gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasm... 70 8e-09
61ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channe... 68 3e-08
62ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predic... 68 3e-08
63gb|AY081593.1| Arabidopsis thaliana water channel-like protein (... 68 3e-08
64gb|AY059948.1| Arabidopsis thaliana water channel - like protein... 68 3e-08
65dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - li... 68 3e-08
66emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Co... 68 3e-08
67emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Co... 68 3e-08
68emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Co... 68 3e-08
69emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Co... 68 3e-08
70gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete se... 68 3e-08
71gb|AY170841.1| Axonopus compressus plasma membrane MIP protein m... 68 3e-08
72dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 3e-08
73dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 3e-08
74dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 3e-08
75dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 3e-08
76emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for p... 64 5e-07
77gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds 64 5e-07
78gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, c... 64 5e-07
79emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for p... 62 2e-06
80emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for p... 62 2e-06
81gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putat... 62 2e-06
82gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein... 62 2e-06
83gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, comple... 62 2e-06
84dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 62 2e-06
85gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com... 62 2e-06
86ref|XM_475029.1| Oryza sativa (japonica cultivar-group), predic... 60 7e-06
87gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein... 60 7e-06
88gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein... 60 7e-06
89dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 7e-06
90dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 7e-06
91dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 7e-06
92dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 7e-06
93gb|AY103580.1| Zea mays PCO072544 mRNA sequence 60 7e-06
94gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRN... 60 7e-06
95gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (... 58 3e-05
96emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4,... 58 3e-05
97emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for p... 58 3e-05
98emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for p... 58 3e-05
99dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
100gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds 58 3e-05
101dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
102dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
103dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
104gb|AY107589.1| Zea mays PCO085320 mRNA sequence 58 3e-05
105gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker 56 1e-04
106gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker 56 1e-04
107dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membran... 56 1e-04
108ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative... 54 5e-04
109emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for p... 54 5e-04
110gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putat... 54 5e-04
111gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma... 54 5e-04
112dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 5e-04
113dbj|AB002149.1| Nicotiana excelsior mRNA for water channel prote... 54 5e-04
114gb|U56603.1|BMU56603 Bufo marinus vasopressin-insensitive water ... 52 0.002
115gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds 52 0.002
116gb|AF020620.1| Bufo marinus aquaporin-1 homolog (AQP-t1) mRNA, c... 52 0.002
117emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4,... 52 0.002
118gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein ... 52 0.002
119gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence 50 0.007
120emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp... 50 0.007
121dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds 50 0.007
122gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrin... 50 0.007
123dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membran... 50 0.007
124gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic pr... 48 0.028
125gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel... 48 0.028
126gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA 48 0.028
127gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (... 46 0.11
128gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, ... 46 0.11
129emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel... 46 0.11
130dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.11
131gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein... 46 0.11
132gb|AY995195.1| Phaseolus vulgaris putative aquaporin (PIP2;1) mR... 46 0.11
133dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane in... 46 0.11
134dbj|AB206099.1| Mimosa pudica pip2;1 mRNA for plasma membrane in... 46 0.11
135gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, ... 46 0.11
136gb|AF255795.1|AF255795 Allium cepa aquaporin 1 (Aqp1) mRNA, comp... 46 0.11
137dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic D... 46 0.11
138dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membra... 46 0.11
139dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.11
140dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.11
141dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.11
142gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, c... 46 0.11
143dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.11
144dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic D... 46 0.11
145gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, co... 46 0.11
146gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, com... 46 0.11
147dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membran... 46 0.11
148gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic pr... 44 0.44
149emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, ... 44 0.44
150emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, B... 44 0.44
151emb|AJ005869.1|CAR005869 Cicer arietinum mRNA for putative trans... 44 0.44
152gb|U22658.1|BMU22658 Bufo marinus urinary bladder aquaporin mRNA... 44 0.44
153gb|AF386739.1|AF386739 Medicago truncatula aquaporin protein PIP... 44 0.44
154gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, ... 44 0.44
155emb|AJ605574.1| Ricinus communis mRNA for aquaporin (Pip1-1 gene... 44 0.44
156gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds 44 0.44
157gb|U62280.1|NTU62280 Nicotiana tabacum aquaporin (NT2) mRNA, com... 44 0.44
158ref|NM_115339.2| Arabidopsis thaliana PIP2;5/PIP2D; water channe... 42 1.7
159gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 42 1.7
160gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 42 1.7
161gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 42 1.7
162gb|BT000670.1| Arabidopsis thaliana clone RAFL07-09-N03 (R10758)... 42 1.7
163emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel... 42 1.7
164gb|AY062981.1| Arabidopsis thaliana putative aquaporin/MIP prote... 42 1.7
165gb|AF370351.1| Arabidopsis thaliana putative aquaporin/MIP prote... 42 1.7
166ref|NM_001005829.1| Xenopus tropicalis aquaporin 1 (channel-form... 42 1.7
167emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 42 1.7
168emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4,... 42 1.7
169emb|AJ849324.1| Populus tremula x Populus tremuloides mRNA for p... 42 1.7
170gb|AY671950.1| Aegiceras corniculatum aquaporin 2 (PIP2) mRNA, c... 42 1.7
171emb|BX822631.1|CNS0A61A Arabidopsis thaliana Full-length cDNA Co... 42 1.7
172dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 42 1.7
173gb|AF154641.1| Nicotiana tabacum clone PR16 mRNA sequence 42 1.7
174gb|AY084843.1| Arabidopsis thaliana clone 11929 mRNA, complete s... 42 1.7
175emb|AJ605568.1| Ricinus communis partial mRNA for putative aquap... 42 1.7
176gb|BC075384.1| Xenopus tropicalis aquaporin 1 (channel-forming i... 42 1.7
177gb|BC084131.1| Xenopus laevis hypothetical LOC495037, mRNA (cDNA... 42 1.7
178gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 42 1.7
179gb|AE000657.1| Aquifex aeolicus VF5, complete genome 42 1.7
180gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel prot... 42 1.7
181ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G0... 40 6.9
182gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 40 6.9
183gb|AY494191.1| Physcomitrella patens plasma membrane aquaporin (... 40 6.9
184gb|AC016250.5| Homo sapiens chromosome 8 clone RP11-516P9, compl... 40 6.9
185gb|CP000272.1| Burkholderia xenovorans LB400 chromosome 3, compl... 40 6.9
186emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrins... 40 6.9
187emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B 40 6.9
188emb|BX545848.23| Zebrafish DNA sequence from clone DKEY-8O19 in ... 40 6.9
189gb|AC025207.5| Homo sapiens chromosome 8, clone RP11-193J8, comp... 40 6.9
190emb|AL596209.13| Mouse DNA sequence from clone RP23-278F12 on ch... 40 6.9
191gb|AC083943.8| Genomic sequence for Oryza sativa, Nipponbare str... 40 6.9
192dbj|AB225187.1| Aspergillus oryzae cDNA, contig sequence: AoEST2039 40 6.9
193dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026 40 6.9
194gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map ... 40 6.9
195gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic pr... 40 6.9
196gb|AY059380.1| Medicago truncatula aquaporin (PIP2-1) mRNA, comp... 40 6.9
197gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative pl... 40 6.9
198gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, ... 40 6.9
199dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
200emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Co... 40 6.9
201dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane in... 40 6.9
202dbj|AP004867.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
203dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 6.9
204dbj|AP004090.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
205emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 40 6.9
206gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic pr... 40 6.9
207emb|BX248523.8| Zebrafish DNA sequence from clone CH211-257G8 in... 40 6.9
208gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 6.9
209gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome 40 6.9
210dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome 40 6.9
211gb|U27347.1|GMU27347 Glycine max putative water channel protein ... 40 6.9
212dbj|AP003548.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 40 6.9

>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA,
            complete cds
          Length = 1283

 Score =  617 bits (311), Expect = e-173
 Identities = 465/510 (91%), Gaps = 16/510 (3%)
 Strand = Plus / Minus

                                                                        
Query: 12   cttgcttggcggattgatgatttggatagaa-ggtggcgacgttgggtcgatcatacata 70
            ||||||||| |||||||||| || ||||||| |||||||||||||| |||||||||||||
Sbjct: 1273 cttgcttggtggattgatgacttagatagaaaggtggcgacgttggatcgatcatacata 1214

                                                                        
Query: 71   tggtcgctaaattaaaaca------ggaaaaggaatgcgggctaattaagaccagcgatc 124
            ||||||||||||| ||| |      ||||||| ||||||||||||||||||| |||||||
Sbjct: 1213 tggtcgctaaatttaaatacaagtaggaaaagcaatgcgggctaattaagacaagcgatc 1154

                                                                        
Query: 125  ccatggaccgaattacaacacacggcacgcatgactgggc-acatac---gcatatgcag 180
            |||||||||||||||||| |||||||||||||||| || | || |||   ||||||||||
Sbjct: 1153 ccatggaccgaattacaagacacggcacgcatgaccggaccacgtactacgcatatgcag 1094

                                                                        
Query: 181  ctgccgacacataaattacacgaccattgcagcggcc-aactgaactgtcgagaagttgc 239
            |||||||||||||| | ||||||||||||| |||||| ||||||||||||||||||||||
Sbjct: 1093 ctgccgacacataa-taacacgaccattgcggcggccgaactgaactgtcgagaagttgc 1035

                                                                        
Query: 240  aaaagcggctttctctttggatggatggacacagcacaggtcgcccttgcttcaatcttg 299
            |||||||  ||||||| |||||||||||||||| ||| ||||||| |||||||| |||||
Sbjct: 1034 aaaagcgcatttctctctggatggatggacacaacacgggtcgccattgcttcagtcttg 975

                                                                        
Query: 300  catgcacatcacatggat---aactcgttacgcgttgctcctgaaggagccgagggcctt 356
            ||| || || ||||||||   |||| ||||||||||||||||||||||||||||||||||
Sbjct: 974  catacagatgacatggatgataacttgttacgcgttgctcctgaaggagccgagggcctt 915

                                                                        
Query: 357  gatggcgcccgccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcat 416
            ||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 914  gatggcgccggccctgaggatgtactggtggtagaaggccgcgatcgccgcgccgatcat 855

                                                                        
Query: 417  ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggc 476
            |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 854  ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 795

                                          
Query: 477  ggcccccaggctcctggccgggttgatgcc 506
            |||||||||||||| |||||||||||||||
Sbjct: 794  ggcccccaggctccgggccgggttgatgcc 765



to top

>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence
          Length = 1348

 Score =  232 bits (117), Expect = 9e-58
 Identities = 165/181 (91%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggt 385
           |||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||
Sbjct: 924 acgcgttgctcctgaaggagccgagggccttgatggcgccagcccggaggatgtactggt 865

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           |||||||||||||||| || ||||| |  | |||||| |||||||||||||| || || |
Sbjct: 864 ggtagaaggccgcgatggcagcgcccacgagggggcccacccagaagatccagtggtcgt 805

                                                                       
Query: 446 cccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgatgc 505
           |||||| |||||||||||||| |||||||||||| |||||||||||||||||||||||||
Sbjct: 804 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 745

            
Query: 506 c 506
           |
Sbjct: 744 c 744



to top

>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds
          Length = 1133

 Score =  224 bits (113), Expect = 2e-55
 Identities = 164/181 (90%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggt 385
           |||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||
Sbjct: 872 acgcgttgctcctgaaggagccgagggccttgatggcgccagcccggaggatgtactggt 813

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           |||||||||||||||| || ||||| |  |  ||||| |||||||||||||| || || |
Sbjct: 812 ggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatccagtggtcgt 753

                                                                       
Query: 446 cccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgatgc 505
           |||||| |||||||||||||| |||||||||||| |||||||||||||||||||||||||
Sbjct: 752 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 693

            
Query: 506 c 506
           |
Sbjct: 692 c 692



to top

>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete
           cds
          Length = 1171

 Score =  216 bits (109), Expect = 5e-53
 Identities = 163/181 (90%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggt 385
           ||||||||||||||||||||||||||||||||||||| || |||| ||| ||||||||||
Sbjct: 943 acgcgttgctcctgaaggagccgagggccttgatggccccagcccggaggatgtactggt 884

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           |||||||||||||||| || ||||| |  |  ||||| |||||||||||||| || || |
Sbjct: 883 ggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatccagtggtcgt 824

                                                                       
Query: 446 cccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgatgc 505
           |||||| |||||||||||||| |||||||||||| |||||||||||||||||||||||||
Sbjct: 823 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 764

            
Query: 506 c 506
           |
Sbjct: 763 c 763



to top

>gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein ZmPIP2-2 mRNA, complete
           cds
          Length = 1268

 Score =  208 bits (105), Expect = 1e-50
 Identities = 162/181 (89%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggt 385
           ||||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||
Sbjct: 996 acgcgttgctcctgaaggagccgagagccttgatggcgcccgcccggaggatgtactggt 937

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           |||||||||||||||| || ||||| |  |  ||||| |||||||| ||||| || ||||
Sbjct: 936 ggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatccagtggtcat 877

                                                                       
Query: 446 cccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgatgc 505
           |||| | |||||||||||||| || ||||||||| |||||||||||||||||||||||||
Sbjct: 876 cccatggcttgtccttgttgtagacgacggcggcgcccaggctcctggccgggttgatgc 817

            
Query: 506 c 506
           |
Sbjct: 816 c 816



to top

>gb|AY109332.1| Zea mays CL502_5 mRNA sequence
          Length = 1969

 Score =  208 bits (105), Expect = 1e-50
 Identities = 162/181 (89%)
 Strand = Plus / Minus

                                                                        
Query: 326  acgcgttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggt 385
            ||||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||
Sbjct: 1646 acgcgttgctcctgaaggagccgagagccttgatggcgcccgcccggaggatgtactggt 1587

                                                                        
Query: 386  ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
            |||||||||||||||| || ||||| |  |  ||||| |||||||| ||||| || ||||
Sbjct: 1586 ggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatccagtggtcat 1527

                                                                        
Query: 446  cccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgatgc 505
            |||| | |||||||||||||| || ||||||||| |||||||||||||||||||||||||
Sbjct: 1526 cccatggcttgtccttgttgtagacgacggcggcgcccaggctcctggccgggttgatgc 1467

             
Query: 506  c 506
            |
Sbjct: 1466 c 1466



 Score =  129 bits (65), Expect = 1e-26
 Identities = 113/129 (87%)
 Strand = Plus / Minus

                                                                       
Query: 378 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 437
           |||||||||||||  ||| ||||| || ||||||||||  ||||| ||||||||||||||
Sbjct: 321 gtactggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatcca 262

                                                                       
Query: 438 ctgatcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgg 497
            || || |||||||||||||||||||||| |||||| ||||| |||| |||||| |||||
Sbjct: 261 ttggtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaagctcctcgccgg 202

                    
Query: 498 gttgatgcc 506
           |||||||||
Sbjct: 201 gttgatgcc 193



to top

>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds
          Length = 1328

 Score =  168 bits (85), Expect = 1e-38
 Identities = 157/181 (86%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggt 385
           |||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||
Sbjct: 968 acgcgttgctcctgaaggagccgagggccttgatggcgccggcccggaggatgtactggt 909

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 908 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 849

                                                                       
Query: 446 cccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgatgc 505
            ||| ||||| || ||||||  ||||||||| || || | ||||||||||||||||||||
Sbjct: 848 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 789

            
Query: 506 c 506
           |
Sbjct: 788 c 788



to top

>ref|NM_187092.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1242

 Score =  161 bits (81), Expect = 3e-36
 Identities = 156/181 (86%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggt 385
           |||||||||||||||||||||||||||| ||||||||||| |||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                                                       
Query: 446 cccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgatgc 505
            ||| ||||| || ||||||  ||||||||| || || | ||||||||||||||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799

            
Query: 506 c 506
           |
Sbjct: 798 c 798



to top

>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1257

 Score =  161 bits (81), Expect = 3e-36
 Identities = 156/181 (86%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggt 385
           |||||||||||||||||||||||||||| ||||||||||| |||| ||| ||||||||||
Sbjct: 980 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 921

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 920 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 861

                                                                       
Query: 446 cccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgatgc 505
            ||| ||||| || ||||||  ||||||||| || || | ||||||||||||||||||||
Sbjct: 860 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 801

            
Query: 506 c 506
           |
Sbjct: 800 c 800



to top

>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1298

 Score =  161 bits (81), Expect = 3e-36
 Identities = 156/181 (86%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggt 385
           |||||||||||||||||||||||||||| ||||||||||| |||| ||| ||||||||||
Sbjct: 981 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 922

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 921 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 862

                                                                       
Query: 446 cccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgatgc 505
            ||| ||||| || ||||||  ||||||||| || || | ||||||||||||||||||||
Sbjct: 861 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 802

            
Query: 506 c 506
           |
Sbjct: 801 c 801



to top

>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full
           insert sequence
          Length = 1216

 Score =  161 bits (81), Expect = 3e-36
 Identities = 156/181 (86%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggt 385
           |||||||||||||||||||||||||||| ||||||||||| |||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                                                       
Query: 446 cccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgatgc 505
            ||| ||||| || ||||||  ||||||||| || || | ||||||||||||||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799

            
Query: 506 c 506
           |
Sbjct: 798 c 798



to top

>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full
           insert sequence
          Length = 1451

 Score =  161 bits (81), Expect = 3e-36
 Identities = 156/181 (86%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggt 385
           |||||||||||||||||||||||||||| ||||||||||| |||| ||| ||||||||||
Sbjct: 572 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 513

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 512 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 453

                                                                       
Query: 446 cccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgatgc 505
            ||| ||||| || ||||||  ||||||||| || || | ||||||||||||||||||||
Sbjct: 452 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 393

            
Query: 506 c 506
           |
Sbjct: 392 c 392



to top

>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full
           insert sequence
          Length = 1242

 Score =  161 bits (81), Expect = 3e-36
 Identities = 156/181 (86%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggt 385
           |||||||||||||||||||||||||||| ||||||||||| |||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                                                       
Query: 446 cccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgatgc 505
            ||| ||||| || ||||||  ||||||||| || || | ||||||||||||||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799

            
Query: 506 c 506
           |
Sbjct: 798 c 798



to top

>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full
           insert sequence
          Length = 1298

 Score =  161 bits (81), Expect = 3e-36
 Identities = 156/181 (86%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggt 385
           |||||||||||||||||||||||||||| ||||||||||| |||| ||| ||||||||||
Sbjct: 981 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 922

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 921 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 862

                                                                       
Query: 446 cccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgatgc 505
            ||| ||||| || ||||||  ||||||||| || || | ||||||||||||||||||||
Sbjct: 861 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 802

            
Query: 506 c 506
           |
Sbjct: 801 c 801



to top

>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full
           insert sequence
          Length = 1257

 Score =  153 bits (77), Expect = 7e-34
 Identities = 155/181 (85%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggt 385
           ||||||||||||||| |||||||||||| ||||||||||| |||| ||| ||||||||||
Sbjct: 980 acgcgttgctcctgagggagccgagggctttgatggcgccggcccggaggatgtactggt 921

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 920 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 861

                                                                       
Query: 446 cccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgatgc 505
            ||| ||||| || ||||||  ||||||||| || || | ||||||||||||||||||||
Sbjct: 860 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 801

            
Query: 506 c 506
           |
Sbjct: 800 c 800



to top

>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel
           protein, partial cds
          Length = 880

 Score =  145 bits (73), Expect = 2e-31
 Identities = 154/181 (85%)
 Strand = Plus / Minus

                                                                       
Query: 326 acgcgttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggt 385
           |||||||||||||||||||||||||||||||||||| ||| |||| ||| ||||||||||
Sbjct: 544 acgcgttgctcctgaaggagccgagggccttgatggggccggcccggaggatgtactggt 485

                                                                       
Query: 386 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 445
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 484 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccattggttgt 425

                                                                       
Query: 446 cccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgatgc 505
            ||||||||| || ||||||  ||||||||| |  ||   | ||||||||||||||||||
Sbjct: 424 gccaggccttctcgttgttgaagatgacggccggtccggtggtcctggccgggttgatgc 365

            
Query: 506 c 506
           |
Sbjct: 364 c 364



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  141 bits (71), Expect = 3e-30
 Identities = 104/115 (90%)
 Strand = Plus / Minus

                                                                            
Query: 326      acgcgttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggt 385
                |||||||||||||||||||||||||||| ||||||||||| |||| ||| ||||||||||
Sbjct: 15355852 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 15355793

                                                                       
Query: 386      ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
                ||||||| |||||||| || |||||||  |  |||||||||||||||||||||||
Sbjct: 15355792 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccactg 15355738



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                            
Query: 438      ctgatcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgg 497
                |||||||  |||||||||||  ||||||| ||  |||||| | || ||||||||||||||
Sbjct: 15306327 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 15306268

                         
Query: 498      gttgatgcc 506
                |||||||||
Sbjct: 15306267 gttgatgcc 15306259



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 381      ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
                ||||||||| |  |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 15316534 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 15316475



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 381      ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
                ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 15306498 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 15306439



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                               
Query: 460      ttgttgtggatgacggcggcccccaggctcctggccgggttgatgcc 506
                ||||||| || ||||||||| || |||||||| ||||||||||||||
Sbjct: 15324236 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgcc 15324190



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                               
Query: 460      ttgttgtggatgacggcggcccccaggctcctggccgggttgatgcc 506
                |||||||  ||||||||||| || |||||||| ||||||||||||||
Sbjct: 15316356 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgcc 15316310



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                        
Query: 451      gccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgatgcc 506
                ||||| || ||||||  ||||||||| || || | |||||||||||||||||||||
Sbjct: 15355603 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgcc 15355548



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                            
Query: 397      gcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
                ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 15324431 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 15324388



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 325      tacgcgttgctcctgaaggagccg 348
                ||||||||||||| ||||||||||
Sbjct: 15306551 tacgcgttgctccggaaggagccg 15306528



to top

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score =  141 bits (71), Expect = 3e-30
 Identities = 104/115 (90%)
 Strand = Plus / Minus

                                                                         
Query: 326   acgcgttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggt 385
             |||||||||||||||||||||||||||| ||||||||||| |||| ||| ||||||||||
Sbjct: 62851 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 62792

                                                                    
Query: 386   ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
             ||||||| |||||||| || |||||||  |  |||||||||||||||||||||||
Sbjct: 62791 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccactg 62737



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                         
Query: 438   ctgatcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgg 497
             |||||||  |||||||||||  ||||||| ||  |||||| | || ||||||||||||||
Sbjct: 13326 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 13267

                      
Query: 498   gttgatgcc 506
             |||||||||
Sbjct: 13266 gttgatgcc 13258



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 381   ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
             ||||||||| |  |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 23533 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 23474



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 381   ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
             ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 13497 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 13438



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 460   ttgttgtggatgacggcggcccccaggctcctggccgggttgatgcc 506
             ||||||| || ||||||||| || |||||||| ||||||||||||||
Sbjct: 31235 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgcc 31189



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 460   ttgttgtggatgacggcggcccccaggctcctggccgggttgatgcc 506
             |||||||  ||||||||||| || |||||||| ||||||||||||||
Sbjct: 23355 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgcc 23309



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                     
Query: 451   gccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgatgcc 506
             ||||| || ||||||  ||||||||| || || | |||||||||||||||||||||
Sbjct: 62602 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgcc 62547



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                         
Query: 397   gcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
             ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 31430 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 31387



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 325   tacgcgttgctcctgaaggagccg 348
             ||||||||||||| ||||||||||
Sbjct: 13550 tacgcgttgctccggaaggagccg 13527



to top

>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete
           cds
          Length = 1171

 Score =  129 bits (65), Expect = 1e-26
 Identities = 113/129 (87%)
 Strand = Plus / Minus

                                                                       
Query: 378 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 437
           |||||||||||||  ||| ||||| || ||||| ||||  ||||| ||||||||||||||
Sbjct: 903 gtactggtggtaggcggcggcgatggcggcgccaatcagtgggcccacccagaagatcca 844

                                                                       
Query: 438 ctgatcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgg 497
            || || |||||||||||||||||||||| |||||| ||||| ||||||||||| |||||
Sbjct: 843 ttggtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaggctcctcgccgg 784

                    
Query: 498 gttgatgcc 506
           |||||||||
Sbjct: 783 gttgatgcc 775



to top

>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete
           cds
          Length = 1156

 Score =  129 bits (65), Expect = 1e-26
 Identities = 113/129 (87%)
 Strand = Plus / Minus

                                                                       
Query: 378 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 437
           |||||||||||||  ||| ||||| || ||||||||||  ||||| ||||||||||||||
Sbjct: 893 gtactggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatcca 834

                                                                       
Query: 438 ctgatcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgg 497
            || || |||||||||||||||||||||| |||||| ||||| |||| |||||| |||||
Sbjct: 833 ttggtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaagctcctcgccgg 774

                    
Query: 498 gttgatgcc 506
           |||||||||
Sbjct: 773 gttgatgcc 765



to top

>ref|XM_466869.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1214

 Score =  121 bits (61), Expect = 2e-24
 Identities = 112/129 (86%)
 Strand = Plus / Minus

                                                                       
Query: 378 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 437
           |||||||||||||  ||| ||||| || |||||||||| |||||| ||||||||||||||
Sbjct: 883 gtactggtggtaggcggcggcgatggcggcgccgatcagggggcccacccagaagatcca 824

                                                                       
Query: 438 ctgatcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgg 497
            || ||||||||||||||||||||||||| ||| || ||||  |||| |||||| |||||
Sbjct: 823 ttggtcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgg 764

                    
Query: 498 gttgatgcc 506
           ||| |||||
Sbjct: 763 gttaatgcc 755



to top

>dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E03, full
           insert sequence
          Length = 1214

 Score =  121 bits (61), Expect = 2e-24
 Identities = 112/129 (86%)
 Strand = Plus / Minus

                                                                       
Query: 378 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 437
           |||||||||||||  ||| ||||| || |||||||||| |||||| ||||||||||||||
Sbjct: 883 gtactggtggtaggcggcggcgatggcggcgccgatcagggggcccacccagaagatcca 824

                                                                       
Query: 438 ctgatcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgg 497
            || ||||||||||||||||||||||||| ||| || ||||  |||| |||||| |||||
Sbjct: 823 ttggtcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgg 764

                    
Query: 498 gttgatgcc 506
           ||| |||||
Sbjct: 763 gttaatgcc 755



to top

>gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence
          Length = 1215

 Score =  113 bits (57), Expect = 6e-22
 Identities = 111/129 (86%)
 Strand = Plus / Minus

                                                                       
Query: 378 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 437
           |||||||||||||  ||| ||||| || ||||| ||||  || || ||||||||||||||
Sbjct: 911 gtactggtggtaggcggcggcgatggcggcgccaatcagtggacccacccagaagatcca 852

                                                                       
Query: 438 ctgatcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgg 497
            || || |||||||||||||||||||||| |||||| ||||| |||||| |||| |||||
Sbjct: 851 ttggtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaggatcctcgccgg 792

                    
Query: 498 gttgatgcc 506
           |||||||||
Sbjct: 791 gttgatgcc 783



to top

>ref|NM_187081.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1215

 Score =  107 bits (54), Expect = 4e-20
 Identities = 108/126 (85%)
 Strand = Plus / Minus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 901 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 842

                                                                       
Query: 441 atcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggtt 500
           ||||  |||||||||||  ||||||| ||  |||||| | || |||||||||||||||||
Sbjct: 841 atcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggtt 782

                 
Query: 501 gatgcc 506
           ||||||
Sbjct: 781 gatgcc 776



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 325 tacgcgttgctcctgaaggagccg 348
           ||||||||||||| ||||||||||
Sbjct: 954 tacgcgttgctccggaaggagccg 931



to top

>dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132K03, full
           insert sequence
          Length = 1215

 Score =  107 bits (54), Expect = 4e-20
 Identities = 108/126 (85%)
 Strand = Plus / Minus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 901 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 842

                                                                       
Query: 441 atcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggtt 500
           ||||  |||||||||||  ||||||| ||  |||||| | || |||||||||||||||||
Sbjct: 841 atcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggtt 782

                 
Query: 501 gatgcc 506
           ||||||
Sbjct: 781 gatgcc 776



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 325 tacgcgttgctcctgaaggagccg 348
           ||||||||||||| ||||||||||
Sbjct: 954 tacgcgttgctccggaaggagccg 931



to top

>gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           complete cds
          Length = 1235

 Score =  105 bits (53), Expect = 1e-19
 Identities = 110/129 (85%)
 Strand = Plus / Minus

                                                                       
Query: 378 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 437
           |||||||||||||  ||| ||||| || ||||||||||  || || ||||||||||||||
Sbjct: 857 gtactggtggtaggcggcggcgatggcggcgccgatcagcggccccacccagaagatcca 798

                                                                       
Query: 438 ctgatcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgg 497
            || ||||||||||||||||| ||||||| |||||| || || |||| ||| || |||||
Sbjct: 797 ttggtcatcccaggccttgtctttgttgtagatgacagcagctcccaagcttctcgccgg 738

                    
Query: 498 gttgatgcc 506
           |||||||||
Sbjct: 737 gttgatgcc 729



to top

>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds
          Length = 1104

 Score =  101 bits (51), Expect = 2e-18
 Identities = 75/83 (90%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           |||||||||||||| || ||||||||||||||||| ||||||| |||||| || || |||
Sbjct: 761 acccagaagatccagtggtcatcccaggccttgtcgttgttgtagatgacagcagcgccc 702

                                  
Query: 484 aggctcctggccgggttgatgcc 506
           | |||||||||||||||||||||
Sbjct: 701 aagctcctggccgggttgatgcc 679



to top

>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete
           cds
          Length = 1207

 Score =  101 bits (51), Expect = 2e-18
 Identities = 75/83 (90%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           |||||||||||||| || ||||||||||||||||| ||||||| |||||| || || |||
Sbjct: 816 acccagaagatccagtggtcatcccaggccttgtcgttgttgtagatgacagcagcgccc 757

                                  
Query: 484 aggctcctggccgggttgatgcc 506
           | |||||||||||||||||||||
Sbjct: 756 aagctcctggccgggttgatgcc 734



to top

>gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-1
           (PIP2-1) mRNA, complete cds
          Length = 1300

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 140/172 (81%)
 Strand = Plus / Minus

                                                                       
Query: 332 tgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggtggtaga 391
           |||||||||| || || || |||||||| || || || || | |||| ||||||||||||
Sbjct: 912 tgctcctgaatgacccaagagccttgatagctccagctctcaatatgaactggtggtaga 853

                                                                       
Query: 392 aggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccagg 451
           |||| || || || || || || | ||| || ||||| ||||||||||| ||||||||||
Sbjct: 852 aggctgcaatggctgcaccaatgaagggtccaacccaaaagatccactggtcatcccagg 793

                                                               
Query: 452 ccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgat 503
           |||| || ||||||| ||| || || |||||||  |||||||| ||||||||
Sbjct: 792 ccttctcattgttgtagataacagcagcccccaaactcctggcagggttgat 741



to top

>gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1) mRNA, complete
           cds
          Length = 480

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 140/172 (81%)
 Strand = Plus / Minus

                                                                       
Query: 332 tgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggtggtaga 391
           |||||||||| || || || |||||||| || || || || | |||| ||||||||||||
Sbjct: 466 tgctcctgaatgacccaagagccttgatagctccagctctcaatatgaactggtggtaga 407

                                                                       
Query: 392 aggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccagg 451
           |||| || || || || || || | ||| || ||||| ||||||||||| ||||||||||
Sbjct: 406 aggctgcaatggctgcaccaatgaagggtccaacccaaaagatccactggtcatcccagg 347

                                                               
Query: 452 ccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgat 503
           |||| || ||||||| ||| || || |||||||  |||||||| ||||||||
Sbjct: 346 ccttctcattgttgtagataacagcagcccccaaactcctggcagggttgat 295



to top

>ref|NM_187084.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 852

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 93/110 (84%)
 Strand = Plus / Minus

                                                                       
Query: 397 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 456
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 782 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 723

                                                             
Query: 457 tccttgttgtggatgacggcggcccccaggctcctggccgggttgatgcc 506
              ||||||| || ||||||||| || |||||||| ||||||||||||||
Sbjct: 722 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgcc 673



to top

>ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group), P0475E07.134 mRNA
          Length = 619

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 93/110 (84%)
 Strand = Plus / Minus

                                                                       
Query: 397 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 456
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 340 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 281

                                                             
Query: 457 tccttgttgtggatgacggcggcccccaggctcctggccgggttgatgcc 506
              ||||||| || ||||||||| || |||||||| ||||||||||||||
Sbjct: 280 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgcc 231



to top

>dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-132-C10, full
           insert sequence
          Length = 618

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 93/110 (84%)
 Strand = Plus / Minus

                                                                       
Query: 397 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 456
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 339 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 280

                                                             
Query: 457 tccttgttgtggatgacggcggcccccaggctcctggccgggttgatgcc 506
              ||||||| || ||||||||| || |||||||| ||||||||||||||
Sbjct: 279 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgcc 230



to top

>gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds
          Length = 1216

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 107/129 (82%)
 Strand = Plus / Minus

                                                                       
Query: 375 tatgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagat 434
           |||| |||||||||||||||| || || || || || || | ||| || ||||| |||||
Sbjct: 873 tatgaactggtggtagaaggctgcaatggctgcaccaatgaagggtccaacccaaaagat 814

                                                                       
Query: 435 ccactgatcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggc 494
           |||||| |||||||||||||| || ||||||| ||| || || |||||||  ||||||||
Sbjct: 813 ccactggtcatcccaggccttctcattgttgtagataacagcagcccccaaactcctggc 754

                    
Query: 495 cgggttgat 503
            ||||||||
Sbjct: 753 agggttgat 745



to top

>ref|XM_473219.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 873

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 107/129 (82%)
 Strand = Plus / Minus

                                                                       
Query: 378 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 437
           |||||||||||||  ||| ||||| || |||||||| | ||| || ||||||||||||||
Sbjct: 819 gtactggtggtaggcggcggcgatggcggcgccgatgaggggccccacccagaagatcca 760

                                                                       
Query: 438 ctgatcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgg 497
            || |||| ||| ||||||| || ||||| ||| || || || |||| |||||| |||||
Sbjct: 759 gtggtcatgccatgccttgtgctggttgtagatcaccgcagctcccaagctccttgccgg 700

                    
Query: 498 gttgatgcc 506
           |||||||||
Sbjct: 699 gttgatgcc 691



to top

>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete
           cds
          Length = 1343

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 107/129 (82%)
 Strand = Plus / Minus

                                                                       
Query: 378 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 437
           |||||||||||| ||||| ||||| || || ||||| |  || || |||||||| |||||
Sbjct: 889 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 830

                                                                       
Query: 438 ctgatcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgg 497
            || |||||||||||||| || ||||||| ||| ||||| || || | |||||| |||||
Sbjct: 829 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgg 770

                    
Query: 498 gttgatgcc 506
           |||||||||
Sbjct: 769 gttgatgcc 761



to top

>dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin, complete cds
          Length = 1318

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 106/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 379 tactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccac 438
           ||||||||||||  ||| || || || ||||||||||  || || |||||||||||||| 
Sbjct: 944 tactggtggtaggcggcggcaatggcggcgccgatcagtggccccacccagaagatccat 885

                                                                       
Query: 439 tgatcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccggg 498
           || |||||||||||||||||  |||||| |||||| || || |||| ||| || || |||
Sbjct: 884 tggtcatcccaggccttgtcagtgttgtagatgacagcagctcccaagcttctcgcgggg 825

                   
Query: 499 ttgatgcc 506
           ||||||||
Sbjct: 824 ttgatgcc 817



to top

>dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd
          Length = 1251

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 106/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 379 tactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccac 438
           ||||||||||||  ||| || || || ||||||||||  || || |||||||||||||| 
Sbjct: 864 tactggtggtaggcggcggcaatggcggcgccgatcagtggccccacccagaagatccat 805

                                                                       
Query: 439 tgatcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccggg 498
           || |||||||||||||||||  |||||| |||||| || || |||| ||| || || |||
Sbjct: 804 tggtcatcccaggccttgtcagtgttgtagatgacagcagctcccaagcttctcgcgggg 745

                   
Query: 499 ttgatgcc 506
           ||||||||
Sbjct: 744 ttgatgcc 737



to top

>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS
          Length = 1139

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           |||||||||||||| || |||| |||||| | ||||||||||| ||||| ||| || || 
Sbjct: 812 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 753

                                  
Query: 484 aggctcctggccgggttgatgcc 506
           ||||||||||| |||||||||||
Sbjct: 752 aggctcctggctgggttgatgcc 730



to top

>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full
           insert sequence
          Length = 1128

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           |||||||||||||| || |||| |||||| | ||||||||||| ||||| ||| || || 
Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786

                                  
Query: 484 aggctcctggccgggttgatgcc 506
           ||||||||||| |||||||||||
Sbjct: 785 aggctcctggctgggttgatgcc 763



to top

>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full
           insert sequence
          Length = 1205

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           |||||||||||||| || |||| |||||| | ||||||||||| ||||| ||| || || 
Sbjct: 900 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 841

                                  
Query: 484 aggctcctggccgggttgatgcc 506
           ||||||||||| |||||||||||
Sbjct: 840 aggctcctggctgggttgatgcc 818



to top

>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full
           insert sequence
          Length = 1136

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           |||||||||||||| || |||| |||||| | ||||||||||| ||||| ||| || || 
Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786

                                  
Query: 484 aggctcctggccgggttgatgcc 506
           ||||||||||| |||||||||||
Sbjct: 785 aggctcctggctgggttgatgcc 763



to top

>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1140

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           |||||||||||||| || |||| |||||| | ||||||||||| ||||| ||| || || 
Sbjct: 840 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 781

                                  
Query: 484 aggctcctggccgggttgatgcc 506
           ||||||||||| |||||||||||
Sbjct: 780 aggctcctggctgggttgatgcc 758



to top

>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel
           protein, complete cds
          Length = 1116

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           |||||||||||||| || |||| |||||| | ||||||||||| ||||| ||| || || 
Sbjct: 843 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 784

                                  
Query: 484 aggctcctggccgggttgatgcc 506
           ||||||||||| |||||||||||
Sbjct: 783 aggctcctggctgggttgatgcc 761



to top

>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence
          Length = 698

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 104/126 (82%)
 Strand = Plus / Minus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 397 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 338

                                                                       
Query: 441 atcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggtt 500
            ||| ||||||| | || || |||||  || |||||||| || |||||||  || |||||
Sbjct: 337 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 278

                 
Query: 501 gatgcc 506
           ||||||
Sbjct: 277 gatgcc 272



to top

>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 104/126 (82%)
 Strand = Plus / Minus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 828 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 769

                                                                       
Query: 441 atcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggtt 500
            ||| ||||||| | || || |||||  || |||||||| || |||||||  || |||||
Sbjct: 768 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 709

                 
Query: 501 gatgcc 506
           ||||||
Sbjct: 708 gatgcc 703



to top

>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 104/126 (82%)
 Strand = Plus / Minus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 885 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 826

                                                                       
Query: 441 atcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggtt 500
            ||| ||||||| | || || |||||  || |||||||| || |||||||  || |||||
Sbjct: 825 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 766

                 
Query: 501 gatgcc 506
           ||||||
Sbjct: 765 gatgcc 760



to top

>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 104/126 (82%)
 Strand = Plus / Minus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 898 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 839

                                                                       
Query: 441 atcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggtt 500
            ||   |||||| |  ||| |||||| ||||| ||| || || |||||||| ||||||||
Sbjct: 838 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 779

                 
Query: 501 gatgcc 506
           ||||||
Sbjct: 778 gatgcc 773



to top

>gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-2
           (PIP2-2) mRNA, complete cds
          Length = 1171

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggcc 480
           |||||||||||||||||||| || |||||  | || || ||||||| |||||||||||| 
Sbjct: 787 ccgacccagaagatccactggtcgtcccaaactttttcattgttgtagatgacggcggcg 728

                                     
Query: 481 cccaggctcctggccgggttgatgcc 506
           || | ||||||||| |||||||||||
Sbjct: 727 ccgaagctcctggcggggttgatgcc 702



to top

>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds
          Length = 1147

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 417 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggc 476
           |||||| |||||||||||||| || |||| |||||| | |||| |||||| ||||| |||
Sbjct: 877 ggggcccacccagaagatccaatggtcattccaggcatggtccctgttgtagatgatggc 818

                                         
Query: 477 ggcccccaggctcctggccgggttgatgcc 506
            ||||| |||||||| || |||||||||||
Sbjct: 817 agccccaaggctcctagctgggttgatgcc 788



to top

>ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channel AT2G39010
           (PIP2;6/PIP2E) mRNA, complete cds
          Length = 1245

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                   
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggc 476
           ||||||||||||||||||||||||||||| ||||| |  ||||||| |||||||||
Sbjct: 845 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggc 790



to top

>gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 1201

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                   
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggc 476
           ||||||||||||||||||||||||||||| ||||| |  ||||||| |||||||||
Sbjct: 840 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggc 785



to top

>gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 870

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                   
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggc 476
           ||||||||||||||||||||||||||||| ||||| |  ||||||| |||||||||
Sbjct: 758 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggc 703



to top

>gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 1169

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                   
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggc 476
           ||||||||||||||||||||||||||||| ||||| |  ||||||| |||||||||
Sbjct: 842 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggc 787



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                            
Query: 378      gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 437
                |||||||||||||  ||| ||||| || |||||||||| |||||| ||||||||||||||
Sbjct: 25184664 gtactggtggtaggcggcggcgatggcggcgccgatcagggggcccacccagaagatcca 25184605

                    
Query: 438      ctga 441
                ||||
Sbjct: 25184604 ctga 25184601



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                            
Query: 442      tcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttg 501
                ||||||||||||||||||||||||| ||| || ||||  |||| |||||| |||||||| 
Sbjct: 25184038 tcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggtta 25183979

                     
Query: 502      atgcc 506
                |||||
Sbjct: 25183978 atgcc 25183974



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                            
Query: 442      tcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttg 501
                |||| |||||| | ||||||||||| ||||| ||| || || ||||||||||| ||||||
Sbjct: 27065064 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 27065005

                     
Query: 502      atgcc 506
                |||||
Sbjct: 27065004 atgcc 27065000



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 79     aaattaaaacaggaaaagga 98
              ||||||||||||||||||||
Sbjct: 751943 aaattaaaacaggaaaagga 751962



to top

>emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB75ZE10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1128

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                   
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggc 476
           ||||||||||||||||||||||||||||| ||||| |  ||||||| |||||||||
Sbjct: 819 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggc 764



to top

>emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS74ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1160

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                   
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggc 476
           ||||||||||||||||||||||||||||| ||||| |  ||||||| |||||||||
Sbjct: 829 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggc 774



to top

>dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1469H02
          Length = 136602

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                         
Query: 378   gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 437
             |||||||||||||  ||| ||||| || |||||||||| |||||| ||||||||||||||
Sbjct: 85057 gtactggtggtaggcggcggcgatggcggcgccgatcagggggcccacccagaagatcca 84998

                 
Query: 438   ctga 441
             ||||
Sbjct: 84997 ctga 84994



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                         
Query: 442   tcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttg 501
             ||||||||||||||||||||||||| ||| || ||||  |||| |||||| |||||||| 
Sbjct: 84431 tcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggtta 84372

                  
Query: 502   atgcc 506
             |||||
Sbjct: 84371 atgcc 84367



to top

>gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water channel protein MipH (MipH)
           mRNA, complete cds
          Length = 1347

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                       
Query: 376 atgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatc 435
           ||||| |||||||||| ||| ||||| || || || || |  || ||||||||||| |||
Sbjct: 890 atgtattggtggtagatggcggcgatggcagccccaatgaacggtccgacccagaaaatc 831

                                          
Query: 436 cactgatcatcccaggccttgtccttgttgt 466
           ||||||||||||||||||||||  |||||||
Sbjct: 830 cactgatcatcccaggccttgttgttgttgt 800



to top

>gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasma membrane
           intrinsic protein mRNA, complete cds
          Length = 1120

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgt 466
           ||||||||||||||||| |||||||| ||||||||||||||||
Sbjct: 746 acccagaagatccactggtcatcccatgccttgtccttgttgt 704



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 331 ttgctcctgaaggagccgagggccttgatggc 362
           |||||||||||||| ||||| |||||||||||
Sbjct: 839 ttgctcctgaaggatccgagagccttgatggc 808



to top

>ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channel AT4G23400
           (PIP1;5/PIP1D) mRNA, complete cds
          Length = 1128

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggcc 480
           ||||||||||||||||| || |||||||| || |  |||||||||| ||||| ||| || 
Sbjct: 834 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 775

                                     
Query: 481 cccaggctcctggccgggttgatgcc 506
           || || |||||||||||||| |||||
Sbjct: 774 ccgagactcctggccgggttaatgcc 749



to top

>ref|XM_473480.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 76/90 (84%)
 Strand = Plus / Minus

                                                                       
Query: 417 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggc 476
           |||||| |||||||||||||| || ||||||||||| | | || |||||| ||||| |||
Sbjct: 774 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 715

                                         
Query: 477 ggcccccaggctcctggccgggttgatgcc 506
            || || |||||||| || |||||||||||
Sbjct: 714 agcgccaaggctcctcgctgggttgatgcc 685



to top

>gb|AY081593.1| Arabidopsis thaliana water channel-like protein (At4g23400) mRNA,
           complete cds
          Length = 956

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggcc 480
           ||||||||||||||||| || |||||||| || |  |||||||||| ||||| ||| || 
Sbjct: 785 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 726

                                     
Query: 481 cccaggctcctggccgggttgatgcc 506
           || || |||||||||||||| |||||
Sbjct: 725 ccgagactcctggccgggttaatgcc 700



to top

>gb|AY059948.1| Arabidopsis thaliana water channel - like protein (At4g23400;
           F16G20.100) mRNA, complete cds
          Length = 1125

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggcc 480
           ||||||||||||||||| || |||||||| || |  |||||||||| ||||| ||| || 
Sbjct: 834 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 775

                                     
Query: 481 cccaggctcctggccgggttgatgcc 506
           || || |||||||||||||| |||||
Sbjct: 774 ccgagactcctggccgggttaatgcc 749



to top

>dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - like protein, partial
           cds, clone: RAFL24-17-A12
          Length = 392

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggcc 480
           ||||||||||||||||| || |||||||| || |  |||||||||| ||||| ||| || 
Sbjct: 90  ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 31

                                     
Query: 481 cccaggctcctggccgggttgatgcc 506
           || || |||||||||||||| |||||
Sbjct: 30  ccgagactcctggccgggttaatgcc 5



to top

>emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB41ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 454

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggcc 480
           ||||||||||||||||| || |||||||| || |  |||||||||| ||||| ||| || 
Sbjct: 158 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 99

                                     
Query: 481 cccaggctcctggccgggttgatgcc 506
           || || |||||||||||||| |||||
Sbjct: 98  ccgagactcctggccgggttaatgcc 73



to top

>emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB51ZF11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 710

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggcc 480
           ||||||||||||||||| || |||||||| || |  |||||||||| ||||| ||| || 
Sbjct: 417 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 358

                                     
Query: 481 cccaggctcctggccgggttgatgcc 506
           || || |||||||||||||| |||||
Sbjct: 357 ccgagactcctggccgggttaatgcc 332



to top

>emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS16ZB08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1066

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggcc 480
           ||||||||||||||||| || |||||||| || |  |||||||||| ||||| ||| || 
Sbjct: 823 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 764

                                     
Query: 481 cccaggctcctggccgggttgatgcc 506
           || || |||||||||||||| |||||
Sbjct: 763 ccgagactcctggccgggttaatgcc 738



to top

>emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS21ZB06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggcc 480
           ||||||||||||||||| || |||||||| || |  |||||||||| ||||| ||| || 
Sbjct: 798 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 739

                                     
Query: 481 cccaggctcctggccgggttgatgcc 506
           || || |||||||||||||| |||||
Sbjct: 738 ccgagactcctggccgggttaatgcc 713



to top

>gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete sequence
          Length = 1089

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggcc 480
           ||||||||||||||||| || |||||||| || |  |||||||||| ||||| ||| || 
Sbjct: 832 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 773

                                     
Query: 481 cccaggctcctggccgggttgatgcc 506
           || || |||||||||||||| |||||
Sbjct: 772 ccgagactcctggccgggttaatgcc 747



to top

>gb|AY170841.1| Axonopus compressus plasma membrane MIP protein mRNA, partial cds
          Length = 423

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 103/126 (81%)
 Strand = Plus / Minus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||||| ||| || |  || ||||| || | ||||||||||||||||||||| ||
Sbjct: 384 ctggtggtagatggcggctagggcagcgccaatgaaggggccgacccagaagatccaatg 325

                                                                       
Query: 441 atcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggtt 500
            |||| |||||| |  ||| |||||| ||||| ||| || || |||||||| || |||||
Sbjct: 324 gtcattccaggcgtgctccctgttgtagatgatggcagcgccaaggctcctagctgggtt 265

                 
Query: 501 gatgcc 506
           ||||||
Sbjct: 264 gatgcc 259



to top

>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full
           insert sequence
          Length = 1163

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 76/90 (84%)
 Strand = Plus / Minus

                                                                       
Query: 417 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggc 476
           |||||| |||||||||||||| || ||||||||||| | | || |||||| ||||| |||
Sbjct: 851 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 792

                                         
Query: 477 ggcccccaggctcctggccgggttgatgcc 506
            || || |||||||| || |||||||||||
Sbjct: 791 agcgccaaggctcctcgctgggttgatgcc 762



to top

>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full
           insert sequence
          Length = 1164

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 103/126 (81%)
 Strand = Plus / Minus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||||| ||| || |  || ||||| || | |||||| |||||||||||||| ||
Sbjct: 888 ctggtggtagatggcagcaagggcagcgccaatgaaggggccaacccagaagatccaatg 829

                                                                       
Query: 441 atcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggtt 500
            ||||||||||| | | || |||||| ||||| ||| || || |||||||| || |||||
Sbjct: 828 gtcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggtt 769

                 
Query: 501 gatgcc 506
           ||||||
Sbjct: 768 gatgcc 763



to top

>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full
           insert sequence
          Length = 1167

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 76/90 (84%)
 Strand = Plus / Minus

                                                                       
Query: 417 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggc 476
           |||||| |||||||||||||| || ||||||||||| | | || |||||| ||||| |||
Sbjct: 854 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 795

                                         
Query: 477 ggcccccaggctcctggccgggttgatgcc 506
            || || |||||||| || |||||||||||
Sbjct: 794 agcgccaaggctcctcgctgggttgatgcc 765



to top

>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full
            insert sequence
          Length = 1462

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 76/90 (84%)
 Strand = Plus / Minus

                                                                        
Query: 417  ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggc 476
            |||||| |||||||||||||| || ||||||||||| | | || |||||| ||||| |||
Sbjct: 1150 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 1091

                                          
Query: 477  ggcccccaggctcctggccgggttgatgcc 506
             || || |||||||| || |||||||||||
Sbjct: 1090 agcgccaaggctcctcgctgggttgatgcc 1061



to top

>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin
          Length = 1291

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                        
Query: 381  ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
            ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||||||
Sbjct: 1291 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccactg 1232



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 461 tgttgtggatgacggcggcccccaggctcctggccgggttgatgcc 506
           |||||| ||||| ||| || || |||||||| ||||||||||||||
Sbjct: 657 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgcc 612



to top

>gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds
          Length = 534

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           |||||||| ||||| || ||||||||||| |  |||||||||| |||||  ||||| || 
Sbjct: 458 acccagaatatccaatgttcatcccaggcttgatccttgttgtagatgattgcggcacca 399

                               
Query: 484 aggctcctggccgggttgat 503
           ||||||||||| ||||||||
Sbjct: 398 aggctcctggcggggttgat 379



to top

>gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, complete cds
          Length = 867

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           |||||||| ||||| || ||||||||||| |  |||||||||| |||||  ||||| || 
Sbjct: 788 acccagaatatccaatgttcatcccaggcttgatccttgttgtagatgattgcggcacca 729

                               
Query: 484 aggctcctggccgggttgat 503
           ||||||||||| ||||||||
Sbjct: 728 aggctcctggcggggttgat 709



to top

>emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.4 gene)
          Length = 1135

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           |||||||||||||| || |  |||||||||||||| | ||||| ||| || ||||| |||
Sbjct: 771 acccagaagatccagtggtggtcccaggccttgtcttggttgtagataacagcggctccc 712

                                  
Query: 484 aggctcctggccgggttgatgcc 506
           || ||||| || |||||||||||
Sbjct: 711 agactcctagcagggttgatgcc 689



to top

>emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.2 gene)
          Length = 978

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           |||||||| ||||| |||||||||||||| || || ||||||  |||||| || || || 
Sbjct: 826 acccagaaaatccaatgatcatcccaggctttttcattgttgaagatgacagcagcgcca 767

                                  
Query: 484 aggctcctggccgggttgatgcc 506
           | ||||||||| |||||||||||
Sbjct: 766 aagctcctggcagggttgatgcc 744



to top

>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1
           (PIP1-1) mRNA, complete cds
          Length = 1115

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           |||||||||||||| || || ||||| || | ||||||||||| ||||| ||| || |||
Sbjct: 810 acccagaagatccagtggtcgtcccatgcgtggtccttgttgtagatgatggccgcaccc 751

                                  
Query: 484 aggctcctggccgggttgatgcc 506
           |||||||  || |||||||||||
Sbjct: 750 aggctccgagctgggttgatgcc 728



to top

>gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein ZmPIP2-6 mRNA, complete
           cds
          Length = 1257

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 397 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 456
           ||||||||||| ||||| |  ||||| ||||||||||||||||| ||   |||||| |||
Sbjct: 884 gcgatcgccgctccgatgaacgggcccacccagaagatccactggtcgctccaggctttg 825

                                                          
Query: 457 tccttgttgtggatgacggcggcccccaggctcctggccgggttgat 503
              |||||||  | ||||||||| || |||||||| |||||||||||
Sbjct: 824 ctgttgttgtacacgacggcggcgccgaggctcctcgccgggttgat 778



to top

>gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, complete cds
          Length = 901

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggcc 480
           ||||||||||| ||||| || ||||||||||||||||| ||||| | |||||| || || 
Sbjct: 771 ccgacccagaacatccaatggtcatcccaggccttgtcgttgttatagatgacagcagct 712

                                  
Query: 481 cccaggctcctggccgggttgat 503
           || | ||| || |||||||||||
Sbjct: 711 ccgaagcttctagccgggttgat 689



to top

>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 100/123 (81%)
 Strand = Plus / Minus

                                                                       
Query: 384 gtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatc 443
           ||||||||  ||||| | |||||||||||| |  || || |||||||||||||| || ||
Sbjct: 914 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 855

                                                                       
Query: 444 atcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgat 503
            ||||| ||||  | |||||||| ||||| |||||| || |||  ||| |||||||||||
Sbjct: 854 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 795

              
Query: 504 gcc 506
           |||
Sbjct: 794 gcc 792



to top

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 100/123 (81%)
 Strand = Plus / Minus

                                                                       
Query: 384 gtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatc 443
           |||||||| |||||| | |||||| ||||| |  || || |||||||||||||| || ||
Sbjct: 899 gtggtagatggccgccagcgccgcaccgatgaacggaccaacccagaagatccagtggtc 840

                                                                       
Query: 444 atcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgat 503
            ||||| ||||  | |||||||| ||||| |||||| || |||  ||| |||||||||||
Sbjct: 839 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 780

              
Query: 504 gcc 506
           |||
Sbjct: 779 gcc 777



to top

>ref|XM_475029.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                       
Query: 425 cccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccca 484
           ||||||||||||| || || ||||| ||||| | || ||||| |||||||||||| || |
Sbjct: 742 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 683

                                 
Query: 485 ggctcctggccgggttgatgcc 506
            ||||| ||| |||||||||||
Sbjct: 682 tgctccgggcagggttgatgcc 661



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 330 gttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggtg 386
           |||||||| ||||||||| || |||||||||||  |||||| ||| |||||||||||
Sbjct: 837 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 781



to top

>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete
           cds
          Length = 1153

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 102/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||| ||
Sbjct: 940 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 881

                                                                       
Query: 441 atcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggtt 500
            ||   ||| || |  |||  ||||| ||||| |||||| || |||||||| ||||||||
Sbjct: 880 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 821

                 
Query: 501 gatgcc 506
           ||||||
Sbjct: 820 gatgcc 815



to top

>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete
           cds
          Length = 1296

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 102/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||| ||
Sbjct: 935 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 876

                                                                       
Query: 441 atcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggtt 500
            ||   ||| || |  |||  ||||| ||||| |||||| || |||||||| ||||||||
Sbjct: 875 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 816

                 
Query: 501 gatgcc 506
           ||||||
Sbjct: 815 gatgcc 810



to top

>dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-B01, full
           insert sequence
          Length = 1067

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                       
Query: 425 cccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccca 484
           ||||||||||||| || || ||||| ||||| | || ||||| |||||||||||| || |
Sbjct: 728 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 669

                                 
Query: 485 ggctcctggccgggttgatgcc 506
            ||||| ||| |||||||||||
Sbjct: 668 tgctccgggcagggttgatgcc 647



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 332 tgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggtg 386
           |||||| ||||||||| || |||||||||||  |||||| ||| |||||||||||
Sbjct: 821 tgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 767



to top

>dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086E18, full
           insert sequence
          Length = 1308

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                       
Query: 425 cccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccca 484
           ||||||||||||| || || ||||| ||||| | || ||||| |||||||||||| || |
Sbjct: 841 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 782

                                 
Query: 485 ggctcctggccgggttgatgcc 506
            ||||| ||| |||||||||||
Sbjct: 781 tgctccgggcagggttgatgcc 760



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 330 gttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggtg 386
           |||||||| ||||||||| || |||||||||||  |||||| ||| |||||||||||
Sbjct: 936 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 880



to top

>dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-B05, full
           insert sequence
          Length = 1309

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                       
Query: 425 cccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccca 484
           ||||||||||||| || || ||||| ||||| | || ||||| |||||||||||| || |
Sbjct: 835 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 776

                                 
Query: 485 ggctcctggccgggttgatgcc 506
            ||||| ||| |||||||||||
Sbjct: 775 tgctccgggcagggttgatgcc 754



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 330 gttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggtg 386
           |||||||| ||||||||| || |||||||||||  |||||| ||| |||||||||||
Sbjct: 930 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 874



to top

>dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-B10, full
           insert sequence
          Length = 1296

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                       
Query: 425 cccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccca 484
           ||||||||||||| || || ||||| ||||| | || ||||| |||||||||||| || |
Sbjct: 829 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 770

                                 
Query: 485 ggctcctggccgggttgatgcc 506
            ||||| ||| |||||||||||
Sbjct: 769 tgctccgggcagggttgatgcc 748



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 330 gttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggtg 386
           |||||||| ||||||||| || |||||||||||  |||||| ||| |||||||||||
Sbjct: 924 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 868



to top

>gb|AY103580.1| Zea mays PCO072544 mRNA sequence
          Length = 1633

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 102/126 (80%)
 Strand = Plus / Minus

                                                                        
Query: 381  ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
            ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||| ||
Sbjct: 1264 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 1205

                                                                        
Query: 441  atcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggtt 500
             ||   ||| || |  |||  ||||| ||||| |||||| || |||||||| ||||||||
Sbjct: 1204 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 1145

                  
Query: 501  gatgcc 506
            ||||||
Sbjct: 1144 gatgcc 1139



to top

>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds
          Length = 1280

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 75/90 (83%)
 Strand = Plus / Minus

                                                                       
Query: 417 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggc 476
           ||||||||||||||||||||| || || | |||||| |  ||| |||||| ||||| |||
Sbjct: 855 ggggccgacccagaagatccaatggtcgttccaggcgtgatccctgttgtagatgatggc 796

                                         
Query: 477 ggcccccaggctcctggccgggttgatgcc 506
            || || |||||||| || |||||||||||
Sbjct: 795 agcgccaaggctcctagctgggttgatgcc 766



to top

>gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (pip1) mRNA,
           complete cds
          Length = 1152

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatga 472
           |||||||| ||||| ||||||||||| |||||||| ||||||| |||||
Sbjct: 799 acccagaatatccagtgatcatcccatgccttgtctttgttgtagatga 751



to top

>emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0093G06,
             complete sequence
          Length = 127420

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                      
Query: 330   gttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggtg 386
             |||||||| ||||||||| || |||||||||||  |||||| ||| |||||||||||
Sbjct: 91012 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 91068



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                         
Query: 445   tcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgatg 504
             ||||| ||||| | || ||||| |||||||||||| || | ||||| ||| |||||||||
Sbjct: 91210 tcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagggttgatg 91269

               
Query: 505   cc 506
             ||
Sbjct: 91270 cc 91271



to top

>emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.1 gene)
          Length = 943

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 417 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttg 465
           |||||| |||||||| ||||| ||||||||||||||  |||||||||||
Sbjct: 883 ggggccaacccagaaaatccagtgatcatcccaggcgctgtccttgttg 835



to top

>emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.2 gene)
          Length = 1124

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                       
Query: 418 gggccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcg 477
           ||||| |||||||||||||| || |||||||| || | ||| ||||||  ||||| ||||
Sbjct: 866 gggccaacccagaagatccagtggtcatcccatgcatggtctttgttgaagatgatggcg 807

                                        
Query: 478 gcccccaggctcctggccgggttgatgcc 506
           || || || ||||| |||||||| |||||
Sbjct: 806 gctccaagactccttgccgggttaatgcc 778



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                        
Query: 330     gttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggtg 386
               |||||||| ||||||||| || |||||||||||  |||||| ||| |||||||||||
Sbjct: 8906703 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 8906759



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                            
Query: 378      gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 437
                |||||||||||||  ||| ||||| || |||||||| | ||| || ||||||||||||||
Sbjct: 26074811 gtactggtggtaggcggcggcgatggcggcgccgatgaggggccccacccagaagatcca 26074752

                  
Query: 438      ct 439
                ||
Sbjct: 26074751 ct 26074750



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                           
Query: 445     tcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgatg 504
               ||||| ||||| | || ||||| |||||||||||| || | ||||| ||| |||||||||
Sbjct: 8906901 tcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagggttgatg 8906960

                 
Query: 505     cc 506
               ||
Sbjct: 8906961 cc 8906962



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                            
Query: 442      tcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttg 501
                ||||||||||| | | || |||||| ||||| ||| || || |||||||| || ||||||
Sbjct: 28020793 tcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggttg 28020734

                     
Query: 502      atgcc 506
                |||||
Sbjct: 28020733 atgcc 28020729



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                            
Query: 442      tcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttg 501
                |||| ||| ||||||| || ||||| ||| || || || |||| |||||| |||||||||
Sbjct: 26074238 tcatgccatgccttgtgctggttgtagatcaccgcagctcccaagctccttgccgggttg 26074179

                     
Query: 502      atgcc 506
                |||||
Sbjct: 26074178 atgcc 26074174



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 417      ggggccgacccagaagatccactg 440
                |||||| |||||||||||||||||
Sbjct: 28021379 ggggccaacccagaagatccactg 28021356



to top

>gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds
          Length = 1070

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           |||||||| ||||| ||||||||||| || ||||| ||||||| ||| |||||||| || 
Sbjct: 746 acccagaaaatccattgatcatcccaagctttgtctttgttgtagattacggcggctccg 687

                            
Query: 484 aggctcctggccgggtt 500
           | ||| ||||| |||||
Sbjct: 686 aagcttctggcggggtt 670



to top

>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1486_E07
          Length = 110494

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                         
Query: 442   tcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttg 501
             |||| |||||| | ||||||||||| ||||| ||| || || ||||||||||| ||||||
Sbjct: 36713 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 36654

                  
Query: 502   atgcc 506
             |||||
Sbjct: 36653 atgcc 36649



to top

>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0475E07
          Length = 139961

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                         
Query: 438   ctgatcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgg 497
             |||||||  |||||||||||  ||||||| ||  |||||| | || ||||||||||||||
Sbjct: 92340 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 92281

                      
Query: 498   gttgatgcc 506
             |||||||||
Sbjct: 92280 gttgatgcc 92272



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                          
Query: 381    ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
              ||||||||| |  |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 102547 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 102488



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 381   ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
             ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 92511 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 92452



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                             
Query: 460    ttgttgtggatgacggcggcccccaggctcctggccgggttgatgcc 506
              ||||||| || ||||||||| || |||||||| ||||||||||||||
Sbjct: 110249 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgcc 110203



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                             
Query: 460    ttgttgtggatgacggcggcccccaggctcctggccgggttgatgcc 506
              |||||||  ||||||||||| || |||||||| ||||||||||||||
Sbjct: 102369 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgcc 102323



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                          
Query: 397    gcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
              ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 110444 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 110401



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 325   tacgcgttgctcctgaaggagccg 348
             ||||||||||||| ||||||||||
Sbjct: 92564 tacgcgttgctccggaaggagccg 92541



to top

>dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0461B08
          Length = 153743

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                          
Query: 442    tcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttg 501
              |||| |||||| | ||||||||||| ||||| ||| || || ||||||||||| ||||||
Sbjct: 118266 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 118207

                   
Query: 502    atgcc 506
              |||||
Sbjct: 118206 atgcc 118202



to top

>gb|AY107589.1| Zea mays PCO085320 mRNA sequence
          Length = 569

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                       
Query: 418 gggccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcg 477
           |||||||||||||| ||||| ||||| ||||| |||||   || |||||  |  ||||| 
Sbjct: 194 gggccgacccagaatatccagtgatcctcccacgcctttcgctggttgtacacaacggcc 135

                                        
Query: 478 gcccccaggctcctggccgggttgatgcc 506
           | |||||||||||| ||||||||||||||
Sbjct: 134 ggccccaggctccttgccgggttgatgcc 106



to top

>gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker
          Length = 824

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||||||
Sbjct: 288 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccactg 347



to top

>gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker
          Length = 763

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                       
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 440
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||||||
Sbjct: 489 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccactg 430



to top

>dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membrane intrinsic protein
           2-1, complete cds
          Length = 1311

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 139/176 (78%)
 Strand = Plus / Minus

                                                                       
Query: 331 ttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggtggtag 390
           ||||| ||||| || || || ||||||||||| || || || || ||||| |||||||||
Sbjct: 907 ttgcttctgaaagatcccagagccttgatggctcctgctctcagaatgtattggtggtag 848

                                                                       
Query: 391 aaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccag 450
           ||||| || || || || || || |  || || | |||||||||||| || |||||||| 
Sbjct: 847 aaggcagcaatggcagctccaatgaaaggtccaagccagaagatccattggtcatcccaa 788

                                                                   
Query: 451 gccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttgatgcc 506
           || ||||||||||| | |||||| || || || |  ||||| || |||||||||||
Sbjct: 787 gctttgtccttgttatagatgacagcagctcctaaactcctagcagggttgatgcc 732



to top

>ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative aquaporin
           (OSJNBa0093B11.9), mRNA
          Length = 729

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           |||||||||||||||||||| | ||| || |||  || ||||| || ||||||||| || 
Sbjct: 626 acccagaagatccactgatcgtgccaagcattgggctggttgtagacgacggcggcgccg 567

                                  
Query: 484 aggctcctggccgggttgatgcc 506
           | |||||| ||||| ||||||||
Sbjct: 566 aagctcctcgccggattgatgcc 544



to top

>emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.5 gene)
          Length = 1094

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggcc 480
           ||||||||||||||||| || |||||||| |||||||| | |||||  || || || || 
Sbjct: 809 ccgacccagaagatccaatggtcatcccatgccttgtcttcgttgtatatcacagcagct 750

                                  
Query: 481 cccaggctcctggccgggttgat 503
           || | |||||| |||||||||||
Sbjct: 749 ccaaagctcctagccgggttgat 727



to top

>gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-2
           (PIP1-2) mRNA, complete cds
          Length = 1154

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           |||||||| ||||||   ||||||||||| |  || ||||||| || || ||||||||||
Sbjct: 841 acccagaaaatccacatgtcatcccaggcatgctctttgttgtagacgatggcggccccc 782

                                  
Query: 484 aggctcctggccgggttgatgcc 506
           || ||||| || |||||||||||
Sbjct: 781 agactcctagcagggttgatgcc 759



to top

>gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1a) mRNA, complete cds
          Length = 1129

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           |||||||| ||||||   ||||||||||| |  ||  |||||| ||||| ||||||||||
Sbjct: 833 acccagaaaatccacatgtcatcccaggcatgctctctgttgtagatgatggcggccccc 774

                                  
Query: 484 aggctcctggccgggttgatgcc 506
           || ||||| || |||||||||||
Sbjct: 773 agactcctagcagggttgatgcc 751



to top

>dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-C02, full
           insert sequence
          Length = 1232

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           |||||||||||||||||||| | ||| || |||  || ||||| || ||||||||| || 
Sbjct: 808 acccagaagatccactgatcgtgccaagcattgggctggttgtagacgacggcggcgccg 749

                                  
Query: 484 aggctcctggccgggttgatgcc 506
           | |||||| ||||| ||||||||
Sbjct: 748 aagctcctcgccggattgatgcc 726



to top

>dbj|AB002149.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1064

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           |||||||||||||| ||||||||||| |||| ||| | ||||  |||||  || || || 
Sbjct: 815 acccagaagatccagtgatcatcccatgcctggtcgtggttgaagatgatagcagctcca 756

                                  
Query: 484 aggctcctggccgggttgatgcc 506
           ||||||| ||| |||||||||||
Sbjct: 755 aggctccgggcggggttgatgcc 733



to top

>gb|U56603.1|BMU56603 Bufo marinus vasopressin-insensitive water channel AQP-t1 mRNA,
           complete cds
          Length = 939

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 409 ccgatcatggggccgacccagaagatccactgat 442
           ||||||||||| ||||||||||||||||| ||||
Sbjct: 761 ccgatcatgggaccgacccagaagatccagtgat 728



to top

>gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds
          Length = 740

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                       
Query: 425 cccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccca 484
           ||||||| ||||||||||||||||| | ||| |  ||||||| ||| || ||||| ||||
Sbjct: 481 cccagaaaatccactgatcatcccatgtcttttttttgttgtagatcacagcggctccca 422

                                 
Query: 485 ggctcctggccgggttgatgcc 506
            ||| | ||||||||| |||||
Sbjct: 421 agctacgggccgggttaatgcc 400



to top

>gb|AF020620.1| Bufo marinus aquaporin-1 homolog (AQP-t1) mRNA, complete cds
          Length = 939

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 409 ccgatcatggggccgacccagaagatccactgat 442
           ||||||||||| ||||||||||||||||| ||||
Sbjct: 761 ccgatcatgggaccgacccagaagatccagtgat 728



to top

>emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019D11,
              complete sequence
          Length = 163039

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                          
Query: 378    gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 437
              |||||||||||||  ||| ||||| || |||||||| | ||| || ||||||||||||||
Sbjct: 109138 gtactggtggtaggcggcggcgatggcggcgccgatgaggggccccacccagaagatcca 109079

                
Query: 438    ct 439
              ||
Sbjct: 109078 ct 109077



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                          
Query: 442    tcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttg 501
              |||| ||| ||||||| || ||||| ||| || || || |||| |||||| |||||||||
Sbjct: 108565 tcatgccatgccttgtgctggttgtagatcaccgcagctcccaagctccttgccgggttg 108506

                   
Query: 502    atgcc 506
              |||||
Sbjct: 108505 atgcc 108501



to top

>gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein (Mip1) mRNA, partial cds
          Length = 539

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 74/90 (82%)
 Strand = Plus / Minus

                                                                       
Query: 417 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggc 476
           ||||||||||||||||||||| || ||   |||||| |  ||| |||||| ||||| |||
Sbjct: 280 ggggccgacccagaagatccaatggtcgctccaggcatgatccctgttgtagatgatggc 221

                                         
Query: 477 ggcccccaggctcctggccgggttgatgcc 506
            || || |||||||| || |||||||||||
Sbjct: 220 agcgccaaggctcctagctgggttgatgcc 191



to top

>gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence
          Length = 1154

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 381 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 437
           ||||||||||| ||| || |  || |||||||| | |||||||||||||||||||||
Sbjct: 790 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatcca 734



to top

>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatga 472
           |||||||||||||| || ||||||||||| | |||| |||||| |||||
Sbjct: 770 acccagaagatccagtggtcatcccaggcgtggtccctgttgtagatga 722



to top

>dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds
          Length = 1278

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 426 ccagaagatccactgatcatcccaggccttgtccttgttgt 466
           |||||||||||| || |||||||| || |||||||||||||
Sbjct: 768 ccagaagatccattggtcatcccaagctttgtccttgttgt 728



to top

>gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           partial cds
          Length = 411

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 442 tcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttg 501
           |||| ||||||| |||| ||||||| |||||| || || |||| ||| || |||||||||
Sbjct: 407 tcattccaggccctgtctttgttgtagatgacagcagctcccaagcttctcgccgggttg 348

                
Query: 502 atgcc 506
           |||||
Sbjct: 347 atgcc 343



to top

>dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membrane intrinsic protein
           2-2, complete cds
          Length = 1051

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 100/125 (80%)
 Strand = Plus / Minus

                                                                       
Query: 382 tggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactga 441
           |||||||||||||| || || || || || || | ||| || |||||||| ||||| || 
Sbjct: 874 tggtggtagaaggctgcaattgctgctccaatgaagggtcctacccagaaaatccattgg 815

                                                                       
Query: 442 tcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttg 501
           |||||||| |||||||| ||||||| ||| || || || || || || || || ||||||
Sbjct: 814 tcatcccaagccttgtctttgttgtagataacagcagctccaagacttctagcggggttg 755

                
Query: 502 atgcc 506
           |||||
Sbjct: 754 atgcc 750



to top

>gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1153

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           |||||||||||||| || |||| ||| |||| ||| ||||||| |||||  || || || 
Sbjct: 825 acccagaagatccagtggtcattccatgcctcgtctttgttgtagatgatagcagctcca 766

                               
Query: 484 aggctcctggccgggttgat 503
           || |||||||| ||||||||
Sbjct: 765 agactcctggcagggttgat 746



to top

>gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel protein MipC mRNA,
           complete cds
          Length = 1066

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 424 acccagaagatccactgatcatcccaggcctt 455
           |||||||| ||||| |||||||||||||||||
Sbjct: 838 acccagaaaatccaatgatcatcccaggcctt 807



to top

>gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA
          Length = 582

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 424 acccagaagatccactgatcatcccaggcctt 455
           |||||||| ||||| |||||||||||||||||
Sbjct: 354 acccagaaaatccaatgatcatcccaggcctt 323



to top

>gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (pip2) mRNA,
           complete cds
          Length = 1260

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           ||||| || ||||| || |||||||||| |||||| | ||||| |||||| || || || 
Sbjct: 843 acccaaaaaatccaatggtcatcccagggcttgtcttcgttgtagatgacagcagctcca 784

                                  
Query: 484 aggctcctggccgggttgatgcc 506
           | |||||| || |||||||||||
Sbjct: 783 aagctcctagcagggttgatgcc 761



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 352 gccttgatggcgcccgccctgagtatgtactggtggtaga 391
           ||||||||||| || ||||| || ||||| ||||||||||
Sbjct: 915 gccttgatggctcctgcccttaggatgtattggtggtaga 876



to top

>gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, complete cds
          Length = 1278

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 376 atgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatc 435
           ||||||||||| ||||| || || || || || || || | ||| ||||||||||| |||
Sbjct: 937 atgtactggtgatagaatgcagctattgcggcaccaatgaagggtccgacccagaaaatc 878

                                      
Query: 436 cactgatcatcccaggccttgtccttg 462
           || || |||||||| ||||| ||||||
Sbjct: 877 cattggtcatcccatgccttatccttg 851



to top

>emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel protein (mipB)
          Length = 1114

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggcc 480
           |||||||| |||| ||| || |||||||| || ||||||||||||  ||||| ||| || 
Sbjct: 800 ccgacccaaaagacccaatggtcatcccaagcgttgtccttgttgaagatgatggcagct 741

                                  
Query: 481 cccaggctcctggccgggttgat 503
           || || ||||| || ||||||||
Sbjct: 740 ccaagactccttgctgggttgat 718



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                   
Query: 472      acggcggcccccaggctcctggccgggttgatgcc 506
                |||||||| || |||||||| ||||||||||||||
Sbjct: 21009488 acggcggcgccgaggctcctcgccgggttgatgcc 21009454



to top

>gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein ZmPIP1-6 mRNA, complete
           cds
          Length = 1325

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 468 gatgacggcggcccccaggctcctggccgggttgatgcc 506
           ||||| |||||| || ||||||||||| |||||||||||
Sbjct: 960 gatgatggcggcgccgaggctcctggcggggttgatgcc 922



to top

>gb|AY995195.1| Phaseolus vulgaris putative aquaporin (PIP2;1) mRNA, complete cds
          Length = 1330

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 424 acccagaagatccactgatcatcccag 450
           |||||||| ||||||||||||||||||
Sbjct: 810 acccagaaaatccactgatcatcccag 784



to top

>dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane intrinsic protein
           2;5, complete cds
          Length = 1126

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgt 466
           |||||||||||||| || |||||||| |||||| | |||||||
Sbjct: 786 acccagaagatccaatggtcatcccaagccttgccattgttgt 744



to top

>dbj|AB206099.1| Mimosa pudica pip2;1 mRNA for plasma membrane intrinsic protein
           2;1, complete cds
          Length = 1235

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 418 gggccgacccagaagatccactgatcatcccaggccttg 456
           ||||| |||||||| ||||| ||||||||||| ||||||
Sbjct: 804 gggccaacccagaaaatccaatgatcatcccaagccttg 766



to top

>gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, complete cds
          Length = 909

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgt 466
           |||||||||||||| || |||||||| ||||| || |||||||
Sbjct: 740 acccagaagatccaatggtcatcccacgccttctcgttgttgt 698



to top

>gb|AF255795.1|AF255795 Allium cepa aquaporin 1 (Aqp1) mRNA, complete cds
          Length = 1237

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgt 466
           |||||||| ||||||||||| ||||| || || ||||||||||
Sbjct: 816 acccagaatatccactgatcgtcccaagctttatccttgttgt 774



to top

>dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:B1274F11
          Length = 171257

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 472    acggcggcccccaggctcctggccgggttgatgcc 506
              |||||||| || |||||||| ||||||||||||||
Sbjct: 101577 acggcggcgccgaggctcctcgccgggttgatgcc 101543



to top

>dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1223

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           |||||||| ||||| || ||||||||||| |    |||||||| ||||| ||| || || 
Sbjct: 874 acccagaatatccagtggtcatcccaggcatgccgcttgttgtagatgatggcagcgccg 815

                                  
Query: 484 aggctcctggccgggttgatgcc 506
           || |||||||| |||||||||||
Sbjct: 814 agactcctggctgggttgatgcc 792



to top

>dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-H08, full
           insert sequence
          Length = 1247

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 472 acggcggcccccaggctcctggccgggttgatgcc 506
           |||||||| || |||||||| ||||||||||||||
Sbjct: 750 acggcggcgccgaggctcctcgccgggttgatgcc 716



to top

>dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-G06, full
           insert sequence
          Length = 1066

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 472 acggcggcccccaggctcctggccgggttgatgcc 506
           |||||||| || |||||||| ||||||||||||||
Sbjct: 648 acggcggcgccgaggctcctcgccgggttgatgcc 614



to top

>dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D11, full
           insert sequence
          Length = 1249

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 472 acggcggcccccaggctcctggccgggttgatgcc 506
           |||||||| || |||||||| ||||||||||||||
Sbjct: 748 acggcggcgccgaggctcctcgccgggttgatgcc 714



to top

>gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, complete cds
          Length = 1192

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 421 ccgacccagaagatccactgatcatcccaggcctt 455
           |||||||| || ||||| |||||||||||||||||
Sbjct: 816 ccgacccaaaatatccattgatcatcccaggcctt 782



to top

>dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013118N06, full
           insert sequence
          Length = 1302

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 472 acggcggcccccaggctcctggccgggttgatgcc 506
           |||||||| || |||||||| ||||||||||||||
Sbjct: 743 acggcggcgccgaggctcctcgccgggttgatgcc 709



to top

>dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone: P0478E02
          Length = 140715

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 472   acggcggcccccaggctcctggccgggttgatgcc 506
             |||||||| || |||||||| ||||||||||||||
Sbjct: 30788 acggcggcgccgaggctcctcgccgggttgatgcc 30754



to top

>gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, complete cds
          Length = 1201

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           |||||||||||||| || ||||||||||| || |  | ||||  ||| || || || || 
Sbjct: 814 acccagaagatccaatggtcatcccaggctttctgttggttgaagataacagcagctccg 755

                                  
Query: 484 aggctcctggccgggttgatgcc 506
           || ||||||||||||||||||||
Sbjct: 754 agactcctggccgggttgatgcc 732



to top

>gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, complete cds
          Length = 1071

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 418 gggccgacccagaagatccactgatcatcccaggccttg 456
           ||||| ||||||||||||||||| || ||||| ||||||
Sbjct: 777 gggccaacccagaagatccactggtcgtcccaagccttg 739



to top

>dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membrane intrinsic protein
            1-1, complete cds
          Length = 1351

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                        
Query: 424  acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
            |||||||| | ||| || ||||||||||| |  | |||||||| ||||| ||| || || 
Sbjct: 1015 acccagaaaacccagtggtcatcccaggcatgctgcttgttgtagatgatggcagcgcca 956

                                   
Query: 484  aggctcctggccgggttgatgcc 506
            || |||||||| |||||||||||
Sbjct: 955  agactcctggctgggttgatgcc 933



to top

>gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic protein 2-like mRNA,
           complete cds
          Length = 1277

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtc 458
           ||||||||||| ||||| || |||||||| ||||||||
Sbjct: 828 ccgacccagaaaatccagtgttcatcccacgccttgtc 791



to top

>emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 59
          Length = 199199

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 457   tccttgttgtggatgacggcggcccccaggctcctggccgggttgatgcc 506
             |||||||||| ||||| ||| || || || |||||||||||||| |||||
Sbjct: 75489 tccttgttgtagatgatggcagctccgagactcctggccgggttaatgcc 75440



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 421   ccgacccagaagatccactg 440
             ||||||||||||||||||||
Sbjct: 75658 ccgacccagaagatccactg 75639



to top

>emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, BAC clone F16G20 (ESSAII
             project)
          Length = 97006

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 457   tccttgttgtggatgacggcggcccccaggctcctggccgggttgatgcc 506
             |||||||||| ||||| ||| || || || |||||||||||||| |||||
Sbjct: 33957 tccttgttgtagatgatggcagctccgagactcctggccgggttaatgcc 33908



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 421   ccgacccagaagatccactg 440
             ||||||||||||||||||||
Sbjct: 34126 ccgacccagaagatccactg 34107



to top

>emb|AJ005869.1|CAR005869 Cicer arietinum mRNA for putative transmembrane channel protein,
           partial
          Length = 634

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 424 acccagaagatccactgatcatccca 449
           |||||||||||||| |||||||||||
Sbjct: 269 acccagaagatccaatgatcatccca 244



to top

>gb|U22658.1|BMU22658 Bufo marinus urinary bladder aquaporin mRNA, complete cds
          Length = 819

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 409 ccgatcatggggccgacccagaagatccactgat 442
           |||||||| || ||||||||||||||||| ||||
Sbjct: 662 ccgatcatcggaccgacccagaagatccagtgat 629



to top

>gb|AF386739.1|AF386739 Medicago truncatula aquaporin protein PIP1;1 (PIP1;1) mRNA,
           complete cds
          Length = 1244

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 424 acccagaagatccactgatcatccca 449
           |||||||||||||| |||||||||||
Sbjct: 845 acccagaagatccagtgatcatccca 820



to top

>gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, complete cds
          Length = 1084

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttg 465
           |||||||||| ||| || |||||||| || ||||||||||||
Sbjct: 815 acccagaagacccaatggtcatcccaagcgttgtccttgttg 774



to top

>emb|AJ605574.1| Ricinus communis mRNA for aquaporin (Pip1-1 gene), clone pP2L
          Length = 1095

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttg 465
           |||||||| ||||| |||||||||||| | | ||||||||||
Sbjct: 868 acccagaaaatccaatgatcatcccagccttggtccttgttg 827



to top

>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 461 tgttgtggatgacggcggcccccaggctcctggccgggttgatgcc 506
           |||||| ||||| ||| || ||||||||||| || |||||||||||
Sbjct: 830 tgttgtagatgatggcagctcccaggctccttgcagggttgatgcc 785



to top

>gb|U62280.1|NTU62280 Nicotiana tabacum aquaporin (NT2) mRNA, complete cds
          Length = 1049

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 424 acccagaagatccactgatcatccca 449
           |||||||||||||| |||||||||||
Sbjct: 797 acccagaagatccagtgatcatccca 772



to top

>ref|NM_115339.2| Arabidopsis thaliana PIP2;5/PIP2D; water channel AT3G54820
           (PIP2;5/PIP2D) mRNA, complete cds
          Length = 1229

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatga 472
           |||||||| ||||| ||||  ||||| || ||||||||||||| |||||
Sbjct: 851 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 803



to top

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 395     ccgcgatcgccgcgccgatcatggg 419
               ||||||||||||||||||| |||||
Sbjct: 2960721 ccgcgatcgccgcgccgatgatggg 2960697



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 395   ccgcgatcgccgcgccgatcatggg 419
             ||||||||||||||||||| |||||
Sbjct: 88152 ccgcgatcgccgcgccgatgatggg 88128



to top

>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 393     ggccgcgatcgccgcgccgatcatg 417
               |||||||||||| ||||||||||||
Sbjct: 2316707 ggccgcgatcgcggcgccgatcatg 2316731



to top

>gb|BT000670.1| Arabidopsis thaliana clone RAFL07-09-N03 (R10758) putative
           aquaporin/plasma membrane intrinsic protein (At3g54820)
           mRNA, complete cds
          Length = 1143

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatga 472
           |||||||| ||||| ||||  ||||| || ||||||||||||| |||||
Sbjct: 771 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 723



to top

>emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel protein (mipA)
          Length = 1104

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgtt 464
           |||||||||| ||| || |||||||| || |||||||||||
Sbjct: 816 acccagaagacccaatggtcatcccaagcgttgtccttgtt 776



to top

>gb|AY062981.1| Arabidopsis thaliana putative aquaporin/MIP protein (At3g54820)
           mRNA, complete cds
          Length = 892

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatga 472
           |||||||| ||||| ||||  ||||| || ||||||||||||| |||||
Sbjct: 755 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 707



to top

>gb|AF370351.1| Arabidopsis thaliana putative aquaporin/MIP protein (At3g54820)
           mRNA, complete cds
          Length = 1194

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatga 472
           |||||||| ||||| ||||  ||||| || ||||||||||||| |||||
Sbjct: 850 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 802



to top

>ref|NM_001005829.1| Xenopus tropicalis aquaporin 1 (channel-forming integral protein,
           28kDa) (aqp1), mRNA
          Length = 950

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 409 ccgatcatggggccgacccagaagatcca 437
           ||||||||||| |||||||| ||||||||
Sbjct: 704 ccgatcatgggtccgacccaaaagatcca 676



to top

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 395     ccgcgatcgccgcgccgatcatggg 419
               ||||||||||||||||||| |||||
Sbjct: 3933700 ccgcgatcgccgcgccgatgatggg 3933676



to top

>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11,
             complete sequence
          Length = 147806

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                         
Query: 442   tcatcccaggccttgtccttgttgtggatgacggcggcccccaggctcctggccgggttg 501
             ||||||||||| | | || |||||| ||||| ||| || || |||||||| || ||||||
Sbjct: 28019 tcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggttg 27960

                  
Query: 502   atgcc 506
             |||||
Sbjct: 27959 atgcc 27955



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 417   ggggccgacccagaagatccactg 440
             |||||| |||||||||||||||||
Sbjct: 28605 ggggccaacccagaagatccactg 28582



to top

>emb|AJ849324.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.1 gene)
          Length = 1295

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 424 acccagaagatccactgatcatcccaggc 452
           |||||||| ||||| ||||||||||||||
Sbjct: 780 acccagaaaatccaatgatcatcccaggc 752



to top

>gb|AY671950.1| Aegiceras corniculatum aquaporin 2 (PIP2) mRNA, complete cds
          Length = 855

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 425 cccagaagatccactgatcatccca 449
           ||||||| |||||||||||||||||
Sbjct: 754 cccagaaaatccactgatcatccca 730



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 343 gagccgagggccttgatggcgcccgccctgagtatgtactggtggtagaaggccgc 398
           |||||||| ||||| || || || || | ||| ||| |||||||||||||||||||
Sbjct: 836 gagccgagagccttaatcgcccctgctcggaggatgaactggtggtagaaggccgc 781



to top

>emb|BX822631.1|CNS0A61A Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB54ZF09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 897

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatga 472
           |||||||| ||||| ||||  ||||| || ||||||||||||| |||||
Sbjct: 571 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 523



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 394     gccgcgatcgccgcgccgatc 414
               |||||||||||||||||||||
Sbjct: 1116192 gccgcgatcgccgcgccgatc 1116212



to top

>gb|AF154641.1| Nicotiana tabacum clone PR16 mRNA sequence
          Length = 1100

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 331 ttgctcctgaaggagccgagggccttgatggcgcccgccctgagtatgtactggtggtag 390
           |||||||||||||| || || || |||||||| || || | ||| ||| |||||||||||
Sbjct: 900 ttgctcctgaaggaaccaagagctttgatggcaccagcacggaggatgaactggtggtag 841

            
Query: 391 a 391
           |
Sbjct: 840 a 840



to top

>gb|AY084843.1| Arabidopsis thaliana clone 11929 mRNA, complete sequence
          Length = 1222

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatga 472
           |||||||| ||||| ||||  ||||| || ||||||||||||| |||||
Sbjct: 852 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 804



to top

>emb|AJ605568.1| Ricinus communis partial mRNA for putative aquaporin (Pip2-3 gene),
           clone pR450-4
          Length = 452

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 442 tcatcccaggccttgtccttgttgt 466
           ||||||||||||||||||| |||||
Sbjct: 428 tcatcccaggccttgtcctggttgt 404



to top

>gb|BC075384.1| Xenopus tropicalis aquaporin 1 (channel-forming integral protein,
           28kDa), mRNA (cDNA clone MGC:89110 IMAGE:7006583),
           complete cds
          Length = 950

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 409 ccgatcatggggccgacccagaagatcca 437
           ||||||||||| |||||||| ||||||||
Sbjct: 704 ccgatcatgggtccgacccaaaagatcca 676



to top

>gb|BC084131.1| Xenopus laevis hypothetical LOC495037, mRNA (cDNA clone MGC:86220
           IMAGE:6958087), complete cds
          Length = 1283

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 409 ccgatcatggggccgacccagaagatcca 437
           ||||||||||| || ||||||||||||||
Sbjct: 810 ccgatcatgggtccaacccagaagatcca 782



to top

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 395     ccgcgatcgccgcgccgatcatggg 419
               ||||||||||||||||||| |||||
Sbjct: 3637218 ccgcgatcgccgcgccgatgatggg 3637194



to top

>gb|AE000657.1| Aquifex aeolicus VF5, complete genome
          Length = 1551335

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 79     aaattaaaacaggaaaaggaa 99
              |||||||||||||||||||||
Sbjct: 624952 aaattaaaacaggaaaaggaa 624932



to top

>gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel protein-like mRNA,
           complete cds
          Length = 1172

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatga 472
           |||||||||||||| || |||| ||| |||| ||| ||||||| |||||
Sbjct: 815 acccagaagatccagtggtcattccatgcctcgtctttgttgtagatga 767



to top

>ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G01620 (PIP1C) mRNA,
           complete cds
          Length = 1251

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatga 472
           ||||||||||| ||||| || || ||||| || | ||||||||||| |||||
Sbjct: 908 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 857



to top

>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 393     ggccgcgatcgccgcgccga 412
               ||||||||||||||||||||
Sbjct: 1911596 ggccgcgatcgccgcgccga 1911615



to top

>gb|AY494191.1| Physcomitrella patens plasma membrane aquaporin (PIP2;1) gene,
            complete cds
          Length = 1486

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 421  ccgacccagaagatccactg 440
            ||||||||||||||||||||
Sbjct: 1380 ccgacccagaagatccactg 1361



to top

>gb|AC016250.5| Homo sapiens chromosome 8 clone RP11-516P9, complete sequence
          Length = 199569

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 82    ttaaaacaggaaaaggaatg 101
             ||||||||||||||||||||
Sbjct: 92945 ttaaaacaggaaaaggaatg 92926



to top

>gb|CP000272.1| Burkholderia xenovorans LB400 chromosome 3, complete sequence
          Length = 1471779

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 393    ggccgcgatcgccgcgccga 412
              ||||||||||||||||||||
Sbjct: 748148 ggccgcgatcgccgcgccga 748129



to top

>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c
          Length = 986

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatga 472
           ||||||||||| ||||| || || ||||| || | ||||||||||| |||||
Sbjct: 814 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 763



to top

>emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B
          Length = 1057

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatga 472
           ||||||||||| ||||| || || ||||| || | ||||||||||| |||||
Sbjct: 795 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 744



to top

>emb|BX545848.23| Zebrafish DNA sequence from clone DKEY-8O19 in linkage group 20 Contains
              the gene for a novel protein (zgc:63746), the gene for a
              novel protein (zgc:55614), the gene for the 5' end of a
              novel protein similar to mouse and human cyclin-dependent
              kinase (CDC2-like) 11 (CDK11), the gene for a novel protein
              similar to vertebrate mitogen-activated protein kinase
              kinase kinase 5 (MAP3K5), a novel gene and eleven CpG
              islands, complete sequence
          Length = 199986

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 76     gctaaattaaaacaggaaaa 95
              ||||||||||||||||||||
Sbjct: 129625 gctaaattaaaacaggaaaa 129606



to top

>gb|AC025207.5| Homo sapiens chromosome 8, clone RP11-193J8, complete sequence
          Length = 157375

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 82     ttaaaacaggaaaaggaatg 101
              ||||||||||||||||||||
Sbjct: 143776 ttaaaacaggaaaaggaatg 143795



to top

>emb|AL596209.13| Mouse DNA sequence from clone RP23-278F12 on chromosome 11 Contains the
             3' end of the Ulk2 gene for Unc-51 like kinase 2 (C.
             elegans), the Prpsap2 gene for phosphoribosyl
             pyrophosphate synthetase-associated protein 2, the gene
             for a novel sodium/glucose cotransporter protein, the gene
             for a novel protein (2310040C09Rik), the Grap gene for
             GRB2-related adaptor protein and a CpG island, complete
             sequence
          Length = 186359

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 249   tttctctttggatggatgga 268
             ||||||||||||||||||||
Sbjct: 79799 tttctctttggatggatgga 79818



to top

>gb|AC083943.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0044A10, from chromosome 10, complete sequence
          Length = 169270

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 389   agaaggccgcgatcgccgcg 408
             ||||||||||||||||||||
Sbjct: 92267 agaaggccgcgatcgccgcg 92286



to top

>dbj|AB225187.1| Aspergillus oryzae cDNA, contig sequence: AoEST2039
          Length = 637

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 348 gagggccttgatggcgcccg 367
           ||||||||||||||||||||
Sbjct: 595 gagggccttgatggcgcccg 576



to top

>dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026
          Length = 2324132

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 348    gagggccttgatggcgcccg 367
              ||||||||||||||||||||
Sbjct: 962646 gagggccttgatggcgcccg 962627



to top

>gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map CIC10A06, complete
             sequence
          Length = 96827

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 421   ccgacccagaagatccactg 440
             ||||||||||||||||||||
Sbjct: 65741 ccgacccagaagatccactg 65722



to top

>gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (F22L4.16) mRNA, complete cds
          Length = 1031

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatga 472
           ||||||||||| ||||| || || ||||| || | ||||||||||| |||||
Sbjct: 836 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 785



to top

>gb|AY059380.1| Medicago truncatula aquaporin (PIP2-1) mRNA, complete cds
          Length = 973

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 433 atccactgatcatcccaggc 452
           ||||||||||||||||||||
Sbjct: 775 atccactgatcatcccaggc 756



to top

>gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative plasma membrane
           intrinsic protein 1c (At1g01620) mRNA, complete cds
          Length = 861

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatga 472
           ||||||||||| ||||| || || ||||| || | ||||||||||| |||||
Sbjct: 782 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 731



to top

>gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, complete cds
          Length = 1101

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 424 acccagaagatccactgatcatcccaggccttgtccttgttgtggatgacggcggccccc 483
           ||||| |||| ||| || |||||||| || ||||||||||||  ||||| ||| || || 
Sbjct: 798 acccaaaagacccaatggtcatcccaagcgttgtccttgttgaagatgatggcagctcca 739

                               
Query: 484 aggctcctggccgggttgat 503
           || ||||| || ||||||||
Sbjct: 738 agactccttgctgggttgat 719



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 389      agaaggccgcgatcgccgcg 408
                ||||||||||||||||||||
Sbjct: 13136748 agaaggccgcgatcgccgcg 13136767



to top

>emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZE08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 963

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatga 472
           ||||||||||| ||||| || || ||||| || | ||||||||||| |||||
Sbjct: 826 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 775



to top

>dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane intrinsic protein
           2;4, complete cds
          Length = 1263

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 460 ttgttgtggatgacggcggcccccaggctcctggccgggttgat 503
           |||||||  ||||| || ||||| | ||||||||||||||||||
Sbjct: 759 ttgttgtacatgactgcagccccaaagctcctggccgggttgat 716



to top

>dbj|AP004867.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0036E06
          Length = 137926

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 79    aaattaaaacaggaaaagga 98
             ||||||||||||||||||||
Sbjct: 30074 aaattaaaacaggaaaagga 30093



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 393     ggccgcgatcgccgcgccga 412
               ||||||||||||||||||||
Sbjct: 5135849 ggccgcgatcgccgcgccga 5135868



to top

>dbj|AP004090.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1399_H05
          Length = 147670

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 79     aaattaaaacaggaaaagga 98
              ||||||||||||||||||||
Sbjct: 108838 aaattaaaacaggaaaagga 108857



to top

>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 405     cgcgccgatcatggggccga 424
               ||||||||||||||||||||
Sbjct: 1377402 cgcgccgatcatggggccga 1377383



to top

>gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (At1g01620) mRNA, complete cds
          Length = 903

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 421 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtggatga 472
           ||||||||||| ||||| || || ||||| || | ||||||||||| |||||
Sbjct: 782 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 731



to top

>emb|BX248523.8| Zebrafish DNA sequence from clone CH211-257G8 in linkage group 20,
             complete sequence
          Length = 169849

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 76    gctaaattaaaacaggaaaa 95
             ||||||||||||||||||||
Sbjct: 35269 gctaaattaaaacaggaaaa 35288



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 389      agaaggccgcgatcgccgcg 408
                ||||||||||||||||||||
Sbjct: 13144088 agaaggccgcgatcgccgcg 13144107



to top

>gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome
          Length = 5528445

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 69      tatggtcgctaaattaaaac 88
               ||||||||||||||||||||
Sbjct: 4757676 tatggtcgctaaattaaaac 4757657



to top

>dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome
          Length = 5498450

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 69      tatggtcgctaaattaaaac 88
               ||||||||||||||||||||
Sbjct: 4688695 tatggtcgctaaattaaaac 4688676



to top

>gb|U27347.1|GMU27347 Glycine max putative water channel protein (Pip1) mRNA, complete
           cds
          Length = 1255

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 424 acccagaagatccactgatcatcccaggcctt 455
           ||||| |||||||| || ||||||||||||||
Sbjct: 848 acccaaaagatccaatggtcatcccaggcctt 817



to top

>dbj|AP003548.2| Homo sapiens genomic DNA, chromosome 8q23, clone:KB1448A5
          Length = 178420

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 82     ttaaaacaggaaaaggaatg 101
              ||||||||||||||||||||
Sbjct: 145388 ttaaaacaggaaaaggaatg 145407


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,095,331
Number of Sequences: 3902068
Number of extensions: 4095331
Number of successful extensions: 73912
Number of sequences better than 10.0: 212
Number of HSP's better than 10.0 without gapping: 214
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 72486
Number of HSP's gapped (non-prelim): 1408
length of query: 506
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 484
effective length of database: 17,147,199,772
effective search space: 8299244689648
effective search space used: 8299244689648
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top