>gb|AC140850.20| Medicago truncatula clone mth2-11i23, complete sequence
          Length = 138846

 Score = 54.0 bits (27), Expect = 7e-05
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 44     atcatcacatccccacacgcacatgca 70
              |||||||||||||||||||||||||||
Sbjct: 130057 atcatcacatccccacacgcacatgca 130031

>gb|AC146189.3| Pan troglodytes BAC clone CH251-490L21 from Y, complete sequence
          Length = 180597

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 49     cacatccccacacgcacatgcat 71
              ||||||| |||||||||||||||
Sbjct: 119650 cacatccacacacgcacatgcat 119628

>gb|AC122452.4| Mus musculus BAC clone RP24-255M5 from chromosome 16, complete
            sequence
          Length = 181463

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 18   ttaccaagattatttattt 36
            |||||||||||||||||||
Sbjct: 7248 ttaccaagattatttattt 7230

>emb|AL035665.32|HS644L1 Human DNA sequence from clone RP4-644L1 on chromosome 20q12 Contains
             the MAFB gene for v-maf musculoaponeurotic fibrosarcoma
             oncogene homolog B (avian), a novel gene and two CpG
             islands, complete sequence
          Length = 145593

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 50    acatccccacacgcacatgcata 72
             |||||| ||||||||||||||||
Sbjct: 83841 acatcctcacacgcacatgcata 83819

>emb|BX640467.12| Zebrafish DNA sequence from clone CH211-14C11 in linkage group 22,
             complete sequence
          Length = 111504

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 63    cacatgcataaaccgagga 81
             |||||||||||||||||||
Sbjct: 17662 cacatgcataaaccgagga 17644

>emb|CR385084.10| Zebrafish DNA sequence from clone CH211-212B24 in linkage group 17,
             complete sequence
          Length = 136826

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 55    cccacacgcacatgcataa 73
             |||||||||||||||||||
Sbjct: 54450 cccacacgcacatgcataa 54432

>dbj|BS000612.1| Pan troglodytes chromosome Y clone:PTBY-009O17, complete sequences
          Length = 80000

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 49    cacatccccacacgcacatgcat 71
             ||||||| |||||||||||||||
Sbjct: 64086 cacatccacacacgcacatgcat 64108

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                       
Query: 49       cacatccccacacgcacatgcat 71
                ||||||| |||||||||||||||
Sbjct: 23891747 cacatccacacacgcacatgcat 23891725

>gb|AC090386.13| Homo sapiens chromosome 18, clone RP11-797E24, complete sequence
          Length = 185563

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 49     cacatccccacacgcacatgcat 71
              |||||||||||||| ||||||||
Sbjct: 141866 cacatccccacacgtacatgcat 141888

>gb|AC154230.2| Mus musculus BAC clone RP24-156E24 from 16, complete sequence
          Length = 136341

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 18    ttaccaagattatttattt 36
             |||||||||||||||||||
Sbjct: 70162 ttaccaagattatttattt 70180

>emb|CR388128.18| Zebrafish DNA sequence from clone CH211-127B17 in linkage group 18,
             complete sequence
          Length = 180022

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 18    ttaccaagattatttattt 36
             |||||||||||||||||||
Sbjct: 74500 ttaccaagattatttattt 74518


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 616,724
Number of Sequences: 3902068
Number of extensions: 616724
Number of successful extensions: 37984
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 37968
Number of HSP's gapped (non-prelim): 16
length of query: 97
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 76
effective length of database: 17,151,101,840
effective search space: 1303483739840
effective search space used: 1303483739840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)