ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbart08a07 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_467137.1| Oryza sativa (japonica cultivar-group), mRNA Length = 747 Score = 359 bits (181), Expect = 6e-96 Identities = 241/261 (92%) Strand = Plus / Minus Query: 229 gcgtagtcctggtcggcgactggctggtaggacgcgatgaacacgtcgccgtacacgaac 288 ||||||||||||||||| || |||||||| || |||||||||||||||||||||||| | Sbjct: 743 gcgtagtcctggtcggcaacgggctggtatgagccgatgaacacgtcgccgtacacgagc 684 Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||||||||| || ||||| ||||| ||||||||||||||||||||||||||||||||| Sbjct: 683 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 624 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 |||||||||||||| |||||||||||||| || |||||||||||||| |||||||| ||| Sbjct: 623 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 564 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| Sbjct: 563 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 504 Query: 469 agggaccccttcttggggtcc 489 || || |||||||| |||||| Sbjct: 503 agcgatcccttcttcgggtcc 483
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 359 bits (181), Expect = 6e-96 Identities = 241/261 (92%) Strand = Plus / Plus Query: 229 gcgtagtcctggtcggcgactggctggtaggacgcgatgaacacgtcgccgtacacgaac 288 ||||||||||||||||| || |||||||| || |||||||||||||||||||||||| | Sbjct: 26627123 gcgtagtcctggtcggcaacgggctggtatgagccgatgaacacgtcgccgtacacgagc 26627182 Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||||||||| || ||||| ||||| ||||||||||||||||||||||||||||||||| Sbjct: 26627183 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 26627242 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 |||||||||||||| |||||||||||||| || |||||||||||||| |||||||| ||| Sbjct: 26627243 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 26627302 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| Sbjct: 26627303 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 26627362 Query: 469 agggaccccttcttggggtcc 489 || || |||||||| |||||| Sbjct: 26627363 agcgatcccttcttcgggtcc 26627383
>dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0519E06 Length = 170634 Score = 359 bits (181), Expect = 6e-96 Identities = 241/261 (92%) Strand = Plus / Plus Query: 229 gcgtagtcctggtcggcgactggctggtaggacgcgatgaacacgtcgccgtacacgaac 288 ||||||||||||||||| || |||||||| || |||||||||||||||||||||||| | Sbjct: 169504 gcgtagtcctggtcggcaacgggctggtatgagccgatgaacacgtcgccgtacacgagc 169563 Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||||||||| || ||||| ||||| ||||||||||||||||||||||||||||||||| Sbjct: 169564 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 169623 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 |||||||||||||| |||||||||||||| || |||||||||||||| |||||||| ||| Sbjct: 169624 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 169683 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| Sbjct: 169684 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 169743 Query: 469 agggaccccttcttggggtcc 489 || || |||||||| |||||| Sbjct: 169744 agcgatcccttcttcgggtcc 169764
>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1112_F09 Length = 139371 Score = 359 bits (181), Expect = 6e-96 Identities = 241/261 (92%) Strand = Plus / Plus Query: 229 gcgtagtcctggtcggcgactggctggtaggacgcgatgaacacgtcgccgtacacgaac 288 ||||||||||||||||| || |||||||| || |||||||||||||||||||||||| | Sbjct: 61284 gcgtagtcctggtcggcaacgggctggtatgagccgatgaacacgtcgccgtacacgagc 61343 Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||||||||| || ||||| ||||| ||||||||||||||||||||||||||||||||| Sbjct: 61344 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 61403 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 |||||||||||||| |||||||||||||| || |||||||||||||| |||||||| ||| Sbjct: 61404 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 61463 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| Sbjct: 61464 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 61523 Query: 469 agggaccccttcttggggtcc 489 || || |||||||| |||||| Sbjct: 61524 agcgatcccttcttcgggtcc 61544
>dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mRNA for tonoplast intrinsic protein, complete cds Length = 1013 Score = 359 bits (181), Expect = 6e-96 Identities = 241/261 (92%) Strand = Plus / Minus Query: 229 gcgtagtcctggtcggcgactggctggtaggacgcgatgaacacgtcgccgtacacgaac 288 ||||||||||||||||| || |||||||| || |||||||||||||||||||||||| | Sbjct: 816 gcgtagtcctggtcggcaacgggctggtatgagccgatgaacacgtcgccgtacacgagc 757 Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||||||||| || ||||| ||||| ||||||||||||||||||||||||||||||||| Sbjct: 756 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 697 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 |||||||||||||| |||||||||||||| || |||||||||||||| |||||||| ||| Sbjct: 696 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 637 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| Sbjct: 636 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 577 Query: 469 agggaccccttcttggggtcc 489 || || |||||||| |||||| Sbjct: 576 agcgatcccttcttcgggtcc 556
>dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-A10, full insert sequence Length = 873 Score = 359 bits (181), Expect = 6e-96 Identities = 241/261 (92%) Strand = Plus / Minus Query: 229 gcgtagtcctggtcggcgactggctggtaggacgcgatgaacacgtcgccgtacacgaac 288 ||||||||||||||||| || |||||||| || |||||||||||||||||||||||| | Sbjct: 618 gcgtagtcctggtcggcaacgggctggtatgagccgatgaacacgtcgccgtacacgagc 559 Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||||||||| || ||||| ||||| ||||||||||||||||||||||||||||||||| Sbjct: 558 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 499 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 |||||||||||||| |||||||||||||| || |||||||||||||| |||||||| ||| Sbjct: 498 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 439 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| Sbjct: 438 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 379 Query: 469 agggaccccttcttggggtcc 489 || || |||||||| |||||| Sbjct: 378 agcgatcccttcttcgggtcc 358
>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2 Length = 339972 Score = 359 bits (181), Expect = 6e-96 Identities = 241/261 (92%) Strand = Plus / Minus Query: 229 gcgtagtcctggtcggcgactggctggtaggacgcgatgaacacgtcgccgtacacgaac 288 ||||||||||||||||| || |||||||| || |||||||||||||||||||||||| | Sbjct: 250711 gcgtagtcctggtcggcaacgggctggtatgagccgatgaacacgtcgccgtacacgagc 250652 Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||||||||| || ||||| ||||| ||||||||||||||||||||||||||||||||| Sbjct: 250651 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 250592 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 |||||||||||||| |||||||||||||| || |||||||||||||| |||||||| ||| Sbjct: 250591 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 250532 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| Sbjct: 250531 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 250472 Query: 469 agggaccccttcttggggtcc 489 || || |||||||| |||||| Sbjct: 250471 agcgatcccttcttcgggtcc 250451 Score = 149 bits (75), Expect = 1e-32 Identities = 96/103 (93%) Strand = Plus / Plus Query: 387 catggagcccccgctgaaggggccggcggcgaggatgttggcgccgacaatgaaaccgat 446 ||||||||| |||||||| ||||||||||||||||||||||||||||| ||||| ||||| Sbjct: 332095 catggagccgccgctgaacgggccggcggcgaggatgttggcgccgacgatgaagccgat 332154 Query: 447 cgcgatgggcgcgatggtgccgagggaccccttcttggggtcc 489 |||||||||||||||||||||||| || |||||||| |||||| Sbjct: 332155 cgcgatgggcgcgatggtgccgagcgatcccttcttcgggtcc 332197
>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA, complete cds Length = 1073 Score = 301 bits (152), Expect = 1e-78 Identities = 237/263 (90%), Gaps = 3/263 (1%) Strand = Plus / Minus Query: 229 gcgtagtcctggtcggcgactggctggtagga--cgc-gatgaacacgtcgccgtacacg 285 |||||||||||||||||||| |||||||||| ||| |||||| ||||||||||| ||| Sbjct: 816 gcgtagtcctggtcggcgacctgctggtaggagccgccgatgaagacgtcgccgtagacg 757 Query: 286 aacccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaag 345 | || ||||| || || ||||||||||| ||||||||||||||||||||||| |||||| Sbjct: 756 aggccagcgagtccgccgccgatgagcgggccgacccagtagacccagttgccggcgaag 697 Query: 346 ttgccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaag 405 | | | ||||||||||| |||||||||||||||||||||||||||||||| ||||||||| Sbjct: 696 tcggccgcggcgacggcggggccgaaggagcgggcggggttcatggagccgccgctgaag 637 Query: 406 gggccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtg 465 || || ||||||||||||||||||||||| ||||| ||||| |||||||||||||||||| Sbjct: 636 ggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtg 577 Query: 466 ccgagggaccccttcttggggtc 488 |||||||| |||||||||||||| Sbjct: 576 ccgagggagcccttcttggggtc 554
>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes, complete cds Length = 65979 Score = 301 bits (152), Expect = 1e-78 Identities = 221/244 (90%) Strand = Plus / Minus Query: 245 cgactggctggtaggacgcgatgaacacgtcgccgtacacgaacccggcgaggccacctc 304 |||| ||||||||||| |||||||||||||||||||| |||| |||||||||||| || | Sbjct: 44956 cgaccggctggtaggaggcgatgaacacgtcgccgtagacgagcccggcgaggccgccac 44897 Query: 305 cgatgagcggcccgacccagtagacccagttgccagcgaagttgccggcggcgacggccg 364 | ||||| |||||||||||||| ||||||| ||| | |||||||||||| || ||||||| Sbjct: 44896 caatgagtggcccgacccagtacacccagtggccggagaagttgccggccgccacggccg 44837 Query: 365 ggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgaggatgt 424 | ||||||||||| || |||||||||||||| ||||||||||| |||||||||||||||| Sbjct: 44836 gcccgaaggagcgcgccgggttcatggagccgccgctgaagggcccggcggcgaggatgt 44777 Query: 425 tggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggaccccttcttgg 484 |||||||||| ||||| |||||||| ||||||||||||||||||||||| |||||||||| Sbjct: 44776 tggcgccgacgatgaagccgatcgccatgggcgcgatggtgccgagggagcccttcttgg 44717 Query: 485 ggtc 488 |||| Sbjct: 44716 ggtc 44713
>gb|AY106931.1| Zea mays PCO140073 mRNA sequence Length = 1069 Score = 293 bits (148), Expect = 3e-76 Identities = 220/244 (90%) Strand = Plus / Minus Query: 245 cgactggctggtaggacgcgatgaacacgtcgccgtacacgaacccggcgaggccacctc 304 |||| ||||||||||| |||||||||||||||||||| |||| ||| || |||||||| | Sbjct: 807 cgaccggctggtaggaggcgatgaacacgtcgccgtagacgagccccgccaggccaccgc 748 Query: 305 cgatgagcggcccgacccagtagacccagttgccagcgaagttgccggcggcgacggccg 364 ||| ||| || ||||||||||| ||||||||||| |||||||||||||| || ||||| | Sbjct: 747 cgacgagggggccgacccagtacacccagttgccggcgaagttgccggccgccacggcgg 688 Query: 365 ggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgaggatgt 424 |||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||| Sbjct: 687 ggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccaggatgt 628 Query: 425 tggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggaccccttcttgg 484 |||||||||| ||||| ||||| || ||||||||||||||||| |||||||||||||| | Sbjct: 627 tggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggaccccttcttcg 568 Query: 485 ggtc 488 |||| Sbjct: 567 ggtc 564
>gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRNA, complete cds Length = 1060 Score = 293 bits (148), Expect = 3e-76 Identities = 220/244 (90%) Strand = Plus / Minus Query: 245 cgactggctggtaggacgcgatgaacacgtcgccgtacacgaacccggcgaggccacctc 304 |||| ||||||||||| |||||||||||||||||||| |||| ||| || |||||||| | Sbjct: 789 cgaccggctggtaggaggcgatgaacacgtcgccgtagacgagccccgccaggccaccgc 730 Query: 305 cgatgagcggcccgacccagtagacccagttgccagcgaagttgccggcggcgacggccg 364 ||| ||| || ||||||||||| ||||||||||| |||||||||||||| || ||||| | Sbjct: 729 cgacgagggggccgacccagtacacccagttgccggcgaagttgccggccgccacggcgg 670 Query: 365 ggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgaggatgt 424 |||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||| Sbjct: 669 ggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccaggatgt 610 Query: 425 tggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggaccccttcttgg 484 |||||||||| ||||| ||||| || ||||||||||||||||| |||||||||||||| | Sbjct: 609 tggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggaccccttcttcg 550 Query: 485 ggtc 488 |||| Sbjct: 549 ggtc 546
>gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral protein ZmTIP2-3 mRNA, complete cds Length = 1042 Score = 285 bits (144), Expect = 7e-74 Identities = 219/244 (89%) Strand = Plus / Minus Query: 245 cgactggctggtaggacgcgatgaacacgtcgccgtacacgaacccggcgaggccacctc 304 |||| ||||||||||| |||||||||||||||||||| |||| ||| || |||||||| | Sbjct: 798 cgaccggctggtaggaggcgatgaacacgtcgccgtagacgagccccgccaggccaccgc 739 Query: 305 cgatgagcggcccgacccagtagacccagttgccagcgaagttgccggcggcgacggccg 364 ||| ||| || ||||||||||| ||||||||||| |||||||| ||||| || ||||| | Sbjct: 738 cgacgagggggccgacccagtacacccagttgccggcgaagttaccggccgccacggcgg 679 Query: 365 ggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgaggatgt 424 |||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||| Sbjct: 678 ggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccaggatgt 619 Query: 425 tggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggaccccttcttgg 484 |||||||||| ||||| ||||| || ||||||||||||||||| |||||||||||||| | Sbjct: 618 tggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggaccccttcttcg 559 Query: 485 ggtc 488 |||| Sbjct: 558 ggtc 555
>gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral protein ZmTIP2-1 mRNA, complete cds Length = 1110 Score = 280 bits (141), Expect = 4e-72 Identities = 233/263 (88%), Gaps = 3/263 (1%) Strand = Plus / Minus Query: 229 gcgtagtcctggtcggcgactggctggtaggacgcg---atgaacacgtcgccgtacacg 285 |||||||||||||| ||||| |||||||||| || ||||| ||||||||||| ||| Sbjct: 973 gcgtagtcctggtccgcgacctgctggtaggagccgccaatgaagacgtcgccgtagacg 914 Query: 286 aacccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaag 345 | || |||||||| || |||| |||||| |||||||||||||||||||| || |||||| Sbjct: 913 aggccagcgaggccgccgccgacgagcgggccgacccagtagacccagtttccggcgaag 854 Query: 346 ttgccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaag 405 | ||| ||||||||||| |||||||||||||||||||||||||||||||| ||||||||| Sbjct: 853 tcgcccgcggcgacggcggggccgaaggagcgggcggggttcatggagccgccgctgaag 794 Query: 406 gggccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtg 465 || || ||||||||||||||||||||||| ||||| ||||| |||||||||||||||||| Sbjct: 793 ggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtg 734 Query: 466 ccgagggaccccttcttggggtc 488 ||||| || |||||||||||||| Sbjct: 733 ccgagcgagcccttcttggggtc 711
>gb|AY105015.1| Zea mays PCO137646 mRNA sequence Length = 1238 Score = 280 bits (141), Expect = 4e-72 Identities = 233/263 (88%), Gaps = 3/263 (1%) Strand = Plus / Minus Query: 229 gcgtagtcctggtcggcgactggctggtaggacgcg---atgaacacgtcgccgtacacg 285 |||||||||||||| ||||| |||||||||| || ||||| ||||||||||| ||| Sbjct: 972 gcgtagtcctggtccgcgacctgctggtaggagccgccaatgaagacgtcgccgtagacg 913 Query: 286 aacccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaag 345 | || |||||||| || |||| |||||| |||||||||||||||||||| || |||||| Sbjct: 912 aggccagcgaggccgccgccgacgagcgggccgacccagtagacccagtttccggcgaag 853 Query: 346 ttgccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaag 405 | ||| ||||||||||| |||||||||||||||||||||||||||||||| ||||||||| Sbjct: 852 tcgcccgcggcgacggcggggccgaaggagcgggcggggttcatggagccgccgctgaag 793 Query: 406 gggccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtg 465 || || ||||||||||||||||||||||| ||||| ||||| |||||||||||||||||| Sbjct: 792 ggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtg 733 Query: 466 ccgagggaccccttcttggggtc 488 ||||| || |||||||||||||| Sbjct: 732 ccgagcgagcccttcttggggtc 710
>gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds Length = 968 Score = 278 bits (140), Expect = 2e-71 Identities = 218/244 (89%) Strand = Plus / Minus Query: 245 cgactggctggtaggacgcgatgaacacgtcgccgtacacgaacccggcgaggccacctc 304 |||| ||||||||||| |||||||||||||||||||| ||| ||| || |||||||| | Sbjct: 730 cgaccggctggtaggaggcgatgaacacgtcgccgtagacgggccccgccaggccaccgc 671 Query: 305 cgatgagcggcccgacccagtagacccagttgccagcgaagttgccggcggcgacggccg 364 ||| ||| || ||||||||||| ||||||||||| |||||||| ||||| || ||||| | Sbjct: 670 cgacgagggggccgacccagtacacccagttgccggcgaagttaccggccgccacggcgg 611 Query: 365 ggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgaggatgt 424 |||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||| Sbjct: 610 ggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccaggatgt 551 Query: 425 tggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggaccccttcttgg 484 |||||||||| ||||| ||||| || ||||||||||||||||| |||||||||||||| | Sbjct: 550 tggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggaccccttcttcg 491 Query: 485 ggtc 488 |||| Sbjct: 490 ggtc 487
>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17, complete sequence Length = 127259 Score = 246 bits (124), Expect = 6e-62 Identities = 214/244 (87%) Strand = Plus / Plus Query: 245 cgactggctggtaggacgcgatgaacacgtcgccgtacacgaacccggcgaggccacctc 304 |||| ||||||||||| ||||||||||||||| |||| |||| |||||| |||||||| | Sbjct: 92449 cgaccggctggtaggaggcgatgaacacgtcgtcgtagacgagcccggccaggccaccac 92508 Query: 305 cgatgagcggcccgacccagtagacccagttgccagcgaagttgccggcggcgacggccg 364 |||| || || ||||||||||| ||||||||||| |||||||||||||| |||||||||| Sbjct: 92509 cgatcagtgggccgacccagtacacccagttgccggcgaagttgccggccgcgacggccg 92568 Query: 365 ggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgaggatgt 424 |||||||||||||||| ||||||||||| | ||||| ||||| || || || ||||||| Sbjct: 92569 ggccgaaggagcgggcagggttcatggaactgccgctaaagggccccgccgccaggatgt 92628 Query: 425 tggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggaccccttcttgg 484 |||| ||||| ||||| ||||| || |||||||||| |||||||||||| |||||||| | Sbjct: 92629 tggcaccgacgatgaagccgatggccatgggcgcgacggtgccgagggaacccttcttcg 92688 Query: 485 ggtc 488 |||| Sbjct: 92689 ggtc 92692
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 246 bits (124), Expect = 6e-62 Identities = 214/244 (87%) Strand = Plus / Plus Query: 245 cgactggctggtaggacgcgatgaacacgtcgccgtacacgaacccggcgaggccacctc 304 |||| ||||||||||| ||||||||||||||| |||| |||| |||||| |||||||| | Sbjct: 27568473 cgaccggctggtaggaggcgatgaacacgtcgtcgtagacgagcccggccaggccaccac 27568532 Query: 305 cgatgagcggcccgacccagtagacccagttgccagcgaagttgccggcggcgacggccg 364 |||| || || ||||||||||| ||||||||||| |||||||||||||| |||||||||| Sbjct: 27568533 cgatcagtgggccgacccagtacacccagttgccggcgaagttgccggccgcgacggccg 27568592 Query: 365 ggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgaggatgt 424 |||||||||||||||| ||||||||||| | ||||| ||||| || || || ||||||| Sbjct: 27568593 ggccgaaggagcgggcagggttcatggaactgccgctaaagggccccgccgccaggatgt 27568652 Query: 425 tggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggaccccttcttgg 484 |||| ||||| ||||| ||||| || |||||||||| |||||||||||| |||||||| | Sbjct: 27568653 tggcaccgacgatgaagccgatggccatgggcgcgacggtgccgagggaacccttcttcg 27568712 Query: 485 ggtc 488 |||| Sbjct: 27568713 ggtc 27568716 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 304 ccgatgagcggcccgacccagtagacccagt 334 |||||||||||||||| |||||| ||||||| Sbjct: 26354828 ccgatgagcggcccgagccagtaaacccagt 26354798
>ref|XM_473424.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2307 Score = 244 bits (123), Expect = 2e-61 Identities = 210/239 (87%) Strand = Plus / Minus Query: 250 ggctggtaggacgcgatgaacacgtcgccgtacacgaacccggcgaggccacctccgatg 309 ||||||||||| ||||||||||||||| |||| |||| |||||| |||||||| ||||| Sbjct: 725 ggctggtaggaggcgatgaacacgtcgtcgtagacgagcccggccaggccaccaccgatc 666 Query: 310 agcggcccgacccagtagacccagttgccagcgaagttgccggcggcgacggccgggccg 369 || || ||||||||||| ||||||||||| |||||||||||||| ||||||||||||||| Sbjct: 665 agtgggccgacccagtacacccagttgccggcgaagttgccggccgcgacggccgggccg 606 Query: 370 aaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgaggatgttggcg 429 ||||||||||| ||||||||||| | ||||| ||||| || || || ||||||||||| Sbjct: 605 aaggagcgggcagggttcatggaactgccgctaaagggccccgccgccaggatgttggca 546 Query: 430 ccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggaccccttcttggggtc 488 ||||| ||||| ||||| || |||||||||| |||||||||||| |||||||| ||||| Sbjct: 545 ccgacgatgaagccgatggccatgggcgcgacggtgccgagggaacccttcttcgggtc 487
>gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;3 mRNA, complete cds Length = 829 Score = 190 bits (96), Expect = 3e-45 Identities = 174/200 (87%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 |||||||||||||| ||||||||||| ||| ||||||||| |||| || | ||||| | Sbjct: 734 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 675 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||| ||| ||||| |||||||||||||| || ||||||||||| || ||| ||||||| Sbjct: 674 ccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggagaagggg 615 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||| ||||||||||||||||||| ||||| ||||| ||||| || |||||||||||| Sbjct: 614 ccggcgacgaggatgttggcgccgacgatgaagccgatggcgattggagcgatggtgccg 555 Query: 469 agggaccccttcttggggtc 488 |||||||||||||||||||| Sbjct: 554 agggaccccttcttggggtc 535
>gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;1 mRNA, complete cds Length = 817 Score = 190 bits (96), Expect = 3e-45 Identities = 174/200 (87%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 |||||||||||||| ||||||||||| ||| |||||||||||||| || | ||||| | Sbjct: 738 ccggcgaggccaccgccgatgagcgggccggcccagtagacccagatgttggtgaagtcg 679 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||| ||| ||||| |||||||||||||| || ||||||||||| || ||| ||||||| Sbjct: 678 ccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggagaagggg 619 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 ||||| ||||||||||||||||||| ||||| ||||| |||||||| |||||||||||| Sbjct: 618 ccggccacgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatggtgccg 559 Query: 469 agggaccccttcttggggtc 488 ||||| |||||||||||||| Sbjct: 558 agggatcccttcttggggtc 539
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 190 bits (96), Expect = 3e-45 Identities = 174/200 (87%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||||||||| || |||| ||| || ||||||||||||| |||| || | | ||| | Sbjct: 13251072 ccggcgaggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcg 13251013 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||| ||||||||| |||||||||||||| || |||||||||||||| ||| ||||||| Sbjct: 13251012 ccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagggg 13250953 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||| ||||||||||||||||||| ||||| ||||| ||||||||||||||||||||| Sbjct: 13250952 ccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccg 13250893 Query: 469 agggaccccttcttggggtc 488 || ||||||||||||||||| Sbjct: 13250892 agcgaccccttcttggggtc 13250873
>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0427E01 Length = 146395 Score = 190 bits (96), Expect = 3e-45 Identities = 174/200 (87%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||||||||| || |||| ||| || ||||||||||||| |||| || | | ||| | Sbjct: 12882 ccggcgaggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcg 12823 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||| ||||||||| |||||||||||||| || |||||||||||||| ||| ||||||| Sbjct: 12822 ccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagggg 12763 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||| ||||||||||||||||||| ||||| ||||| ||||||||||||||||||||| Sbjct: 12762 ccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccg 12703 Query: 469 agggaccccttcttggggtc 488 || ||||||||||||||||| Sbjct: 12702 agcgaccccttcttggggtc 12683
>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0012F14 Length = 168629 Score = 190 bits (96), Expect = 3e-45 Identities = 174/200 (87%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||||||||| || |||| ||| || ||||||||||||| |||| || | | ||| | Sbjct: 168260 ccggcgaggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcg 168201 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||| ||||||||| |||||||||||||| || |||||||||||||| ||| ||||||| Sbjct: 168200 ccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagggg 168141 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||| ||||||||||||||||||| ||||| ||||| ||||||||||||||||||||| Sbjct: 168140 ccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccg 168081 Query: 469 agggaccccttcttggggtc 488 || ||||||||||||||||| Sbjct: 168080 agcgaccccttcttggggtc 168061
>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full insert sequence Length = 1194 Score = 190 bits (96), Expect = 3e-45 Identities = 174/200 (87%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||||||||| || |||| ||| || ||||||||||||| |||| || | | ||| | Sbjct: 772 ccggcgaggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcg 713 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||| ||||||||| |||||||||||||| || |||||||||||||| ||| ||||||| Sbjct: 712 ccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagggg 653 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||| ||||||||||||||||||| ||||| ||||| ||||||||||||||||||||| Sbjct: 652 ccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccg 593 Query: 469 agggaccccttcttggggtc 488 || ||||||||||||||||| Sbjct: 592 agcgaccccttcttggggtc 573
>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full insert sequence Length = 1214 Score = 190 bits (96), Expect = 3e-45 Identities = 174/200 (87%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||||||||| || |||| ||| || ||||||||||||| |||| || | | ||| | Sbjct: 774 ccggcgaggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcg 715 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||| ||||||||| |||||||||||||| || |||||||||||||| ||| ||||||| Sbjct: 714 ccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagggg 655 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||| ||||||||||||||||||| ||||| ||||| ||||||||||||||||||||| Sbjct: 654 ccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccg 595 Query: 469 agggaccccttcttggggtc 488 || ||||||||||||||||| Sbjct: 594 agcgaccccttcttggggtc 575
>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full insert sequence Length = 1074 Score = 190 bits (96), Expect = 3e-45 Identities = 174/200 (87%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||||||||| || |||| ||| || ||||||||||||| |||| || | | ||| | Sbjct: 652 ccggcgaggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcg 593 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||| ||||||||| |||||||||||||| || |||||||||||||| ||| ||||||| Sbjct: 592 ccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagggg 533 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||| ||||||||||||||||||| ||||| ||||| ||||||||||||||||||||| Sbjct: 532 ccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccg 473 Query: 469 agggaccccttcttggggtc 488 || ||||||||||||||||| Sbjct: 472 agcgaccccttcttggggtc 453
>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full insert sequence Length = 1197 Score = 190 bits (96), Expect = 3e-45 Identities = 174/200 (87%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||||||||| || |||| ||| || ||||||||||||| |||| || | | ||| | Sbjct: 775 ccggcgaggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcg 716 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||| ||||||||| |||||||||||||| || |||||||||||||| ||| ||||||| Sbjct: 715 ccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagggg 656 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||| ||||||||||||||||||| ||||| ||||| ||||||||||||||||||||| Sbjct: 655 ccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccg 596 Query: 469 agggaccccttcttggggtc 488 || ||||||||||||||||| Sbjct: 595 agcgaccccttcttggggtc 576
>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full insert sequence Length = 1195 Score = 190 bits (96), Expect = 3e-45 Identities = 174/200 (87%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||||||||| || |||| ||| || ||||||||||||| |||| || | | ||| | Sbjct: 773 ccggcgaggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcg 714 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||| ||||||||| |||||||||||||| || |||||||||||||| ||| ||||||| Sbjct: 713 ccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagggg 654 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||| ||||||||||||||||||| ||||| ||||| ||||||||||||||||||||| Sbjct: 653 ccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccg 594 Query: 469 agggaccccttcttggggtc 488 || ||||||||||||||||| Sbjct: 593 agcgaccccttcttggggtc 574
>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full insert sequence Length = 1202 Score = 190 bits (96), Expect = 3e-45 Identities = 174/200 (87%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||||||||| || |||| ||| || ||||||||||||| |||| || | | ||| | Sbjct: 775 ccggcgaggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcg 716 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||| ||||||||| |||||||||||||| || |||||||||||||| ||| ||||||| Sbjct: 715 ccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagggg 656 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||| ||||||||||||||||||| ||||| ||||| ||||||||||||||||||||| Sbjct: 655 ccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccg 596 Query: 469 agggaccccttcttggggtc 488 || ||||||||||||||||| Sbjct: 595 agcgaccccttcttggggtc 576
>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full insert sequence Length = 1220 Score = 190 bits (96), Expect = 3e-45 Identities = 174/200 (87%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||||||||| || |||| ||| || ||||||||||||| |||| || | | ||| | Sbjct: 773 ccggcgaggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcg 714 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||| ||||||||| |||||||||||||| || |||||||||||||| ||| ||||||| Sbjct: 713 ccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagggg 654 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||| ||||||||||||||||||| ||||| ||||| ||||||||||||||||||||| Sbjct: 653 ccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccg 594 Query: 469 agggaccccttcttggggtc 488 || ||||||||||||||||| Sbjct: 593 agcgaccccttcttggggtc 574
>gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;2 mRNA, complete cds Length = 853 Score = 182 bits (92), Expect = 7e-43 Identities = 173/200 (86%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 |||||||||||||| ||||||||||| ||| ||||||||| |||| || | ||||| | Sbjct: 737 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 678 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||| ||| ||||| |||||||||||||| || ||||||||||| || ||| ||||||| Sbjct: 677 ccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggagaagggg 618 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 ||||| ||||||||||||||||||| ||||| ||||| |||||||| |||||||||||| Sbjct: 617 ccggcaacgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatggtgccg 558 Query: 469 agggaccccttcttggggtc 488 ||||| |||||||||||||| Sbjct: 557 agggaacccttcttggggtc 538
>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full insert sequence Length = 1196 Score = 182 bits (92), Expect = 7e-43 Identities = 173/200 (86%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||||||||| || |||| ||| || ||||||||||||| |||| || | | ||| | Sbjct: 774 ccggcgaggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcg 715 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||| ||||||||| || ||||||||||| || |||||||||||||| ||| ||||||| Sbjct: 714 ccgctggcgacggcgggaccgaaggagcgcgccgggttcatggagccgccggagaagggg 655 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||| ||||||||||||||||||| ||||| ||||| ||||||||||||||||||||| Sbjct: 654 ccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccg 595 Query: 469 agggaccccttcttggggtc 488 || ||||||||||||||||| Sbjct: 594 agcgaccccttcttggggtc 575
>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA, complete cds Length = 1067 Score = 174 bits (88), Expect = 2e-40 Identities = 172/200 (86%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 |||||||||||||| ||||||||||| ||| ||||||| ||||| || | ||||| | Sbjct: 740 ccggcgaggccaccgccgatgagcgggccggcccagtaaacccaaatgttggtgaagtcg 681 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||| ||| ||||| |||||||||||||| || ||||||||||| || ||| |||||| Sbjct: 680 ccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggaaaagggg 621 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 ||||| ||||||||||||||||||||||||| ||||| |||||||| |||||||||||| Sbjct: 620 ccggccacgaggatgttggcgccgacaatgaagccgatggcgatgggggcgatggtgccg 561 Query: 469 agggaccccttcttggggtc 488 ||||| |||||||||||||| Sbjct: 560 agggatcccttcttggggtc 541
>gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral protein ZmTIP1-2 mRNA, complete cds Length = 1021 Score = 115 bits (58), Expect = 1e-22 Identities = 115/134 (85%) Strand = Plus / Minus Query: 356 cgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcgg 415 |||||||||||||||||||| |||||||||||||||| | ||| ||||| ||| | | Sbjct: 639 cgacggccgggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccccccg 580 Query: 416 cgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggacc 475 | ||||||||||||||||| ||||| ||||| ||||||||||||||| ||||||| | Sbjct: 579 ccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatgacgccgaggtcgc 520 Query: 476 ccttcttggggtcc 489 |||||||||||||| Sbjct: 519 ccttcttggggtcc 506
>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein Length = 1020 Score = 113 bits (57), Expect = 6e-22 Identities = 108/125 (86%) Strand = Plus / Minus Query: 364 gggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgaggatg 423 |||||||||||| ||||||||||||||| | ||| ||||| |||| || |||||||| Sbjct: 677 gggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatg 618 Query: 424 ttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggaccccttcttg 483 ||||||||||| ||||| ||||| |||||||||||||||||||| ||| ||||||||| Sbjct: 617 ttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttg 558 Query: 484 gggtc 488 ||||| Sbjct: 557 gggtc 553 Score = 48.1 bits (24), Expect = 0.027 Identities = 39/44 (88%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagaccca 332 ||||||||||| || |||||||| || ||||||||||| ||||| Sbjct: 752 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 709
>ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 759 Score = 109 bits (55), Expect = 9e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 356 cgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcgg 415 ||||||| |||||||||||| |||||||||||||||| | ||| ||||| |||| ||| Sbjct: 625 cgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccgg 566 Query: 416 cgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatg 462 ||||||||||||||||||| ||||| ||||| |||||||| |||||| Sbjct: 565 cgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 519
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 109 bits (55), Expect = 9e-21 Identities = 94/107 (87%) Strand = Plus / Plus Query: 356 cgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcgg 415 ||||||| |||||||||||| |||||||||||||||| | ||| ||||| |||| ||| Sbjct: 43108802 cgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccgg 43108861 Query: 416 cgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatg 462 ||||||||||||||||||| ||||| ||||| |||||||| |||||| Sbjct: 43108862 cgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 43108908 Score = 101 bits (51), Expect = 2e-18 Identities = 78/87 (89%) Strand = Plus / Minus Query: 348 gccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggg 407 ||||||||||| ||||||||||||||||||||| |||||||||||| | ||| | |||| Sbjct: 7297487 gccggcggcgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtaggg 7297428 Query: 408 gccggcggcgaggatgttggcgccgac 434 ||| |||||||||||||||||||||| Sbjct: 7297427 cccgccggcgaggatgttggcgccgac 7297401 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 310 agcggcccgacccagtagacccagt 334 ||||||||||||||||||||||||| Sbjct: 7302424 agcggcccgacccagtagacccagt 7302400
>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0459B04 Length = 142475 Score = 109 bits (55), Expect = 9e-21 Identities = 94/107 (87%) Strand = Plus / Plus Query: 356 cgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcgg 415 ||||||| |||||||||||| |||||||||||||||| | ||| ||||| |||| ||| Sbjct: 105831 cgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccgg 105890 Query: 416 cgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatg 462 ||||||||||||||||||| ||||| ||||| |||||||| |||||| Sbjct: 105891 cgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 105937
>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full insert sequence Length = 1346 Score = 109 bits (55), Expect = 9e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 356 cgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcgg 415 ||||||| |||||||||||| |||||||||||||||| | ||| ||||| |||| ||| Sbjct: 649 cgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccgg 590 Query: 416 cgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatg 462 ||||||||||||||||||| ||||| ||||| |||||||| |||||| Sbjct: 589 cgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 543
>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full insert sequence Length = 1149 Score = 109 bits (55), Expect = 9e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 356 cgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcgg 415 ||||||| |||||||||||| |||||||||||||||| | ||| ||||| |||| ||| Sbjct: 698 cgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccgg 639 Query: 416 cgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatg 462 ||||||||||||||||||| ||||| ||||| |||||||| |||||| Sbjct: 638 cgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 592
>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast intrinsic protein, complete cds Length = 970 Score = 109 bits (55), Expect = 9e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 356 cgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcgg 415 ||||||| |||||||||||| |||||||||||||||| | ||| ||||| |||| ||| Sbjct: 635 cgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccgg 576 Query: 416 cgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatg 462 ||||||||||||||||||| ||||| ||||| |||||||| |||||| Sbjct: 575 cgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 529
>ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 753 Score = 105 bits (53), Expect = 1e-19 Identities = 110/129 (85%) Strand = Plus / Minus Query: 360 ggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgag 419 |||||||||||||||| ||| |||||||||||| | ||| ||| | |||| || |||| Sbjct: 618 ggccgggccgaaggagacggccgggttcatggaggcgccgtcgaacgcgccgccgacgag 559 Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggacccctt 479 |||||| |||||||| ||||| ||||| |||||||| ||||||||||||||| ||||| Sbjct: 558 gatgttcgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctgccctt 499 Query: 480 cttggggtc 488 ||||||||| Sbjct: 498 cttggggtc 490 Score = 48.1 bits (24), Expect = 0.027 Identities = 39/44 (88%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagaccca 332 |||||||||||||| |||||||| || || |||||||| ||||| Sbjct: 689 ccggcgaggccaccgccgatgagtgggccaacccagtacaccca 646
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 105 bits (53), Expect = 1e-19 Identities = 110/129 (85%) Strand = Plus / Plus Query: 360 ggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgag 419 |||||||||||||||| ||| |||||||||||| | ||| ||| | |||| || |||| Sbjct: 2544864 ggccgggccgaaggagacggccgggttcatggaggcgccgtcgaacgcgccgccgacgag 2544923 Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggacccctt 479 |||||| |||||||| ||||| ||||| |||||||| ||||||||||||||| ||||| Sbjct: 2544924 gatgttcgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctgccctt 2544983 Query: 480 cttggggtc 488 ||||||||| Sbjct: 2544984 cttggggtc 2544992 Score = 48.1 bits (24), Expect = 0.027 Identities = 39/44 (88%) Strand = Plus / Plus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagaccca 332 |||||||||||||| |||||||| || || |||||||| ||||| Sbjct: 2544793 ccggcgaggccaccgccgatgagtgggccaacccagtacaccca 2544836 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 410 cggcggcgaggatgttggcg 429 |||||||||||||||||||| Sbjct: 30271155 cggcggcgaggatgttggcg 30271136
>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0067N01, from chromosome 3, complete sequence Length = 159636 Score = 105 bits (53), Expect = 1e-19 Identities = 110/129 (85%) Strand = Plus / Minus Query: 360 ggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgag 419 |||||||||||||||| ||| |||||||||||| | ||| ||| | |||| || |||| Sbjct: 125230 ggccgggccgaaggagacggccgggttcatggaggcgccgtcgaacgcgccgccgacgag 125171 Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggacccctt 479 |||||| |||||||| ||||| ||||| |||||||| ||||||||||||||| ||||| Sbjct: 125170 gatgttcgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctgccctt 125111 Query: 480 cttggggtc 488 ||||||||| Sbjct: 125110 cttggggtc 125102 Score = 48.1 bits (24), Expect = 0.027 Identities = 39/44 (88%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagaccca 332 |||||||||||||| |||||||| || || |||||||| ||||| Sbjct: 125301 ccggcgaggccaccgccgatgagtgggccaacccagtacaccca 125258
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 105 bits (53), Expect = 1e-19 Identities = 110/129 (85%) Strand = Plus / Plus Query: 360 ggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgag 419 |||||||||||||||| ||| |||||||||||| | ||| ||| | |||| || |||| Sbjct: 2544974 ggccgggccgaaggagacggccgggttcatggaggcgccgtcgaacgcgccgccgacgag 2545033 Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggacccctt 479 |||||| |||||||| ||||| ||||| |||||||| ||||||||||||||| ||||| Sbjct: 2545034 gatgttcgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctgccctt 2545093 Query: 480 cttggggtc 488 ||||||||| Sbjct: 2545094 cttggggtc 2545102 Score = 48.1 bits (24), Expect = 0.027 Identities = 39/44 (88%) Strand = Plus / Plus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagaccca 332 |||||||||||||| |||||||| || || |||||||| ||||| Sbjct: 2544903 ccggcgaggccaccgccgatgagtgggccaacccagtacaccca 2544946 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 410 cggcggcgaggatgttggcg 429 |||||||||||||||||||| Sbjct: 30362577 cggcggcgaggatgttggcg 30362558
>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds Length = 1080 Score = 105 bits (53), Expect = 1e-19 Identities = 110/129 (85%) Strand = Plus / Minus Query: 360 ggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgag 419 |||||||||||||||| ||| |||||||||||| | ||| ||| | |||| || |||| Sbjct: 696 ggccgggccgaaggagacggccgggttcatggaggcgccgtcgaacgcgccgccgacgag 637 Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggacccctt 479 |||||| |||||||| ||||| ||||| |||||||| ||||||||||||||| ||||| Sbjct: 636 gatgttcgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctgccctt 577 Query: 480 cttggggtc 488 ||||||||| Sbjct: 576 cttggggtc 568 Score = 48.1 bits (24), Expect = 0.027 Identities = 39/44 (88%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagaccca 332 |||||||||||||| |||||||| || || |||||||| ||||| Sbjct: 767 ccggcgaggccaccgccgatgagtgggccaacccagtacaccca 724
>dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-E06, full insert sequence Length = 1024 Score = 105 bits (53), Expect = 1e-19 Identities = 110/129 (85%) Strand = Plus / Plus Query: 360 ggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgag 419 |||||||||||||||| ||| |||||||||||| | ||| ||| | |||| || |||| Sbjct: 273 ggccgggccgaaggagacggccgggttcatggaggcgccgtcgaacgcgccgccgacgag 332 Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggacccctt 479 |||||| |||||||| ||||| ||||| |||||||| ||||||||||||||| ||||| Sbjct: 333 gatgttcgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctgccctt 392 Query: 480 cttggggtc 488 ||||||||| Sbjct: 393 cttggggtc 401
>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full insert sequence Length = 1034 Score = 105 bits (53), Expect = 1e-19 Identities = 110/129 (85%) Strand = Plus / Minus Query: 360 ggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgag 419 |||||||||||||||| ||| |||||||||||| | ||| ||| | |||| || |||| Sbjct: 705 ggccgggccgaaggagacggccgggttcatggaggcgccgtcgaacgcgccgccgacgag 646 Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggacccctt 479 |||||| |||||||| ||||| ||||| |||||||| ||||||||||||||| ||||| Sbjct: 645 gatgttcgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctgccctt 586 Query: 480 cttggggtc 488 ||||||||| Sbjct: 585 cttggggtc 577 Score = 48.1 bits (24), Expect = 0.027 Identities = 39/44 (88%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagaccca 332 |||||||||||||| |||||||| || || |||||||| ||||| Sbjct: 776 ccggcgaggccaccgccgatgagtgggccaacccagtacaccca 733
>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full insert sequence Length = 1082 Score = 105 bits (53), Expect = 1e-19 Identities = 110/129 (85%) Strand = Plus / Minus Query: 360 ggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgag 419 |||||||||||||||| ||| |||||||||||| | ||| ||| | |||| || |||| Sbjct: 707 ggccgggccgaaggagacggccgggttcatggaggcgccgtcgaacgcgccgccgacgag 648 Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggacccctt 479 |||||| |||||||| ||||| ||||| |||||||| ||||||||||||||| ||||| Sbjct: 647 gatgttcgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctgccctt 588 Query: 480 cttggggtc 488 ||||||||| Sbjct: 587 cttggggtc 579 Score = 48.1 bits (24), Expect = 0.027 Identities = 39/44 (88%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagaccca 332 |||||||||||||| |||||||| || || |||||||| ||||| Sbjct: 778 ccggcgaggccaccgccgatgagtgggccaacccagtacaccca 735
>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full insert sequence Length = 551 Score = 105 bits (53), Expect = 1e-19 Identities = 110/129 (85%) Strand = Plus / Minus Query: 360 ggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgag 419 |||||||||||||||| ||| |||||||||||| | ||| ||| | |||| || |||| Sbjct: 231 ggccgggccgaaggagacggccgggttcatggaggcgccgtcgaacgcgccgccgacgag 172 Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggacccctt 479 |||||| |||||||| ||||| ||||| |||||||| ||||||||||||||| ||||| Sbjct: 171 gatgttcgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctgccctt 112 Query: 480 cttggggtc 488 ||||||||| Sbjct: 111 cttggggtc 103 Score = 48.1 bits (24), Expect = 0.027 Identities = 39/44 (88%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagaccca 332 |||||||||||||| |||||||| || || |||||||| ||||| Sbjct: 302 ccggcgaggccaccgccgatgagtgggccaacccagtacaccca 259
>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full insert sequence Length = 1055 Score = 105 bits (53), Expect = 1e-19 Identities = 110/129 (85%) Strand = Plus / Minus Query: 360 ggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgag 419 |||||||||||||||| ||| |||||||||||| | ||| ||| | |||| || |||| Sbjct: 703 ggccgggccgaaggagacggccgggttcatggaggcgccgtcgaacgcgccgccgacgag 644 Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggacccctt 479 |||||| |||||||| ||||| ||||| |||||||| ||||||||||||||| ||||| Sbjct: 643 gatgttcgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctgccctt 584 Query: 480 cttggggtc 488 ||||||||| Sbjct: 583 cttggggtc 575 Score = 48.1 bits (24), Expect = 0.027 Identities = 39/44 (88%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagaccca 332 |||||||||||||| |||||||| || || |||||||| ||||| Sbjct: 774 ccggcgaggccaccgccgatgagtgggccaacccagtacaccca 731
>emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein Length = 1007 Score = 103 bits (52), Expect = 5e-19 Identities = 163/200 (81%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||| ||||| ||||||||||| || ||||||||||| ||||||||| | | ||||| Sbjct: 763 ccggcaaggccgcctccgatgagggggccgacccagtacacccagttgtcggtgaagtct 704 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||| | || || ||| |||||||||||||||||||||||||||| || ||||||| Sbjct: 703 ccgctcacaacagcagggtcgaaggagcgggcggggttcatggagccgccagagaagggg 644 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 || ||||| | |||||||||||| || ||||| || || || ||||| ||||||||||| Sbjct: 643 cccgcggccaagatgttggcgcccacgatgaagccaatagcaatgggagcgatggtgccc 584 Query: 469 agggaccccttcttggggtc 488 ||| |||||||| ||||| Sbjct: 583 aggtcgcccttcttcgggtc 564
>ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa8227 predicted mRNA Length = 756 Score = 101 bits (51), Expect = 2e-18 Identities = 78/87 (89%) Strand = Plus / Minus Query: 348 gccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggg 407 ||||||||||| ||||||||||||||||||||| |||||||||||| | ||| | |||| Sbjct: 624 gccggcggcgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtaggg 565 Query: 408 gccggcggcgaggatgttggcgccgac 434 ||| |||||||||||||||||||||| Sbjct: 564 cccgccggcgaggatgttggcgccgac 538
>dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0431F01 Length = 143209 Score = 101 bits (51), Expect = 2e-18 Identities = 78/87 (89%) Strand = Plus / Minus Query: 348 gccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggg 407 ||||||||||| ||||||||||||||||||||| |||||||||||| | ||| | |||| Sbjct: 98917 gccggcggcgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtaggg 98858 Query: 408 gccggcggcgaggatgttggcgccgac 434 ||| |||||||||||||||||||||| Sbjct: 98857 cccgccggcgaggatgttggcgccgac 98831 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 310 agcggcccgacccagtagacccagt 334 ||||||||||||||||||||||||| Sbjct: 103854 agcggcccgacccagtagacccagt 103830
>dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023007E01, full insert sequence Length = 1112 Score = 101 bits (51), Expect = 2e-18 Identities = 78/87 (89%) Strand = Plus / Minus Query: 348 gccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggg 407 ||||||||||| ||||||||||||||||||||| |||||||||||| | ||| | |||| Sbjct: 627 gccggcggcgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtaggg 568 Query: 408 gccggcggcgaggatgttggcgccgac 434 ||| |||||||||||||||||||||| Sbjct: 567 cccgccggcgaggatgttggcgccgac 541
>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA, complete cds Length = 1133 Score = 91.7 bits (46), Expect = 2e-15 Identities = 106/126 (84%) Strand = Plus / Minus Query: 364 gggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgaggatg 423 |||||||||||| ||||||||||||||| | ||| ||||| |||| | | |||||| Sbjct: 708 gggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgcccaccaggatg 649 Query: 424 ttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggaccccttcttg 483 |||||||| || ||||| ||||| |||||||||||||||||||| ||| ||||||||| Sbjct: 648 ttggcgcccacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttg 589 Query: 484 gggtcc 489 |||||| Sbjct: 588 gggtcc 583 Score = 48.1 bits (24), Expect = 0.027 Identities = 39/44 (88%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagaccca 332 ||||||||||| || |||||||| || ||||||||||| ||||| Sbjct: 783 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 740
>emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic protein (TIP) Length = 1146 Score = 89.7 bits (45), Expect = 8e-15 Identities = 105/125 (84%) Strand = Plus / Minus Query: 364 gggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgaggatg 423 ||||||||||| ||||||||||||||| | ||| ||||| |||| || |||||||| Sbjct: 693 gggccgaaggacacggcggggttcatggacgcgccgtcgaaggcgccgccgacgaggatg 634 Query: 424 ttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggaccccttcttg 483 |||||||| || ||||| ||||| |||||||| ||||||||||| ||| ||||||||| Sbjct: 633 ttggcgcccacgatgaagccgatggcgatgggggcgatggtgcccaggctgcccttcttg 574 Query: 484 gggtc 488 ||||| Sbjct: 573 gggtc 569
>gb|AY112388.1| Zea mays CL24208_1 mRNA sequence Length = 833 Score = 89.7 bits (45), Expect = 8e-15 Identities = 110/134 (82%) Strand = Plus / Plus Query: 356 cgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcgg 415 |||| ||||||||||||||| ||||| |||||||||| | ||| ||||| | | Sbjct: 372 cgacagccgggccgaaggagacggcggngttcatggaggcgccgtcgaaggcgnnnnnng 431 Query: 416 cgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggacc 475 | ||||||||||||||||| ||||| ||||| ||||||||||||||| ||||||| | Sbjct: 432 ccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatgacgccgaggtcgc 491 Query: 476 ccttcttggggtcc 489 |||||||||||||| Sbjct: 492 ccttcttggggtcc 505
>ref|NM_112495.2| Arabidopsis thaliana DELTA-TIP; water channel AT3G16240 (DELTA-TIP) mRNA, complete cds Length = 1125 Score = 81.8 bits (41), Expect = 2e-12 Identities = 158/197 (80%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||| || ||||| |||||||| || || |||||||||||||||| |||| ||||| Sbjct: 796 ccggcaagtccaccaccgatgagtggtccaacccagtagacccagtgaccagagaagtct 737 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||||| || || || || || ||||| || || ||||||||||| || ||| ||| || Sbjct: 736 ccggcagcaacagctggtccaaaggaacgtgctgggttcatggatccaccggagaatgga 677 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||||||||||||||||| || || || | ||| || |||| || |||||||| ||| Sbjct: 676 ccggcggcgaggatgttggcaccaacgataagaccaatggcgagaggagcgatggttccg 617 Query: 469 agggaccccttcttggg 485 || || ||||||||||| Sbjct: 616 agagaacccttcttggg 600
>ref|NM_112496.2| Arabidopsis thaliana electron carrier/ electron transporter/ iron ion binding AT3G16250 mRNA, complete cds Length = 1538 Score = 81.8 bits (41), Expect = 2e-12 Identities = 158/197 (80%) Strand = Plus / Plus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||| || ||||| |||||||| || || |||||||||||||||| |||| ||||| Sbjct: 1079 ccggcaagtccaccaccgatgagtggtccaacccagtagacccagtgaccagagaagtct 1138 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||||| || || || || || ||||| || || ||||||||||| || ||| ||| || Sbjct: 1139 ccggcagcaacagctggtccaaaggaacgtgctgggttcatggatccaccggagaatgga 1198 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||||||||||||||||| || || || | ||| || |||| || |||||||| ||| Sbjct: 1199 ccggcggcgaggatgttggcaccaacgataagaccaatggcgagaggagcgatggttccg 1258 Query: 469 agggaccccttcttggg 485 || || ||||||||||| Sbjct: 1259 agagaacccttcttggg 1275
>emb|BX823177.1|CNS0A5ZD Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB95ZE06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 903 Score = 81.8 bits (41), Expect = 2e-12 Identities = 158/197 (80%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||| || ||||| |||||||| || || |||||||||||||||| |||| ||||| Sbjct: 734 ccggcaagtccaccaccgatgagtggtccaacccagtagacccagtcaccagagaagtct 675 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||||| || || || || || ||||| || || ||||||||||| || ||| ||| || Sbjct: 674 ccggcagcaacagctggtccaaaggaacgtgctgggttcatggatccaccggagaatgga 615 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||||||||||||||||| || || || | ||| || |||| || |||||||| ||| Sbjct: 614 ccggcggcgaggatgttggcaccaacgataagaccaatggcgagaggagcgatggttccg 555 Query: 469 agggaccccttcttggg 485 || || ||||||||||| Sbjct: 554 agagaacccttcttggg 538
>emb|BX823081.1|CNS0A5VY Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB88ZH07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 957 Score = 81.8 bits (41), Expect = 2e-12 Identities = 158/197 (80%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||| || ||||| |||||||| || || |||||||||||||||| |||| ||||| Sbjct: 739 ccggcaagtccaccaccgatgagtggtccaacccagtagacccagtgaccagagaagtct 680 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||||| || || || || || ||||| || || ||||||||||| || ||| ||| || Sbjct: 679 ccggcagcaacagctggtccaaaggaacgtgctgggttcatggatccaccggagaatgga 620 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||||||||||||||||| || || || | ||| || |||| || |||||||| ||| Sbjct: 619 ccggcggcgaggatgttggcaccaacgataagaccaatggcgagaggagcgatggttccg 560 Query: 469 agggaccccttcttggg 485 || || ||||||||||| Sbjct: 559 agagaacccttcttggg 543
>emb|BX823757.1|CNS0A5CX Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS72ZD10 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 945 Score = 81.8 bits (41), Expect = 2e-12 Identities = 158/197 (80%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||| || ||||| |||||||| || || |||||||||||||||| |||| ||||| Sbjct: 736 ccggcaagtccaccaccgatgagtggtccaacccagtagacccagtgaccagagaagtct 677 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||||| || || || || || ||||| || || ||||||||||| || ||| ||| || Sbjct: 676 ccggcagcaacagctggtccaaaggaacgtgctgggttcatggatccaccggagaatgga 617 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||||||||||||||||| || || || | ||| || |||| || |||||||| ||| Sbjct: 616 ccggcggcgaggatgttggcaccaacgataagaccaatggcgagaggagcgatggttccg 557 Query: 469 agggaccccttcttggg 485 || || ||||||||||| Sbjct: 556 agagaacccttcttggg 540
>gb|AY085921.1| Arabidopsis thaliana clone 19689 mRNA, complete sequence Length = 978 Score = 81.8 bits (41), Expect = 2e-12 Identities = 158/197 (80%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||| || ||||| |||||||| || || |||||||||||||||| |||| ||||| Sbjct: 758 ccggcaagtccaccaccgatgagtggtccaacccagtagacccagtgaccagagaagtct 699 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||||| || || || || || ||||| || || ||||||||||| || ||| ||| || Sbjct: 698 ccggcagcaacagctggtccaaaggaacgtgctgggttcatggatccaccggagaatgga 639 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||||||||||||||||| || || || | ||| || |||| || |||||||| ||| Sbjct: 638 ccggcggcgaggatgttggcaccaacgataagaccaatggcgagaggagcgatggttccg 579 Query: 469 agggaccccttcttggg 485 || || ||||||||||| Sbjct: 578 agagaacccttcttggg 562
>dbj|AB023046.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYA6 Length = 75289 Score = 81.8 bits (41), Expect = 2e-12 Identities = 158/197 (80%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||| || ||||| |||||||| || || |||||||||||||||| |||| ||||| Sbjct: 19585 ccggcaagtccaccaccgatgagtggtccaacccagtagacccagtgaccagagaagtct 19526 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||||| || || || || || ||||| || || ||||||||||| || ||| ||| || Sbjct: 19525 ccggcagcaacagctggtccaaaggaacgtgctgggttcatggatccaccggagaatgga 19466 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||||||||||||||||| || || || | ||| || |||| || |||||||| ||| Sbjct: 19465 ccggcggcgaggatgttggcaccaacgataagaccaatggcgagaggagcgatggttccg 19406 Query: 469 agggaccccttcttggg 485 || || ||||||||||| Sbjct: 19405 agagaacccttcttggg 19389
>gb|U39485.1|ATU39485 Arabidopsis thaliana delta tonoplast integral protein mRNA, complete cds Length = 939 Score = 81.8 bits (41), Expect = 2e-12 Identities = 158/197 (80%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttg 348 ||||| || ||||| |||||||| || || |||||||||||||||| |||| ||||| Sbjct: 703 ccggcaagtccaccaccgatgagtggtccaacccagtagacccagtgaccagagaagtct 644 Query: 349 ccggcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaagggg 408 ||||| || || || || || ||||| || || ||||||||||| || ||| ||| || Sbjct: 643 ccggcagcaacagctggtccaaaggaacgtgctgggttcatggatccaccggagaatgga 584 Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||||||||||||||||| || || || | ||| || |||| || |||||||| ||| Sbjct: 583 ccggcggcgaggatgttggcaccaacgataagaccaatggcgagaggagcgatggttccg 524 Query: 469 agggaccccttcttggg 485 || || ||||||||||| Sbjct: 523 agagaacccttcttggg 507
>gb|AY081622.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230) mRNA, complete cds Length = 853 Score = 77.8 bits (39), Expect = 3e-11 Identities = 150/187 (80%) Strand = Plus / Minus Query: 299 cacctccgatgagcggcccgacccagtagacccagttgccagcgaagttgccggcggcga 358 |||| |||||||| || || |||||||||||||||| |||| ||||| ||||| || | Sbjct: 676 caccaccgatgagtggtccaacccagtagacccagtgaccagagaagtctccggcagcaa 617 Query: 359 cggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcga 418 | || || || ||||| || || ||||||||||| || ||| ||| || |||||||||| Sbjct: 616 cagctggtccaaaggaacgtgctgggttcatggatccaccggagaatggaccggcggcga 557 Query: 419 ggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggacccct 478 |||||||||| || || || | ||| || |||| || |||||||| ||||| || |||| Sbjct: 556 ggatgttggcaccaacgataagaccaatggcgagaggagcgatggttccgagagaaccct 497 Query: 479 tcttggg 485 ||||||| Sbjct: 496 tcttggg 490
>gb|AY065181.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230; MYA6.5) mRNA, complete cds Length = 929 Score = 77.8 bits (39), Expect = 3e-11 Identities = 150/187 (80%) Strand = Plus / Minus Query: 299 cacctccgatgagcggcccgacccagtagacccagttgccagcgaagttgccggcggcga 358 |||| |||||||| || || |||||||||||||||| |||| ||||| ||||| || | Sbjct: 747 caccaccgatgagtggtccaacccagtagacccagtgaccagagaagtctccggcagcaa 688 Query: 359 cggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcga 418 | || || || ||||| || || ||||||||||| || ||| ||| || |||||||||| Sbjct: 687 cagctggtccaaaggaacgtgctgggttcatggatccaccggagaatggaccggcggcga 628 Query: 419 ggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggacccct 478 |||||||||| || || || | ||| || |||| || |||||||| ||||| || |||| Sbjct: 627 ggatgttggcaccaacgataagaccaatggcgagaggagcgatggttccgagagaaccct 568 Query: 479 tcttggg 485 ||||||| Sbjct: 567 tcttggg 561
>dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, complete cds Length = 911 Score = 75.8 bits (38), Expect = 1e-10 Identities = 155/194 (79%) Strand = Plus / Minus Query: 292 gcgaggccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttgccg 351 ||||| ||||| |||||||| || || |||||||||||||||| |||| ||||| || Sbjct: 724 gcgagtccaccaccgatgagtggtccaacccagtagacccagtgaccagagaagtctcct 665 Query: 352 gcggcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccg 411 || || || || || || ||||| || || ||||||||||| || || ||| || ||| Sbjct: 664 gctgcaacagctggtccaaaggaacgtgctgggttcatggatccaccagagaatggaccg 605 Query: 412 gcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagg 471 ||||| ||||||||||| ||||| |||| ||| || |||| ||| |||||||| ||||| Sbjct: 604 gcggctaggatgttggcaccgacgatgagaccaatggcgaggggagcgatggttccgaga 545 Query: 472 gaccccttcttggg 485 || ||||| ||||| Sbjct: 544 gaaccctttttggg 531
>gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putative aquaporin TIP1 (TIP1) mRNA, complete cds Length = 1057 Score = 73.8 bits (37), Expect = 5e-10 Identities = 106/129 (82%) Strand = Plus / Minus Query: 297 gccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttgccggcggc 356 ||||||||| || || || || |||||||||| ||||||| | ||||| |||| | | Sbjct: 720 gccacctccaattaggggtcccacccagtagatccagttgtccttgaagtcgccgctgac 661 Query: 357 gacggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggc 416 |||||| |||||||||||||||||||||||||| || || ||| ||| |||||||| || Sbjct: 660 gacggcggggccgaaggagcgggcggggttcattgatccaccggagaatgggccggcagc 601 Query: 417 gaggatgtt 425 |||||||| Sbjct: 600 caggatgtt 592
>gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral protein ZmTIP4-1 mRNA, complete cds Length = 1125 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 360 ggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgag 419 |||||||||||||||||| || ||||||||||| | ||| ||||| |||| ||||||| Sbjct: 766 ggccgggccgaaggagcgtgccgggttcatggacgcgccggtgaagttgccgccggcgag 707 Query: 420 gatgttggcgccgacaatga 439 | ||||||||||||| |||| Sbjct: 706 gctgttggcgccgacgatga 687
>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence Length = 1112 Score = 67.9 bits (34), Expect = 3e-08 Identities = 103/126 (81%) Strand = Plus / Minus Query: 364 gggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgaggatg 423 ||||||||||| ||||||||||||||| | ||| ||||| |||| | | |||||| Sbjct: 711 gggccgaaggacacggcggggttcatggacgcgccgtcgaaggcgccgcccaccaggatg 652 Query: 424 ttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggaccccttcttg 483 |||||||| || ||||| ||||| |||||||| ||||||||||| ||| |||||||| Sbjct: 651 ttggcgcccacgatgaagccgatggcgatgggggcgatggtgcccaggctgcccttcttc 592 Query: 484 gggtcc 489 |||||| Sbjct: 591 gggtcc 586 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagaccca 332 ||||||||||| || |||||||| |||||||||||||| ||||| Sbjct: 786 ccggcgaggccgccgccgatgaggggcccgacccagtacaccca 743
>emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquaporin (delta-TIP gene) Length = 1017 Score = 65.9 bits (33), Expect = 1e-07 Identities = 78/93 (83%) Strand = Plus / Minus Query: 297 gccacctccgatgagcggcccgacccagtagacccagttgccagcgaagttgccggcggc 356 ||||||||| || || || || |||||||||| ||||||| | ||||| |||| | | Sbjct: 678 gccacctccaattaggggtcccacccagtagatccagttgtccttgaagtcgccgctgac 619 Query: 357 gacggccgggccgaaggagcgggcggggttcat 389 |||||| |||||||||||||||||||||||||| Sbjct: 618 gacggcggggccgaaggagcgggcggggttcat 586
>gb|AC183494.1| Brassica oleracea Contig C, complete sequence Length = 285752 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Minus Query: 382 gggttcatggagcccccgctgaaggggccggcggcgaggatgttggcgccgacaatgaaa 441 |||||||||||||| ||||| || || || || |||||||||||||| || || |||||| Sbjct: 123777 gggttcatggagccaccgctaaatggaccagcagcgaggatgttggcaccaacgatgaaa 123718 Query: 442 ccgatcgcgatgggcgcgatggtgccgag 470 || || ||||| || |||||||| ||||| Sbjct: 123717 ccaatagcgattggtgcgatggttccgag 123689
>gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast intrinsic protein (TIP1) mRNA, partial cds Length = 662 Score = 63.9 bits (32), Expect = 5e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 413 cggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgaggg 472 |||| ||||||||||| || || ||||| |||||||||||||||||||| || || ||| Sbjct: 561 cggccaggatgttggcccccacgatgaagccgatcgcgatgggcgcgatcgtccccaggc 502 Query: 473 accccttcttggggtc 488 ||||||||| ||||| Sbjct: 501 tccccttcttcgggtc 486
>gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral protein ZmTIP4-4 mRNA, complete cds Length = 955 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Minus Query: 364 gggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgaggatg 423 |||||||||||||| |||||||||||||| | ||| |||||| ||| ||||||| | | Sbjct: 705 gggccgaaggagcgcgcggggttcatggacgcgccggagaagggcccgccggcgagcacg 646 Query: 424 ttggcgccgac 434 ||||||||||| Sbjct: 645 ttggcgccgac 635 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 304 ccgatgagcggcccgacccagtagacccagt 334 ||||| || |||||||||||||||||||||| Sbjct: 765 ccgataagaggcccgacccagtagacccagt 735
>gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsic protein mRNA, complete cds Length = 997 Score = 60.0 bits (30), Expect = 7e-06 Identities = 99/122 (81%) Strand = Plus / Minus Query: 367 ccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgaggatgttg 426 ||||||||||| || ||||||||||| || || ||| || || ||||| | ||||||| Sbjct: 645 ccgaaggagcgagctgggttcatggatccaccagagaatggaccagcggccaagatgttg 586 Query: 427 gcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggaccccttcttgggg 486 || || |||||||| ||||| || ||||| || ||||| ||||| || |||||||| ||| Sbjct: 585 gcaccaacaatgaagccgatggcaatgggtgcaatggtcccgagtgatcccttctttggg 526 Query: 487 tc 488 || Sbjct: 525 tc 524
>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds Length = 1039 Score = 60.0 bits (30), Expect = 7e-06 Identities = 102/126 (80%) Strand = Plus / Minus Query: 364 gggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgaggatg 423 ||||||||||| ||||||||||||||| | ||| ||||| |||| | | |||||| Sbjct: 615 gggccgaaggacacggcggggttcatggacgcgccgtcgaaggcgccgcccaccaggatg 556 Query: 424 ttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggaccccttcttg 483 ||||| || || ||||| ||||| |||||||| ||||||||||| ||| |||||||| Sbjct: 555 ttggcccccacgatgaagccgatggcgatgggggcgatggtgcccaggctgcccttcttc 496 Query: 484 gggtcc 489 |||||| Sbjct: 495 gggtcc 490 Score = 48.1 bits (24), Expect = 0.027 Identities = 39/44 (88%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagaccca 332 ||||||||||| || |||||||| || ||||||||||| ||||| Sbjct: 690 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 647
>gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water channel protein MipK (MipK) mRNA, complete cds Length = 1076 Score = 60.0 bits (30), Expect = 7e-06 Identities = 99/122 (81%) Strand = Plus / Minus Query: 367 ccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgaggatgttg 426 ||||| |||||||| ||||||||||| || || ||| ||||||||||| | ||||||| Sbjct: 690 ccgaatgagcgggctgggttcatggatccaccagagaatgggccggcggccaagatgttg 631 Query: 427 gcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggaccccttcttgggg 486 || || |||||||| || || || ||||| || |||||||| | || ||| |||||||| Sbjct: 630 gctccaacaatgaacccaatagcaatgggggcaatggtgcccactgagcccctcttgggg 571 Query: 487 tc 488 || Sbjct: 570 tc 569
>gb|U43291.1|MCU43291 Mesembryanthemum crystallinum tonoplast intrinsic protein (TIP) mRNA, complete cds Length = 1235 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagacccagt 334 |||||||| || ||||||||||| || ||||||||||||||||||| Sbjct: 743 ccggcgagccctcctccgatgagtgggccgacccagtagacccagt 698
>ref|NM_117838.2| Arabidopsis thaliana DELTA-TIP2/TIP2;2; water channel AT4G17340 (DELTA-TIP2/TIP2;2) mRNA, complete cds Length = 977 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 382 gggttcatggagcccccgctgaaggggccggcggcgaggatgttggcgccgacaatgaaa 441 ||||||||||| || ||||| ||||| || || |||||||||||||| || || |||||| Sbjct: 658 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 599 Query: 442 ccgat 446 ||||| Sbjct: 598 ccgat 594
>emb|Z48232.1|PCRB7PRJ P.crispum mRNA for membrane intrinsic protein Length = 954 Score = 58.0 bits (29), Expect = 3e-05 Identities = 92/113 (81%) Strand = Plus / Minus Query: 376 cgggcggggttcatggagcccccgctgaaggggccggcggcgaggatgttggcgccgaca 435 |||||||||||||| ||||| |||||||| || || || || | |||||| || || ||| Sbjct: 646 cgggcggggttcattgagccaccgctgaaaggaccagcagccaagatgtttgcaccaaca 587 Query: 436 atgaaaccgatcgcgatgggcgcgatggtgccgagggaccccttcttggggtc 488 ||||| || || || ||||| || ||||| || || || |||||||||||||| Sbjct: 586 atgaagccaattgcaatgggtgcaatggttccaagtgagcccttcttggggtc 534
>emb|Z97343.1|ATFCA8 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 8 Length = 207674 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 382 gggttcatggagcccccgctgaaggggccggcggcgaggatgttggcgccgacaatgaaa 441 ||||||||||| || ||||| ||||| || || |||||||||||||| || || |||||| Sbjct: 64861 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 64802 Query: 442 ccgat 446 ||||| Sbjct: 64801 ccgat 64797
>emb|AL161546.2|ATCHRIV46 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 46 Length = 198788 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 382 gggttcatggagcccccgctgaaggggccggcggcgaggatgttggcgccgacaatgaaa 441 ||||||||||| || ||||| ||||| || || |||||||||||||| || || |||||| Sbjct: 54226 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 54167 Query: 442 ccgat 446 ||||| Sbjct: 54166 ccgat 54162
>gb|AY056063.1| Arabidopsis thaliana AT4g17340/dl4705w mRNA, complete cds Length = 753 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 382 gggttcatggagcccccgctgaaggggccggcggcgaggatgttggcgccgacaatgaaa 441 ||||||||||| || ||||| ||||| || || |||||||||||||| || || |||||| Sbjct: 593 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 534 Query: 442 ccgat 446 ||||| Sbjct: 533 ccgat 529
>gb|AF367283.1|AF367283 Arabidopsis thaliana AT4g17340/dl4705w mRNA, complete cds Length = 972 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 382 gggttcatggagcccccgctgaaggggccggcggcgaggatgttggcgccgacaatgaaa 441 ||||||||||| || ||||| ||||| || || |||||||||||||| || || |||||| Sbjct: 655 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 596 Query: 442 ccgat 446 ||||| Sbjct: 595 ccgat 591
>gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral protein ZmTIP5-1 mRNA, complete cds Length = 1021 Score = 58.0 bits (29), Expect = 3e-05 Identities = 35/37 (94%) Strand = Plus / Minus Query: 356 cgacggccgggccgaaggagcgggcggggttcatgga 392 |||||||||||||||| |||||||| ||||||||||| Sbjct: 704 cgacggccgggccgaacgagcgggccgggttcatgga 668
>emb|BX825196.1|CNS0A4OU Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL1ZB11 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 954 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 382 gggttcatggagcccccgctgaaggggccggcggcgaggatgttggcgccgacaatgaaa 441 ||||||||||| || ||||| ||||| || || |||||||||||||| || || |||||| Sbjct: 641 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 582 Query: 442 ccgat 446 ||||| Sbjct: 581 ccgat 577
>emb|BX828364.1|CNS0A340 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH80ZD07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 936 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 382 gggttcatggagcccccgctgaaggggccggcggcgaggatgttggcgccgacaatgaaa 441 ||||||||||| || ||||| ||||| || || |||||||||||||| || || |||||| Sbjct: 616 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 557 Query: 442 ccgat 446 ||||| Sbjct: 556 ccgat 552
>gb|AY088929.1| Arabidopsis thaliana clone 99796 mRNA, complete sequence Length = 969 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 382 gggttcatggagcccccgctgaaggggccggcggcgaggatgttggcgccgacaatgaaa 441 ||||||||||| || ||||| ||||| || || |||||||||||||| || || |||||| Sbjct: 659 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 600 Query: 442 ccgat 446 ||||| Sbjct: 599 ccgat 595
>dbj|AB048248.1| Pyrus communis Py-gTIP mRNA for gamma tonoplast intrinsic protein, complete cds Length = 1122 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 421 atgttggcgccgacaatgaaaccgatcgcgatgggcgcgat 461 ||||||||||| || |||||||| ||||||||||||||||| Sbjct: 631 atgttggcgccaacgatgaaaccaatcgcgatgggcgcgat 591
>ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT5G47450 (AtTIP2;3) mRNA, complete cds Length = 1051 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 385 ttcatggagcccccgctgaaggggccggcggcgaggatgttggcgccgacaatgaaaccg 444 ||||||||||| || ||||| || || || |||||||||||||| || || ||||| ||| Sbjct: 628 ttcatggagccaccactgaatggaccagcagcgaggatgttggcaccaactatgaagccg 569 Query: 445 atcgcgatgggcgcgatggt 464 || ||||| || |||||||| Sbjct: 568 atggcgattggagcgatggt 549
>gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds Length = 753 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 385 ttcatggagcccccgctgaaggggccggcggcgaggatgttggcgccgacaatgaaaccg 444 ||||||||||| || ||||| || || || |||||||||||||| || || ||||| ||| Sbjct: 590 ttcatggagccaccactgaatggaccagcagcgaggatgttggcaccaactatgaagccg 531 Query: 445 atcgcgatgggcgcgatggt 464 || ||||| || |||||||| Sbjct: 530 atggcgattggagcgatggt 511
>ref|XM_001003742.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA Length = 890 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 357 gacggccgggccgaaggagcgggcggggttcatgga 392 |||||| ||||||||||||||||| ||||||||||| Sbjct: 614 gacggcagggccgaaggagcgggctgggttcatgga 579
>ref|XM_994651.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA Length = 890 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 357 gacggccgggccgaaggagcgggcggggttcatgga 392 |||||| ||||||||||||||||| ||||||||||| Sbjct: 614 gacggcagggccgaaggagcgggctgggttcatgga 579
>gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds Length = 853 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 385 ttcatggagcccccgctgaaggggccggcggcgaggatgttggcgccgacaatgaaaccg 444 ||||||||||| || ||||| || || || |||||||||||||| || || ||||| ||| Sbjct: 618 ttcatggagccaccactgaatggaccagcagcgaggatgttggcaccaactatgaagccg 559 Query: 445 atcgcgatgggcgcgatggt 464 || ||||| || |||||||| Sbjct: 558 atggcgattggagcgatggt 539
>dbj|AK082699.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length enriched library, clone:C230090D02 product:aquaporin 6, full insert sequence Length = 2066 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 357 gacggccgggccgaaggagcgggcggggttcatgga 392 |||||| ||||||||||||||||| ||||||||||| Sbjct: 615 gacggcagggccgaaggagcgggctgggttcatgga 580
>dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ7 Length = 80117 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Plus Query: 385 ttcatggagcccccgctgaaggggccggcggcgaggatgttggcgccgacaatgaaaccg 444 ||||||||||| || ||||| || || || |||||||||||||| || || ||||| ||| Sbjct: 8616 ttcatggagccaccactgaatggaccagcagcgaggatgttggcaccaactatgaagccg 8675 Query: 445 atcgcgatgggcgcgatggt 464 || ||||| || |||||||| Sbjct: 8676 atggcgattggagcgatggt 8695
>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds Length = 1097 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagaccca 332 ||||||||||| || |||||||| |||||||||||||| ||||| Sbjct: 782 ccggcgaggccgccgccgatgaggggcccgacccagtacaccca 739 Score = 52.0 bits (26), Expect = 0.002 Identities = 101/126 (80%) Strand = Plus / Minus Query: 364 gggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgaggatg 423 ||||||||||| ||||||||||||||| | ||| ||||| |||| | | |||||| Sbjct: 707 gggccgaaggacacggcggggttcatggacgcgccgtcgaaggcgccgcccaccaggatg 648 Query: 424 ttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggaccccttcttg 483 ||||| || || ||||| ||||| || ||||| ||||||||||| ||| |||||||| Sbjct: 647 ttggcccccacgatgaagccgatggcaatgggggcgatggtgcccaggctgcccttcttc 588 Query: 484 gggtcc 489 |||||| Sbjct: 587 gggtcc 582
>gb|AC139317.4| Mus musculus BAC clone RP24-495N6 from 15, complete sequence Length = 182415 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 357 gacggccgggccgaaggagcgggcggggttcatgga 392 |||||| ||||||||||||||||| ||||||||||| Sbjct: 98544 gacggcagggccgaaggagcgggctgggttcatgga 98579
>ref|NM_175087.2| Mus musculus aquaporin 6 (Aqp6), mRNA Length = 2066 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 357 gacggccgggccgaaggagcgggcggggttcatgga 392 |||||| ||||||||||||||||| ||||||||||| Sbjct: 615 gacggcagggccgaaggagcgggctgggttcatgga 580
>ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript variant 2 (LOC607978), mRNA Length = 1082 Score = 54.0 bits (27), Expect = 4e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 364 gggccgaaggagcgggcggggttcatggagc 394 ||||||||||||||||| ||||||||||||| Sbjct: 584 gggccgaaggagcgggccgggttcatggagc 554
>ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript variant 1 (LOC607978), mRNA Length = 1067 Score = 54.0 bits (27), Expect = 4e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 364 gggccgaaggagcgggcggggttcatggagc 394 ||||||||||||||||| ||||||||||||| Sbjct: 569 gggccgaaggagcgggccgggttcatggagc 539
>emb|AJ245953.1|SOL245953 Spinacia oleracea mRNA for delta tonoplast intrinsic protein (dtip gene) Length = 1101 Score = 52.0 bits (26), Expect = 0.002 Identities = 71/86 (82%) Strand = Plus / Minus Query: 355 gcgacggccgggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcg 414 ||||| ||||||||||| || ||||| |||||||| || || || ||| ||||||||| Sbjct: 722 gcgacagccgggccgaatgaacgggctgggttcattgaaccaccagagaacgggccggcg 663 Query: 415 gcgaggatgttggcgccgacaatgaa 440 || | ||||||||| || |||||||| Sbjct: 662 gctaagatgttggctccaacaatgaa 637
>gb|U92651.2|BOU92651 Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-1 mRNA, complete cds Length = 942 Score = 52.0 bits (26), Expect = 0.002 Identities = 62/74 (83%) Strand = Plus / Minus Query: 382 gggttcatggagcccccgctgaaggggccggcggcgaggatgttggcgccgacaatgaaa 441 |||||||||||| | |||||||| | || |||| | ||||||||| || ||||||||| Sbjct: 635 gggttcatggaggctccgctgaatgctcctccggctaagatgttggcaccaacaatgaaa 576 Query: 442 ccgatcgcgatggg 455 ||||| |||||||| Sbjct: 575 ccgatagcgatggg 562
>gb|AY104464.1| Zea mays PCO114899 mRNA sequence Length = 1167 Score = 52.0 bits (26), Expect = 0.002 Identities = 101/126 (80%) Strand = Plus / Minus Query: 364 gggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgaggatg 423 ||||||||||| ||||||||||||||| | ||| ||||| |||| | | |||||| Sbjct: 710 gggccgaaggacacggcggggttcatggacgcgccgtcgaaggcgccgcccaccaggatg 651 Query: 424 ttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggaccccttcttg 483 ||||| || || ||||| ||||| || ||||| ||||||||||| ||| |||||||| Sbjct: 650 ttggcccccacgatgaagccgatggcaatgggggcgatggtgcccaggctgcccttcttc 591 Query: 484 gggtcc 489 |||||| Sbjct: 590 gggtcc 585 Score = 48.1 bits (24), Expect = 0.027 Identities = 39/44 (88%) Strand = Plus / Minus Query: 289 ccggcgaggccacctccgatgagcggcccgacccagtagaccca 332 ||||||||||| || |||||||| || ||||||||||| ||||| Sbjct: 785 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 742
>gb|AF047173.1| Vernicia fordii aquaporin mRNA, complete cds Length = 1049 Score = 52.0 bits (26), Expect = 0.002 Identities = 98/122 (80%) Strand = Plus / Minus Query: 367 ccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgaggatgttg 426 |||||||||||||| |||| |||||| || || ||| ||||| || || | |||||| Sbjct: 689 ccgaaggagcgggctgggtacatggatccaccagagaatgggcctgcagccaaaatgttg 630 Query: 427 gcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggaccccttcttgggg 486 || || ||||||||||| || || ||||| || |||||||| || || || ||||||||| Sbjct: 629 gcaccaacaatgaaaccaatggcaatgggagcaatggtgcctagtgatcctttcttgggg 570 Query: 487 tc 488 || Sbjct: 569 tc 568
>ref|NM_188626.1| Oryza sativa (japonica cultivar-group), Ozsa8229 predicted mRNA Length = 756 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 310 agcggcccgacccagtagacccagt 334 ||||||||||||||||||||||||| Sbjct: 662 agcggcccgacccagtagacccagt 638
>gb|AF521142.1| Kandelia candel tonoplast intrinsic protein mRNA, partial cds Length = 175 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 423 gttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgcc 467 |||||| || |||||||||||||| ||||| |||||||| ||||| Sbjct: 62 gttggcacccacaatgaaaccgatggcgattggcgcgattgtgcc 18
>emb|AJ843991.1| Plantago major partial mRNA for aquaporin 1 (aqp1 gene) Length = 871 Score = 50.1 bits (25), Expect = 0.007 Identities = 100/125 (80%) Strand = Plus / Minus Query: 364 gggccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgaggatg 423 |||||||| || ||||| ||||||||||| || || ||||| |||||||| || | ||| Sbjct: 565 gggccgaatgatcgggctgggttcatggatccaccactgaatgggccggcagccaaaatg 506 Query: 424 ttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgagggaccccttcttg 483 ||||| || |||||||| || || || || || || || || || || || ||||||||| Sbjct: 505 ttggctccaacaatgaatccaattgccattggggcaattgttccaagtgaacccttcttg 446 Query: 484 gggtc 488 ||||| Sbjct: 445 gggtc 441
>gb|AF326506.1|AF326506 Zea mays tonoplast membrane integral protein ZmTIP4-2 mRNA, complete cds Length = 1255 Score = 50.1 bits (25), Expect = 0.007 Identities = 61/73 (83%) Strand = Plus / Minus Query: 367 ccgaaggagcgggcggggttcatggagcccccgctgaaggggccggcggcgaggatgttg 426 |||||||| || || ||||||||||| | ||| ||||| |||| |||||||| ||||| Sbjct: 758 ccgaaggaccgcgccgggttcatggacgcgccggtgaagttgccgccggcgaggctgttg 699 Query: 427 gcgccgacaatga 439 |||||||| |||| Sbjct: 698 gcgccgactatga 686
>dbj|AK099190.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023108H12, full insert sequence Length = 1055 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 310 agcggcccgacccagtagacccagt 334 ||||||||||||||||||||||||| Sbjct: 708 agcggcccgacccagtagacccagt 684
>dbj|AK069592.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023019I12, full insert sequence Length = 1059 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 310 agcggcccgacccagtagacccagt 334 ||||||||||||||||||||||||| Sbjct: 711 agcggcccgacccagtagacccagt 687
>gb|AY112570.1| Zea mays CL43160_1 mRNA sequence Length = 307 Score = 50.1 bits (25), Expect = 0.007 Identities = 50/56 (89%), Gaps = 3/56 (5%) Strand = Plus / Minus Query: 229 gcgtagtcctggtcggcgactggctggtagga--cg-cgatgaacacgtcgccgta 281 |||||||||||||||||||| |||||||||| || ||||||| ||||||||||| Sbjct: 56 gcgtagtcctggtcggcgacctgctggtaggagccgccgatgaagacgtcgccgta 1
>gb|U39486.1|ATU39486 Arabidopsis thaliana delta tonoplast integral protein gene, partial cds Length = 2235 Score = 50.1 bits (25), Expect = 0.007 Identities = 64/77 (83%) Strand = Plus / Minus Query: 409 ccggcggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccg 468 |||||||||||||||||||| || || || | ||| || |||| || |||||||| ||| Sbjct: 2216 ccggcggcgaggatgttggcaccaacgataagaccaatggcgagaggagcgatggttccg 2157 Query: 469 agggaccccttcttggg 485 || || ||||||||||| Sbjct: 2156 agagaacccttcttggg 2140
>ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel AT2G36830 (GAMMA-TIP) mRNA, complete cds Length = 1058 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatggg 455 ||||||||| || |||||||||||||| |||||||| Sbjct: 625 gatgttggctccaacaatgaaaccgattgcgatggg 590
>emb|X72581.1|ATGTIPMR A.thaliana mRNA for tonoplast intrinsic protein gamma (gamma-TIP) Length = 933 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatggg 455 ||||||||| || |||||||||||||| |||||||| Sbjct: 594 gatgttggctccaacaatgaaaccgattgcgatggg 559
>emb|X63552.1|ATGTIPARA A.thaliana gene for tonoplast intrinsic protein gamma-TIP(Ara) Length = 1398 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatggg 455 ||||||||| || |||||||||||||| |||||||| Sbjct: 1010 gatgttggctccaacaatgaaaccgattgcgatggg 975
>gb|AY059134.1| Arabidopsis thaliana putative aquaporin (At2g36830) mRNA, complete cds Length = 787 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatggg 455 ||||||||| || |||||||||||||| |||||||| Sbjct: 561 gatgttggctccaacaatgaaaccgattgcgatggg 526
>gb|AF370172.1| Arabidopsis thaliana putative tonoplast intrinsic protein gamma, aquaporin (At2g36830) mRNA, complete cds Length = 1030 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatggg 455 ||||||||| || |||||||||||||| |||||||| Sbjct: 619 gatgttggctccaacaatgaaaccgattgcgatggg 584
>emb|X54854.1|ATROOTSP A. thaliana mRNA for root-specific gene Length = 993 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatggg 455 ||||||||| || |||||||||||||| |||||||| Sbjct: 603 gatgttggctccaacaatgaaaccgattgcgatggg 568
>gb|AC006922.7| Arabidopsis thaliana chromosome 2 clone T1J8 map g6825, complete sequence Length = 134151 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatggg 455 ||||||||| || |||||||||||||| |||||||| Sbjct: 7320 gatgttggctccaacaatgaaaccgattgcgatggg 7285
>emb|BX819301.1|CNS0AA93 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB66ZE04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 996 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatggg 455 ||||||||| || |||||||||||||| |||||||| Sbjct: 600 gatgttggctccaacaatgaaaccgattgcgatggg 565
>emb|BX819066.1|CNS0AA99 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB42ZA01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1009 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatggg 455 ||||||||| || |||||||||||||| |||||||| Sbjct: 590 gatgttggctccaacaatgaaaccgattgcgatggg 555
>emb|BX818765.1|CNS0AA8G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB10ZD11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 950 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatggg 455 ||||||||| || |||||||||||||| |||||||| Sbjct: 605 gatgttggctccaacaatgaaaccgattgcgatggg 570
>emb|BX819619.1|CNS0A8TV Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB95ZA10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 885 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatggg 455 ||||||||| || |||||||||||||| |||||||| Sbjct: 606 gatgttggctccaacaatgaaaccgattgcgatggg 571
>emb|BX819585.1|CNS0A8ZS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB91ZD10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 975 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatggg 455 ||||||||| || |||||||||||||| |||||||| Sbjct: 606 gatgttggctccaacaatgaaaccgattgcgatggg 571
>emb|BX819242.1|CNS0A8YI Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB5ZD01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 904 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatggg 455 ||||||||| || |||||||||||||| |||||||| Sbjct: 604 gatgttggctccaacaatgaaaccgattgcgatggg 569
>emb|BX818836.1|CNS0A8V6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB18ZB03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 995 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatggg 455 ||||||||| || |||||||||||||| |||||||| Sbjct: 605 gatgttggctccaacaatgaaaccgattgcgatggg 570
>emb|BX820166.1|CNS0A8IR Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS84ZH08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 961 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatggg 455 ||||||||| || |||||||||||||| |||||||| Sbjct: 596 gatgttggctccaacaatgaaaccgattgcgatggg 561
>dbj|AB206104.1| Mimosa pudica tip1;1 mRNA for tonoplast intrinsic protein 1;1, complete cds Length = 1067 Score = 48.1 bits (24), Expect = 0.027 Identities = 36/40 (90%) Strand = Plus / Minus Query: 295 aggccacctccgatgagcggcccgacccagtagacccagt 334 ||||||||||| || || || ||||||||||||||||||| Sbjct: 756 aggccacctccaataagtgggccgacccagtagacccagt 717
>gb|AY087558.1| Arabidopsis thaliana clone 36633 mRNA, complete sequence Length = 1042 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatggg 455 ||||||||| || |||||||||||||| |||||||| Sbjct: 625 gatgttggctccaacaatgaaaccgattgcgatggg 590
>gb|M84344.1|ATHGTIP Arabidopsis thaliana tonoplast intrinsic protein (gamma-TIP) gene, complete cds Length = 1398 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatggg 455 ||||||||| || |||||||||||||| |||||||| Sbjct: 1010 gatgttggctccaacaatgaaaccgattgcgatggg 975
>gb|AY839872.1| Vitis vinifera aquaporin (TIP1;1) mRNA, complete cds Length = 993 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 304 ccgatgagcggcccgacccagtagacccagt 334 |||||||| |||||| ||||||||||||||| Sbjct: 724 ccgatgagaggcccggcccagtagacccagt 694
>ref|XM_509051.1| PREDICTED: Pan troglodytes similar to aquaporin 2; collecting duct water channel protein; aquaporin-CD (LOC451886), mRNA Length = 887 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 364 gggccgaaggagcgggcggggttcatggagc 394 ||||||||||||||||| || |||||||||| Sbjct: 646 gggccgaaggagcgggctggattcatggagc 616
>ref|XM_473251.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 798 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 304 ccgatgagcggcccgacccagtagacccagt 334 |||||||||||||||| |||||| ||||||| Sbjct: 695 ccgatgagcggcccgagccagtaaacccagt 665
>gb|BC065275.1| Homo sapiens aquaporin 6, kidney specific, mRNA (cDNA clone IMAGE:6164409), partial cds Length = 2245 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 364 gggccgaaggagcgggcggggttcatggagc 394 ||||||||||||||||| || |||||||||| Sbjct: 586 gggccgaaggagcgggctggattcatggagc 556
>ref|XM_543677.2| PREDICTED: Canis familiaris similar to Aquaporin 5 (LOC486551), mRNA Length = 1556 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 364 gggccgaaggagcgggcggggttcatggagc 394 |||||||| |||||||| ||||||||||||| Sbjct: 791 gggccgaaagagcgggccgggttcatggagc 761
>emb|AL663019.2|OSJN00221 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0038O10, complete sequence Length = 141545 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 304 ccgatgagcggcccgacccagtagacccagt 334 |||||||||||||||| |||||| ||||||| Sbjct: 131405 ccgatgagcggcccgagccagtaaacccagt 131375
>emb|AL137716.1|HSM802206 Homo sapiens mRNA; cDNA DKFZp434D2030 (from clone DKFZp434D2030) Length = 5178 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 364 gggccgaaggagcgggcggggttcatggagc 394 ||||||||||||||||| || |||||||||| Sbjct: 3027 gggccgaaggagcgggctggattcatggagc 2997
>gb|AF271660.1|AF271660 Vitis berlandieri x Vitis rupestris putative aquaporin TIP3 (TIP3) mRNA, complete cds Length = 1133 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 304 ccgatgagcggcccgacccagtagacccagt 334 |||||||| |||||| ||||||||||||||| Sbjct: 744 ccgatgagaggcccggcccagtagacccagt 714
>ref|NM_001652.3| Homo sapiens aquaporin 6, kidney specific (AQP6), mRNA Length = 2654 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 364 gggccgaaggagcgggcggggttcatggagc 394 ||||||||||||||||| || |||||||||| Sbjct: 945 gggccgaaggagcgggctggattcatggagc 915
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 407 ggccggcggcgaggatgttggcgccga 433 |||||||||||||||||||| |||||| Sbjct: 1148946 ggccggcggcgaggatgttgacgccga 1148920
>gb|AC025154.31| Homo sapiens 12 BAC RP11-469H8 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 164813 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 364 gggccgaaggagcgggcggggttcatggagc 394 ||||||||||||||||| || |||||||||| Sbjct: 27182 gggccgaaggagcgggctggattcatggagc 27152
>emb|AJ555456.1|ECA555456 Equus caballus partial mRNA for aquaporin 5 (aqp5 gene) Length = 535 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 364 gggccgaaggagcgggcggggttcatggagc 394 |||||||| |||||||| ||||||||||||| Sbjct: 531 gggccgaaagagcgggctgggttcatggagc 501
>dbj|AK108116.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-139-C05, full insert sequence Length = 912 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 304 ccgatgagcggcccgacccagtagacccagt 334 |||||||||||||||| |||||| ||||||| Sbjct: 761 ccgatgagcggcccgagccagtaaacccagt 731
>gb|AY610211.1| Sus scrofa clone Clu_9762.scr.msk.p1.Contig1, mRNA sequence Length = 2291 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Plus Query: 364 gggccgaaggagcgggcggggttcatggagc 394 |||||||| |||||||| ||||||||||||| Sbjct: 2230 gggccgaaagagcgggctgggttcatggagc 2260
>gb|U48408.1|HSU48408 Human kidney water channel (hKID) mRNA, complete cds Length = 1347 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 364 gggccgaaggagcgggcggggttcatggagc 394 ||||||||||||||||| || |||||||||| Sbjct: 950 gggccgaaggagcgggctggattcatggagc 920
>dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds Length = 321 Score = 46.1 bits (23), Expect = 0.11 Identities = 35/39 (89%) Strand = Plus / Minus Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatgggcgc 458 ||||||||||||||| ||||| ||||| || |||||||| Sbjct: 321 gatgttggcgccgacgatgaagccgatggcaatgggcgc 283
>ref|NM_207059.1| Danio rerio zgc:85890 (zgc:85890), mRNA Length = 1194 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 313 ggcccgacccagtagacccagt 334 |||||||||||||||||||||| Sbjct: 657 ggcccgacccagtagacccagt 636
>gb|AY626937.1| Danio rerio aquaporin 1 mRNA, complete cds Length = 1208 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 313 ggcccgacccagtagacccagt 334 |||||||||||||||||||||| Sbjct: 665 ggcccgacccagtagacccagt 644
>ref|XM_761277.1| Theileria parva strain Muguga chromosome 1 hypothetical protein (TP01_0849) partial mRNA Length = 2823 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 attttatatggaattgaatcga 90 |||||||||||||||||||||| Sbjct: 1950 attttatatggaattgaatcga 1971
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 420 gatgttggcgccgacaatgaaaccga 445 ||||||||| |||||||||||||||| Sbjct: 3172197 gatgttggcaccgacaatgaaaccga 3172172
>gb|BC066289.1| Danio rerio zgc:85890, mRNA (cDNA clone MGC:85890 IMAGE:6970049), complete cds Length = 1194 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 313 ggcccgacccagtagacccagt 334 |||||||||||||||||||||| Sbjct: 657 ggcccgacccagtagacccagt 636
>ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1242 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 408 gccggcggcgaggatgttggcgccg 432 ||||||||||||| ||||||||||| Sbjct: 614 gccggcggcgagggtgttggcgccg 590
>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117 mRNA Length = 1257 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 408 gccggcggcgaggatgttggcgccg 432 ||||||||||||| ||||||||||| Sbjct: 616 gccggcggcgagggtgttggcgccg 592
>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117 mRNA Length = 1298 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 408 gccggcggcgaggatgttggcgccg 432 ||||||||||||| ||||||||||| Sbjct: 617 gccggcggcgagggtgttggcgccg 593
>ref|XM_606158.2| PREDICTED: Bos taurus similar to aquaporin 6 (LOC527759), mRNA Length = 846 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 370 aaggagcgggcggggttcatggagc 394 ||||||||||| ||||||||||||| Sbjct: 593 aaggagcgggctgggttcatggagc 569
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 408 gccggcggcgaggatgttggcgccg 432 ||||||||||||| ||||||||||| Sbjct: 15353478 gccggcggcgagggtgttggcgccg 15353454
>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel protein, partial cds Length = 880 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 408 gccggcggcgaggatgttggcgccg 432 ||||||||||||| ||||||||||| Sbjct: 180 gccggcggcgagggtgttggcgccg 156
>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1047_A06 Length = 111673 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 408 gccggcggcgaggatgttggcgccg 432 ||||||||||||| ||||||||||| Sbjct: 60477 gccggcggcgagggtgttggcgccg 60453
>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0475E07 Length = 139961 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 408 gccggcggcgaggatgttggcgccg 432 ||||||||||||| ||||||||||| Sbjct: 139491 gccggcggcgagggtgttggcgccg 139467
>dbj|AB126924.1| Prunus persica Pr-gTIP1 mRNA for tonoplast intrinsic protein, complete cds Length = 1143 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Minus Query: 421 atgttggcgccgacaatgaaaccgatcgcgatgggcgcgat 461 ||||| ||||| || | ||||||||||||||| |||||||| Sbjct: 660 atgttcgcgccaactacgaaaccgatcgcgatcggcgcgat 620
>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full insert sequence Length = 1216 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 408 gccggcggcgaggatgttggcgccg 432 ||||||||||||| ||||||||||| Sbjct: 614 gccggcggcgagggtgttggcgccg 590
>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full insert sequence Length = 1451 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 408 gccggcggcgaggatgttggcgccg 432 ||||||||||||| ||||||||||| Sbjct: 208 gccggcggcgagggtgttggcgccg 184
>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full insert sequence Length = 1242 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 408 gccggcggcgaggatgttggcgccg 432 ||||||||||||| ||||||||||| Sbjct: 614 gccggcggcgagggtgttggcgccg 590
>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full insert sequence Length = 1257 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 408 gccggcggcgaggatgttggcgccg 432 ||||||||||||| ||||||||||| Sbjct: 616 gccggcggcgagggtgttggcgccg 592
>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full insert sequence Length = 1298 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 408 gccggcggcgaggatgttggcgccg 432 ||||||||||||| ||||||||||| Sbjct: 617 gccggcggcgagggtgttggcgccg 593
>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds Length = 1328 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 408 gccggcggcgaggatgttggcgccg 432 ||||||||||||| ||||||||||| Sbjct: 604 gccggcggcgagggtgttggcgccg 580
>gb|AF118381.1|AF118381 Brassica napus tonoplast intrinsic protein (gamma-TIP2) mRNA, complete cds Length = 1020 Score = 42.1 bits (21), Expect = 1.7 Identities = 72/89 (80%) Strand = Plus / Minus Query: 382 gggttcatggagcccccgctgaaggggccggcggcgaggatgttggcgccgacaatgaaa 441 |||||||||||| | |||||||| | || ||||||||||||| || || || |||||| Sbjct: 611 gggttcatggaggctccgctgaaagctccaccggcgaggatgttagctccaacgatgaaa 552 Query: 442 ccgatcgcgatgggcgcgatggtgccgag 470 || || ||||| || ||||| || ||||| Sbjct: 551 cctatggcgattggtgcgattgttccgag 523
>gb|AF083879.1|AF083879 Rattus norvegicus aquaporin-6 (AQP6) mRNA, complete cds Length = 1315 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 364 gggccgaaggagcgggcggggttcatgga 392 |||||||||||||| || ||||||||||| Sbjct: 740 gggccgaaggagcgagctgggttcatgga 712
>ref|NM_022181.1| Rattus norvegicus aquaporin 6 (Aqp6), mRNA Length = 1315 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 364 gggccgaaggagcgggcggggttcatgga 392 |||||||||||||| || ||||||||||| Sbjct: 740 gggccgaaggagcgagctgggttcatgga 712
>gb|L28113.1|RATRNASEQA Rat mRNA sequence Length = 1140 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 364 gggccgaaggagcgggcggggttcatgga 392 |||||||||||||| || ||||||||||| Sbjct: 767 gggccgaaggagcgagctgggttcatgga 739
>gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds Length = 1047 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 298 ccacctccgatgagcggcccgacccagtagacccagt 334 |||||||||||||| || ||| ||||||||| ||||| Sbjct: 788 ccacctccgatgagagggccggcccagtagatccagt 752
>gb|CP000014.1| Borrelia garinii PBi plasmid cp26, complete sequence Length = 27108 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 aaaatattttatatggaatt 83 |||||||||||||||||||| Sbjct: 8963 aaaatattttatatggaatt 8982
>gb|CP000150.1| Burkholderia sp. 383 chromosome 3, complete sequence Length = 1395069 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 194 ggtcgagcatccgttcggct 213 |||||||||||||||||||| Sbjct: 612053 ggtcgagcatccgttcggct 612034
>ref|XM_469697.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1307 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 410 cggcggcgaggatgttggcg 429 |||||||||||||||||||| Sbjct: 239 cggcggcgaggatgttggcg 258
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome Length = 3188609 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 446 tcgcgatgggcgcgatggtg 465 |||||||||||||||||||| Sbjct: 61338 tcgcgatgggcgcgatggtg 61319
>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence Length = 3510148 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 350 cggcggcgacggccgggccg 369 |||||||||||||||||||| Sbjct: 2558549 cggcggcgacggccgggccg 2558568
>ref|XM_364121.1| Magnaporthe grisea 70-15 hypothetical protein (MG08966.4) partial mRNA Length = 1143 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 344 agttgccggcggcgacggcc 363 |||||||||||||||||||| Sbjct: 784 agttgccggcggcgacggcc 765
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence Length = 4126292 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 350 cggcggcgacggccgggccg 369 |||||||||||||||||||| Sbjct: 3770821 cggcggcgacggccgggccg 3770840
>gb|AY914979.1| Schistosoma japonicum SJCHGC01981 protein mRNA, complete cds Length = 894 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 66 aatattttatatggaattga 85 |||||||||||||||||||| Sbjct: 463 aatattttatatggaattga 482
>ref|XM_540787.2| PREDICTED: Canis familiaris similar to Achaete-scute homolog 2 (Mash-2) (LOC483666), mRNA Length = 927 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 348 gccggcggcgacggccgggc 367 |||||||||||||||||||| Sbjct: 446 gccggcggcgacggccgggc 465
>gb|AC131391.2| Homo sapiens chromosome 16 clone RP11-552C15, complete sequence Length = 41511 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 297 gccacctccgatgagcggcc 316 |||||||||||||||||||| Sbjct: 8517 gccacctccgatgagcggcc 8498
>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence Length = 4074542 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 350 cggcggcgacggccgggccg 369 |||||||||||||||||||| Sbjct: 3511141 cggcggcgacggccgggccg 3511160
>emb|AL939119.1|SCO939119 Streptomyces coelicolor A3(2) complete genome; segment 16/29 Length = 299050 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 351 ggcggcgacggccgggccga 370 |||||||||||||||||||| Sbjct: 254567 ggcggcgacggccgggccga 254586
>gb|AC165428.1| Strongylocentrotus purpuratus BAC clone contig containing Eve, the hox cluster, cholinesterase, and COLP5alpha genes, complete sequence Length = 796348 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 90 aaagggaaacacgaaggccg 109 |||||||||||||||||||| Sbjct: 155979 aaagggaaacacgaaggccg 155998
>gb|AC130458.2| Homo sapiens chromosome 16 clone CTA-388D4, complete sequence Length = 93519 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 297 gccacctccgatgagcggcc 316 |||||||||||||||||||| Sbjct: 58307 gccacctccgatgagcggcc 58288
>dbj|AB110189.1| Oryza sativa (japonica cultivar-group) mRNA for hypothetical protein, complete cds, clone: 17FPG011 Length = 1129 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 410 cggcggcgaggatgttggcg 429 |||||||||||||||||||| Sbjct: 58 cggcggcgaggatgttggcg 77
>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome Length = 3561584 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 345 gttgccggcggcgacggccgggcc 368 |||||||||||||||| ||||||| Sbjct: 1350664 gttgccggcggcgacgaccgggcc 1350687
>gb|AC092558.4| Oryza sativa chromosome 3 BAC OSJNBb0036F07 genomic sequence, complete sequence Length = 130359 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 410 cggcggcgaggatgttggcg 429 |||||||||||||||||||| Sbjct: 62835 cggcggcgaggatgttggcg 62816
>gb|AC154339.2| Mus musculus BAC clone RP23-248O15 from chromosome 13, complete sequence Length = 174982 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 76 atggaattgaatcgaaagggaaac 99 ||||||||||||| |||||||||| Sbjct: 121579 atggaattgaatcaaaagggaaac 121602
>gb|AF326507.1|AF326507 Zea mays tonoplast membrane integral protein ZmTIP4-3 mRNA, complete cds Length = 1045 Score = 40.1 bits (20), Expect = 6.6 Identities = 35/40 (87%) Strand = Plus / Minus Query: 354 ggcgacggccgggccgaaggagcgggcggggttcatggag 393 ||||||||| || |||||||| | ||| |||||||||||| Sbjct: 720 ggcgacggcgggcccgaaggacctggccgggttcatggag 681
>emb|BX511226.5| Zebrafish DNA sequence from clone DKEY-41K7 in linkage group 1, complete sequence Length = 252757 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 ctttgatcatcacatcacac 157 |||||||||||||||||||| Sbjct: 29560 ctttgatcatcacatcacac 29579
>emb|BX819122.1|CNS0AA8S Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB49ZC08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 929 Score = 40.1 bits (20), Expect = 6.6 Identities = 32/36 (88%) Strand = Plus / Minus Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatggg 455 ||||||||| || |||||||||||||| | |||||| Sbjct: 604 gatgttggctccaacaatgaaaccgattgggatggg 569
>emb|BX818785.1|CNS0A8WQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB13ZC03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 973 Score = 40.1 bits (20), Expect = 6.6 Identities = 32/36 (88%) Strand = Plus / Minus Query: 420 gatgttggcgccgacaatgaaaccgatcgcgatggg 455 ||||||||| || |||||||||||||| ||||||| Sbjct: 604 gatgttggctccaacaatgaaaccgatttcgatggg 569
>emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH44ZA10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 887 Score = 40.1 bits (20), Expect = 6.6 Identities = 62/76 (81%) Strand = Plus / Minus Query: 413 cggcgaggatgttggcgccgacaatgaaaccgatcgcgatgggcgcgatggtgccgaggg 472 ||||||||||||| || || || |||||||| || ||||| || ||||| || ||||| | Sbjct: 451 cggcgaggatgttcgctccaacgatgaaacctatggcgattggtgcgattgttccgagag 392 Query: 473 accccttcttggggtc 488 || ||||||||||| Sbjct: 391 tgccgttcttggggtc 376
>gb|AF215860.1|AF215860 Schistosoma japonicum mitochondrion coding region, complete sequence Length = 14085 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 66 aatattttatatggaattga 85 |||||||||||||||||||| Sbjct: 9364 aatattttatatggaattga 9383
>gb|AE000792.1| Borrelia burgdorferi B31 plasmid cp26, complete sequence Length = 26498 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 aaaatattttatatggaatt 83 |||||||||||||||||||| Sbjct: 9081 aaaatattttatatggaatt 9100
>gb|U95737.1|HUU95737 Human Chromosome 16 BAC clone CIT987SK-A-388D4, complete sequence Length = 93431 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 297 gccacctccgatgagcggcc 316 |||||||||||||||||||| Sbjct: 58219 gccacctccgatgagcggcc 58200
>gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome Length = 3940880 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 accatttgtacacaaccttt 141 |||||||||||||||||||| Sbjct: 1537047 accatttgtacacaaccttt 1537028
>dbj|AK065730.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013037C05, full insert sequence Length = 1111 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 410 cggcggcgaggatgttggcg 429 |||||||||||||||||||| Sbjct: 61 cggcggcgaggatgttggcg 80
>gb|AY814421.1| Schistosoma japonicum clone SJCHGC00208 unknown mRNA Length = 2259 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 66 aatattttatatggaattga 85 |||||||||||||||||||| Sbjct: 1024 aatattttatatggaattga 1043 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,167,898 Number of Sequences: 3902068 Number of extensions: 3167898 Number of successful extensions: 66438 Number of sequences better than 10.0: 203 Number of HSP's better than 10.0 without gapping: 203 Number of HSP's successfully gapped in prelim test: 3 Number of HSP's that attempted gapping in prelim test: 64893 Number of HSP's gapped (non-prelim): 1519 length of query: 489 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 467 effective length of database: 17,147,199,772 effective search space: 8007742293524 effective search space used: 8007742293524 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
