ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart07g11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AF427791.1| Hordeum vulgare Mla locus, complete sequence 761 0.0
2emb|AJ250663.2|HVU250663 Hordeum vulgare partial mRNA for putati... 599 e-168
3dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 100 7e-18
4gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 100 7e-18
5emb|AL731742.3|CNS08C7R Oryza sativa chromosome 12, . BAC OJ1123... 100 7e-18
6gb|BT017006.1| Zea mays clone EK07D2310C10.c mRNA sequence 74 4e-10
7dbj|AK058739.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
8gb|BT018918.1| Zea mays clone Contig12.F mRNA sequence 50 0.006
9gb|AY549626.1| Zea perennis isolate per7b MPI (mpi) gene, comple... 50 0.006
10gb|AY549625.1| Zea perennis isolate per7a MPI (mpi) gene, comple... 50 0.006
11gb|AY549624.1| Zea perennis isolate per6 MPI (mpi) gene, complet... 50 0.006
12gb|AY549623.1| Zea perennis isolate per4d MPI (mpi) gene, comple... 50 0.006
13gb|AY549622.1| Zea perennis isolate per4c MPI (mpi) gene, comple... 50 0.006
14gb|AY549621.1| Zea perennis isolate per4b MPI (mpi) gene, comple... 50 0.006
15gb|AY549619.1| Zea perennis isolate per3c MPI (mpi) gene, comple... 50 0.006
16gb|AY549618.1| Zea perennis isolate per3b MPI (mpi) gene, comple... 50 0.006
17gb|AY549617.1| Zea perennis isolate per3a MPI (mpi) gene, comple... 50 0.006
18gb|AY549616.1| Zea perennis isolate per2c MPI (mpi) gene, comple... 50 0.006
19gb|AY549614.1| Zea perennis isolate per2a MPI (mpi) gene, comple... 50 0.006
20gb|AY549612.1| Zea perennis isolate per1b MPI (mpi) gene, comple... 50 0.006
21gb|AY549599.1| Zea diploperennis isolate d1b MPI (mpi) gene, com... 50 0.006
22emb|X82187.1|ZMPIS7 Z.mays mRNA for pis7 50 0.006
23emb|X78988.2|ZMMPI Zea mays MPI gene 50 0.006
24emb|X69972.1|ZMCIMS Z.mays mRNA for subtilisin-chymotrypsin inhi... 50 0.006
25dbj|AK121693.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.006
26dbj|AK063833.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.006
27gb|AY104061.1| Zea mays PCO087322 mRNA sequence 50 0.006
28gb|AY878693.1| Oryza sativa (japonica cultivar-group) subitilisi... 50 0.006
29emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112... 50 0.006
30gb|DQ147231.1| Zea mays subsp. parviglumis isolate 11c maize pro... 50 0.006
31gb|DQ147230.1| Zea mays subsp. parviglumis isolate 11b maize pro... 50 0.006
32gb|DQ147229.1| Zea mays subsp. parviglumis isolate 10a maize pro... 50 0.006
33gb|DQ147228.1| Zea mays subsp. parviglumis isolate 10b maize pro... 50 0.006
34gb|DQ147227.1| Zea mays subsp. parviglumis isolate 9b maize prot... 50 0.006
35gb|DQ147226.1| Zea mays subsp. parviglumis isolate 9a maize prot... 50 0.006
36gb|DQ147225.1| Zea mays subsp. parviglumis isolate 8b maize prot... 50 0.006
37gb|DQ147224.1| Zea mays subsp. parviglumis isolate 7a maize prot... 50 0.006
38gb|DQ147223.1| Zea mays subsp. parviglumis isolate 6b maize prot... 50 0.006
39gb|DQ147222.1| Zea mays subsp. parviglumis isolate 5a maize prot... 50 0.006
40gb|DQ147221.1| Zea mays subsp. parviglumis isolate 5b maize prot... 50 0.006
41gb|DQ147220.1| Zea mays subsp. parviglumis isolate 4b maize prot... 50 0.006
42gb|DQ147219.1| Zea mays subsp. parviglumis isolate 4c maize prot... 50 0.006
43gb|DQ147218.1| Zea mays subsp. parviglumis isolate 3c maize prot... 50 0.006
44gb|DQ147217.1| Zea mays subsp. parviglumis isolate 3a maize prot... 50 0.006
45gb|DQ147216.1| Zea mays subsp. parviglumis isolate 2a maize prot... 50 0.006
46gb|DQ147215.1| Zea mays subsp. parviglumis isolate 1b maize prot... 50 0.006
47gb|AY549627.1| Tripsacum dactyloides MPI (mpi) gene, complete cds 48 0.023
48gb|AY424272.1| Brachypodium distachyon ecotype ABR5 serine prote... 48 0.023
49gb|AY112541.1| Zea mays CL44946_1 mRNA sequence 48 0.023
50gb|AC108157.3| Homo sapiens BAC clone RP11-580P21 from 4, comple... 44 0.36
51gb|U51243.1|HSU51243 Human alpha-albumin gene, complete cds 44 0.36
52gb|M21400.1|BLYCI1A Barley chymotrypsin inhibitor (CI-1A) mRNA, ... 44 0.36
53gb|AY549620.1| Zea perennis MPI (mpi) gene, complete cds 42 1.4
54gb|AY549615.1| Zea perennis isolate per2b MPI (mpi) gene, comple... 42 1.4
55gb|AY549613.1| Zea perennis isolate per1c MPI (mpi) gene, comple... 42 1.4
56gb|AY549610.1| Zea diploperennis isolate d8b MPI (mpi) gene, com... 42 1.4
57gb|AY549609.1| Zea diploperennis isolate d8a MPI (mpi) gene, com... 42 1.4
58gb|AY549608.1| Zea diploperennis isolate d7b MPI (mpi) gene, com... 42 1.4
59gb|AY549607.1| Zea diploperennis isolate d7a MPI (mpi) gene, com... 42 1.4
60gb|AY549606.1| Zea diploperennis isolate d6b MPI (mpi) gene, com... 42 1.4
61gb|AY549605.1| Zea diploperennis isolate d6a MPI (mpi) gene, com... 42 1.4
62gb|AY549604.1| Zea diploperennis isolate d5b MPI (mpi) gene, com... 42 1.4
63gb|AY549603.1| Zea diploperennis isolate d5a MPI (mpi) gene, com... 42 1.4
64gb|AY549602.1| Zea diploperennis isolate d4a MPI (mpi) gene, com... 42 1.4
65gb|AY549601.1| Zea diploperennis isolate d3a MPI (mpi) gene, com... 42 1.4
66gb|AY549600.1| Zea diploperennis isolate d2a MPI (mpi) gene, com... 42 1.4
67gb|AY549598.1| Zea diploperennis isolate d1a MPI (mpi) gene, com... 42 1.4
68ref|XM_369944.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 5.6
69emb|CT009509.7| Mouse DNA sequence from clone RP23-140C10 on chr... 40 5.6
70ref|XM_537053.2| PREDICTED: Canis familiaris similar to Cofilin-... 40 5.6
71gb|AC129092.13| Medicago truncatula clone mth2-17n16, complete s... 40 5.6
72emb|AL939122.1|SCO939122 Streptomyces coelicolor A3(2) complete ... 40 5.6
73ref|XM_682322.1| PREDICTED: Danio rerio similar to papilin (LOC5... 40 5.6
74gb|AC147918.2| Xenopus tropicalis clone CH216-8N16, complete seq... 40 5.6
75gb|AF152393.1|MMTSP4S2 Mus musculus thrombospondin 4 gene, parti... 40 5.6
76gb|AF333038.2| Streptomyces viridochromogenes Avilamycin A biosy... 40 5.6
77gb|AC166113.3| Mus musculus BAC clone RP23-23E6 from chromosome ... 40 5.6 
>gb|AF427791.1| Hordeum vulgare Mla locus, complete sequence
          Length = 261265

 Score =  761 bits (384), Expect = 0.0
 Identities = 387/388 (99%)
 Strand = Plus / Plus

                                                                          
Query: 1      aatatgaagcacaaattataaataactggtcaagtacattgatccacaggtagcatgctg 60
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 220456 aatatgaagcacaaattataaataactggtcaagtacattgatccacaggtagcatgctg 220515

                                                                          
Query: 61     gtggtcagcatctatttattgatccatgcttattggaagtacttattcatcagcatccac 120
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 220516 gtggtcagcatctatttattgatccatgcttattggaagtacttattcatcagcatccac 220575

                                                                          
Query: 121    aatgcatccatgttgcctttgcttgcaaagctagctagccaatgtggggagtggacgcga 180
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 220576 aatgcatccatgttgcctttgcttgcaaagctagctagccaatgtggggaatggacgcga 220635

                                                                          
Query: 181    cagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtcaccggcgagccgg 240
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 220636 cagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtcaccggcgagccgg 220695

                                                                          
Query: 241    ctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctccttggcctcct 300
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 220696 ctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctccttggcctcct 220755

                                                                          
Query: 301    cgatggactttcccactacctccggccatgacgtcttcttctcctctccggcgggggctt 360
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 220756 cgatggactttcccactacctccggccatgacgtcttcttctcctctccggcgggggctt 220815

                                          
Query: 361    ttggggcggcgcagctcatcctcgattc 388
              ||||||||||||||||||||||||||||
Sbjct: 220816 ttggggcggcgcagctcatcctcgattc 220843



 Score =  174 bits (88), Expect = 1e-40
 Identities = 124/136 (91%)
 Strand = Plus / Plus

                                                                          
Query: 253    cgatgtccgcttcaggcatgtccttaaggatgatctccttggcctcctcgatggactttc 312
              |||||||| |||||||||||||||| ||||||| |||| |||| |||||||||||||| |
Sbjct: 217638 cgatgtccacttcaggcatgtccttgaggatgacctccctggcgtcctcgatggacttcc 217697

                                                                          
Query: 313    ccactacctccggccatgacgtcttcttctcctctccggcgggggcttttggggcggcgc 372
              |||||| |||||||||||||| |||||||||||| |||||||| ||||||||| | ||||
Sbjct: 217698 ccactaactccggccatgacgacttcttctcctcaccggcgggtgcttttgggtcagcgc 217757

                              
Query: 373    agctcatcctcgattc 388
              ||||||||||||||||
Sbjct: 217758 agctcatcctcgattc 217773



 Score =  167 bits (84), Expect = 4e-38
 Identities = 180/212 (84%)
 Strand = Plus / Plus

                                                                          
Query: 145    gcaaagctagctagccaatgtggggagtggacgcgacagtgtcgacgaagatgcggacac 204
              ||||| |||||||||| ||||| ||||||| ||||||||||||||| | || ||||||||
Sbjct: 223765 gcaaatctagctagccgatgtgaggagtggtcgcgacagtgtcgaccaggacgcggacac 223824

                                                                          
Query: 205    ggttggtcctgaagtcgagggtcaccggcgagccggctgggaggacgacgatgtccgctt 264
              ||||| ||||  ||||   || ||||   |||  ||| ||||||||   |||||||||||
Sbjct: 223825 ggttgctcctccagtctgcggccaccacggagttggcggggaggactttgatgtccgctt 223884

                                                                          
Query: 265    caggcatgtccttaaggatgatctccttggcctcctcgatggactttcccactacctccg 324
              ||||||| ||||| ||||||| |||| |||| |||||||||||||| ||||||| |||||
Sbjct: 223885 caggcatatccttgaggatgacctccctggcgtcctcgatggacttccccactaactccg 223944

                                              
Query: 325    gccatgacgtcttcttctcctctccggcgggg 356
              ||||||||| |||||||||||| |||||||||
Sbjct: 223945 gccatgacgacttcttctcctcaccggcgggg 223976



 Score =  123 bits (62), Expect = 5e-25
 Identities = 131/154 (85%)
 Strand = Plus / Minus

                                                                          
Query: 187    cgacgaagatgcggacacggttggtcctgaagtcgagggtcaccggcgagccggctggga 246
              |||||||||||||||||||||||| |||||||||   ||||||||  |||||  | || |
Sbjct: 207140 cgacgaagatgcggacacggttgggcctgaagtcttcggtcaccgctgagccaaccggca 207081

                                                                          
Query: 247    ggacgacgatgtccgcttcaggcatgtccttaaggatgatctccttggcctcctcgatgg 306
               |||||||||||| ||||||||| ||||||| || ||||||||||||||||||| |||||
Sbjct: 207080 cgacgacgatgtcggcttcaggcttgtccttgagaatgatctccttggcctccttgatgg 207021

                                                
Query: 307    actttcccactacctccggccatgacgtcttctt 340
               |   || || ||||||||||| |||||||||||
Sbjct: 207020 tcaggccgaccacctccggccaagacgtcttctt 206987



 Score =  119 bits (60), Expect = 8e-24
 Identities = 102/116 (87%)
 Strand = Plus / Plus

                                                                          
Query: 241    ctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctccttggcctcct 300
              ||||||||||   |||||||||||||||||||||||| ||||||| || | |||| ||||
Sbjct: 225002 ctgggaggactttgatgtccgcttcaggcatgtccttgaggatgaccttcctggcgtcct 225061

                                                                      
Query: 301    cgatggactttcccactacctccggccatgacgtcttcttctcctctccggcgggg 356
              |||||||||| ||||||| ||||| ||| |||| |||||||||||| |||||||||
Sbjct: 225062 cgatggacttccccactaactccgcccaggacgacttcttctcctcaccggcgggg 225117



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 60/66 (90%)
 Strand = Plus / Plus

                                                                          
Query: 149    agctagctagccaatgtggggagtggacgcgacagtgtcgacgaagatgcggacacggtt 208
              |||||||||||| ||||| ||||||| |||||||||||| |||| |||||||||||||||
Sbjct: 217534 agctagctagccgatgtgaggagtggtcgcgacagtgtcaacgaggatgcggacacggtt 217593

                    
Query: 209    ggtcct 214
              | ||||
Sbjct: 217594 gctcct 217599



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 397    tgaacttgactgatatgagtattt 420
              ||||||||||||||||||||||||
Sbjct: 221013 tgaacttgactgatatgagtattt 221036



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 397    tgaacttgactgatatgagtattt 420
              ||||||||||||||| ||||||||
Sbjct: 218472 tgaacttgactgatacgagtattt 218495
to top
>emb|AJ250663.2|HVU250663 Hordeum vulgare partial mRNA for putative proteinase inhibitor
           (bci-7 gene)
          Length = 306

 Score =  599 bits (302), Expect = e-168
 Identities = 305/306 (99%)
 Strand = Plus / Minus

                                                                       
Query: 101 acttattcatcagcatccacaatgcatccatgttgcctttgcttgcaaagctagctagcc 160
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 306 acttattcatcagcatccacaatgcatccatgttgcctttgcttgcaaagctagctagcc 247

                                                                       
Query: 161 aatgtggggagtggacgcgacagtgtcgacgaagatgcggacacggttggtcctgaagtc 220
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 246 aatgtggggagtggacgcgacagtgtcgacgaagatgcggacacggttggtcctgaagtc 187

                                                                       
Query: 221 gagggtcaccggcgagccggctgggaggacgacgatgtccgcttcaggcatgtccttaag 280
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 186 gagggtcaccggcgagccggctgggaggacgacgatgtccgcttcaggcatgtccttaag 127

                                                                       
Query: 281 gatgatctccttggcctcctcgatggactttcccactacctccggccatgacgtcttctt 340
           |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 126 gatgatctccttggcctcctcgatggactttcccgctacctccggccatgacgtcttctt 67

                                                                       
Query: 341 ctcctctccggcgggggcttttggggcggcgcagctcatcctcgattcggcaggcgtgaa 400
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 66  ctcctctccggcgggggcttttggggcggcgcagctcatcctcgattcggcaggcgtgaa 7

                 
Query: 401 cttgac 406
           ||||||
Sbjct: 6   cttgac 1
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 134/162 (82%)
 Strand = Plus / Plus

                                                                            
Query: 177      gcgacagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtcaccggcgag 236
                ||||| ||||| |||||||||||||| |||||||  | ||||||||||||||||||||| 
Sbjct: 22227277 gcgacggtgtcaacgaagatgcggacgcggttggagcggaagtcgagggtcaccggcgac 22227336

                                                                            
Query: 237      ccggctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctccttggcc 296
                || || || || ||||||||||| || || ||||||||||| ||||| | || ||| |||
Sbjct: 22227337 cccgccggaagcacgacgatgtcggcgtcgggcatgtccttgaggatcaccttcttcgcc 22227396

                                                          
Query: 297      tcctcgatggactttcccactacctccggccatgacgtcttc 338
                |||||    |||   ||||| ||||||||||| |||||||||
Sbjct: 22227397 tcctccgccgacagccccaccacctccggccacgacgtcttc 22227438



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                            
Query: 177      gcgacagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtcaccggcgag 236
                ||||| |||||||||||||||||||| |||||||  | |||||| | |||||||||||  
Sbjct: 22236610 gcgacggtgtcgacgaagatgcggacgcggttggggcggaagtccatggtcaccggcgtc 22236669

                                                                            
Query: 237      ccggctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctccttggcc 296
                ||  | || |  ||||||||||| || || ||||||||||| ||||| | || ||| |||
Sbjct: 22236670 cccaccggaaccacgacgatgtcggcgtcgggcatgtccttgaggatcaccttcttcgcc 22236729

                     
Query: 297      tcctc 301
                |||||
Sbjct: 22236730 tcctc 22236734



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 132/166 (79%), Gaps = 4/166 (2%)
 Strand = Plus / Plus

                                                                            
Query: 177      gcgacagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtca----ccgg 232
                ||||| |||||||||||||||||||| |||||||  | ||||||   |||||    ||||
Sbjct: 22231902 gcgacggtgtcgacgaagatgcggacgcggttggggcggaagtccttggtcaccggccgg 22231961

                                                                            
Query: 233      cgagccggctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctcctt 292
                ||| || || || || ||||||||||| || || ||||||||||| ||||| | || |||
Sbjct: 22231962 cgaccccgccggaagcacgacgatgtcggcgtcgggcatgtccttgaggatcaccttctt 22232021

                                                              
Query: 293      ggcctcctcgatggactttcccactacctccggccatgacgtcttc 338
                 |||||||| |  | |   ||||| ||||||||||| |||||||||
Sbjct: 22232022 cgcctcctccaccggcagccccaccacctccggccacgacgtcttc 22232067



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                                 
Query: 177      gcgacagtgtcgacgaagatgcggacacggttg 209
                ||||| |||||||||||||| ||||||||||||
Sbjct: 14455880 gcgacggtgtcgacgaagattcggacacggttg 14455912
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 134/162 (82%)
 Strand = Plus / Plus

                                                                            
Query: 177      gcgacagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtcaccggcgag 236
                ||||| ||||| |||||||||||||| |||||||  | ||||||||||||||||||||| 
Sbjct: 22155622 gcgacggtgtcaacgaagatgcggacgcggttggagcggaagtcgagggtcaccggcgac 22155681

                                                                            
Query: 237      ccggctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctccttggcc 296
                || || || || ||||||||||| || || ||||||||||| ||||| | || ||| |||
Sbjct: 22155682 cccgccggaagcacgacgatgtcggcgtcgggcatgtccttgaggatcaccttcttcgcc 22155741

                                                          
Query: 297      tcctcgatggactttcccactacctccggccatgacgtcttc 338
                |||||    |||   ||||| ||||||||||| |||||||||
Sbjct: 22155742 tcctccgccgacagccccaccacctccggccacgacgtcttc 22155783



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                            
Query: 177      gcgacagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtcaccggcgag 236
                ||||| |||||||||||||||||||| |||||||  | |||||| | |||||||||||  
Sbjct: 22164955 gcgacggtgtcgacgaagatgcggacgcggttggggcggaagtccatggtcaccggcgtc 22165014

                                                                            
Query: 237      ccggctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctccttggcc 296
                ||  | || |  ||||||||||| || || ||||||||||| ||||| | || ||| |||
Sbjct: 22165015 cccaccggaaccacgacgatgtcggcgtcgggcatgtccttgaggatcaccttcttcgcc 22165074

                     
Query: 297      tcctc 301
                |||||
Sbjct: 22165075 tcctc 22165079



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 132/166 (79%), Gaps = 4/166 (2%)
 Strand = Plus / Plus

                                                                            
Query: 177      gcgacagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtca----ccgg 232
                ||||| |||||||||||||||||||| |||||||  | ||||||   |||||    ||||
Sbjct: 22160247 gcgacggtgtcgacgaagatgcggacgcggttggggcggaagtccttggtcaccggccgg 22160306

                                                                            
Query: 233      cgagccggctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctcctt 292
                ||| || || || || ||||||||||| || || ||||||||||| ||||| | || |||
Sbjct: 22160307 cgaccccgccggaagcacgacgatgtcggcgtcgggcatgtccttgaggatcaccttctt 22160366

                                                              
Query: 293      ggcctcctcgatggactttcccactacctccggccatgacgtcttc 338
                 |||||||| |  | |   ||||| ||||||||||| |||||||||
Sbjct: 22160367 cgcctcctccaccggcagccccaccacctccggccacgacgtcttc 22160412



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                                 
Query: 177      gcgacagtgtcgacgaagatgcggacacggttg 209
                ||||| |||||||||||||| ||||||||||||
Sbjct: 14410164 gcgacggtgtcgacgaagattcggacacggttg 14410196
to top
>emb|AL731742.3|CNS08C7R Oryza sativa chromosome 12, . BAC OJ1123_B09 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 155585

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 134/162 (82%)
 Strand = Plus / Minus

                                                                         
Query: 177   gcgacagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtcaccggcgag 236
             ||||| ||||| |||||||||||||| |||||||  | ||||||||||||||||||||| 
Sbjct: 25733 gcgacggtgtcaacgaagatgcggacgcggttggagcggaagtcgagggtcaccggcgac 25674

                                                                         
Query: 237   ccggctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctccttggcc 296
             || || || || ||||||||||| || || ||||||||||| ||||| | || ||| |||
Sbjct: 25673 cccgccggaagcacgacgatgtcggcgtcgggcatgtccttgaggatcaccttcttcgcc 25614

                                                       
Query: 297   tcctcgatggactttcccactacctccggccatgacgtcttc 338
             |||||    |||   ||||| ||||||||||| |||||||||
Sbjct: 25613 tcctccgccgacagccccaccacctccggccacgacgtcttc 25572



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 102/125 (81%)
 Strand = Plus / Minus

                                                                         
Query: 177   gcgacagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtcaccggcgag 236
             ||||| |||||||||||||||||||| |||||||  | |||||| | |||||||||||  
Sbjct: 16400 gcgacggtgtcgacgaagatgcggacgcggttggggcggaagtccatggtcaccggcgtc 16341

                                                                         
Query: 237   ccggctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctccttggcc 296
             ||  | || |  ||||||||||| || || ||||||||||| ||||| | || ||| |||
Sbjct: 16340 cccaccggaaccacgacgatgtcggcgtcgggcatgtccttgaggatcaccttcttcgcc 16281

                  
Query: 297   tcctc 301
             |||||
Sbjct: 16280 tcctc 16276



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 132/166 (79%), Gaps = 4/166 (2%)
 Strand = Plus / Minus

                                                                         
Query: 177   gcgacagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtca----ccgg 232
             ||||| |||||||||||||||||||| |||||||  | ||||||   |||||    ||||
Sbjct: 21108 gcgacggtgtcgacgaagatgcggacgcggttggggcggaagtccttggtcaccggccgg 21049

                                                                         
Query: 233   cgagccggctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctcctt 292
             ||| || || || || ||||||||||| || || ||||||||||| ||||| | || |||
Sbjct: 21048 cgaccccgccggaagcacgacgatgtcggcgtcgggcatgtccttgaggatcaccttctt 20989

                                                           
Query: 293   ggcctcctcgatggactttcccactacctccggccatgacgtcttc 338
              |||||||| |  | |   ||||| ||||||||||| |||||||||
Sbjct: 20988 cgcctcctccaccggcagccccaccacctccggccacgacgtcttc 20943
to top
>gb|BT017006.1| Zea mays clone EK07D2310C10.c mRNA sequence
          Length = 531

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                       
Query: 267 ggcatgtccttaaggatgatctccttggcctcctcgatggactttcccactacctccggc 326
           ||||||||||| || ||| ||||| | ||||||| ||||||| | ||||| |||||||||
Sbjct: 191 ggcatgtccttgagaatggtctccgtcgcctccttgatggacatgcccaccacctccggc 132

                            
Query: 327 catgacgtcttcttctc 343
           || ||||||||||||||
Sbjct: 131 cacgacgtcttcttctc 115
to top
>dbj|AK058739.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-G06, full
           insert sequence
          Length = 451

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 102/125 (81%)
 Strand = Plus / Minus

                                                                       
Query: 177 gcgacagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtcaccggcgag 236
           ||||| |||||||||||||||||||| |||||||  | |||||| | |||||||||||  
Sbjct: 293 gcgacggtgtcgacgaagatgcggacgcggttggggcggaagtccatggtcaccggcgtc 234

                                                                       
Query: 237 ccggctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctccttggcc 296
           ||  | || |  ||||||||||| || || ||||||||||| ||||| | || ||| |||
Sbjct: 233 cccaccggaaccacgacgatgtcggcgtcgggcatgtccttgaggatcaccttcttcgcc 174

                
Query: 297 tcctc 301
           |||||
Sbjct: 173 tcctc 169
to top
>gb|BT018918.1| Zea mays clone Contig12.F mRNA sequence
          Length = 1058

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 380 tgtcgacgaagatgcggacacggtt 356
to top
>gb|AY549626.1| Zea perennis isolate per7b MPI (mpi) gene, complete cds
          Length = 584

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 500 tgtcgacgaagatgcggacacggtt 476
to top
>gb|AY549625.1| Zea perennis isolate per7a MPI (mpi) gene, complete cds
          Length = 592

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 508 tgtcgacgaagatgcggacacggtt 484
to top
>gb|AY549624.1| Zea perennis isolate per6 MPI (mpi) gene, complete cds
          Length = 593

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 509 tgtcgacgaagatgcggacacggtt 485
to top
>gb|AY549623.1| Zea perennis isolate per4d MPI (mpi) gene, complete cds
          Length = 578

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 494 tgtcgacgaagatgcggacacggtt 470
to top
>gb|AY549622.1| Zea perennis isolate per4c MPI (mpi) gene, complete cds
          Length = 571

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 501 tgtcgacgaagatgcggacacggtt 477
to top
>gb|AY549621.1| Zea perennis isolate per4b MPI (mpi) gene, complete cds
          Length = 585

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 501 tgtcgacgaagatgcggacacggtt 477
to top
>gb|AY549619.1| Zea perennis isolate per3c MPI (mpi) gene, complete cds
          Length = 580

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 496 tgtcgacgaagatgcggacacggtt 472
to top
>gb|AY549618.1| Zea perennis isolate per3b MPI (mpi) gene, complete cds
          Length = 586

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 502 tgtcgacgaagatgcggacacggtt 478
to top
>gb|AY549617.1| Zea perennis isolate per3a MPI (mpi) gene, complete cds
          Length = 594

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 510 tgtcgacgaagatgcggacacggtt 486
to top
>gb|AY549616.1| Zea perennis isolate per2c MPI (mpi) gene, complete cds
          Length = 593

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 509 tgtcgacgaagatgcggacacggtt 485
to top
>gb|AY549614.1| Zea perennis isolate per2a MPI (mpi) gene, complete cds
          Length = 585

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 501 tgtcgacgaagatgcggacacggtt 477
to top
>gb|AY549612.1| Zea perennis isolate per1b MPI (mpi) gene, complete cds
          Length = 585

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 501 tgtcgacgaagatgcggacacggtt 477
to top
>gb|AY549599.1| Zea diploperennis isolate d1b MPI (mpi) gene, complete cds
          Length = 585

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 501 tgtcgacgaagatgcggacacggtt 477
to top
>emb|X82187.1|ZMPIS7 Z.mays mRNA for pis7
          Length = 386

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 262 tgtcgacgaagatgcggacacggtt 238
to top
>emb|X78988.2|ZMMPI Zea mays MPI gene
          Length = 1262

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 184  tgtcgacgaagatgcggacacggtt 208
            |||||||||||||||||||||||||
Sbjct: 1087 tgtcgacgaagatgcggacacggtt 1063
to top
>emb|X69972.1|ZMCIMS Z.mays mRNA for subtilisin-chymotrypsin inhibitor
          Length = 457

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 282 tgtcgacgaagatgcggacacggtt 258
to top
>dbj|AK121693.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033072A19, full
           insert sequence
          Length = 436

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 177 gcgacagtgtcgacgaagatgcggacacggttg 209
           ||||| |||||||||||||| ||||||||||||
Sbjct: 251 gcgacggtgtcgacgaagattcggacacggttg 219
to top
>dbj|AK063833.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-122-B05, full
           insert sequence
          Length = 452

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 177 gcgacagtgtcgacgaagatgcggacacggttg 209
           ||||| |||||||||||||| ||||||||||||
Sbjct: 252 gcgacggtgtcgacgaagattcggacacggttg 220
to top
>gb|AY104061.1| Zea mays PCO087322 mRNA sequence
          Length = 745

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 471 tgtcgacgaagatgcggacacggtt 447
to top
>gb|AY878693.1| Oryza sativa (japonica cultivar-group) subitilisin-chymotrypsin
           inhibitor (Sci1) mRNA, complete cds
          Length = 435

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 177 gcgacagtgtcgacgaagatgcggacacggttg 209
           ||||| |||||||||||||| ||||||||||||
Sbjct: 228 gcgacggtgtcgacgaagattcggacacggttg 196
to top
>emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112_B07 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118101

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 177   gcgacagtgtcgacgaagatgcggacacggttg 209
             ||||| |||||||||||||| ||||||||||||
Sbjct: 61412 gcgacggtgtcgacgaagattcggacacggttg 61380
to top
>gb|DQ147231.1| Zea mays subsp. parviglumis isolate 11c maize protease inhibitor
           (mpi) gene, complete cds
          Length = 566

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 480 tgtcgacgaagatgcggacacggtt 456
to top
>gb|DQ147230.1| Zea mays subsp. parviglumis isolate 11b maize protease inhibitor
           (mpi) gene, complete cds
          Length = 565

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 480 tgtcgacgaagatgcggacacggtt 456
to top
>gb|DQ147229.1| Zea mays subsp. parviglumis isolate 10a maize protease inhibitor
           (mpi) gene, complete cds
          Length = 566

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 480 tgtcgacgaagatgcggacacggtt 456
to top
>gb|DQ147228.1| Zea mays subsp. parviglumis isolate 10b maize protease inhibitor
           (mpi) gene, complete cds
          Length = 566

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 480 tgtcgacgaagatgcggacacggtt 456
to top
>gb|DQ147227.1| Zea mays subsp. parviglumis isolate 9b maize protease inhibitor
           (mpi) gene, complete cds
          Length = 558

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 472 tgtcgacgaagatgcggacacggtt 448
to top
>gb|DQ147226.1| Zea mays subsp. parviglumis isolate 9a maize protease inhibitor
           (mpi) gene, complete cds
          Length = 554

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 469 tgtcgacgaagatgcggacacggtt 445
to top
>gb|DQ147225.1| Zea mays subsp. parviglumis isolate 8b maize protease inhibitor
           (mpi) gene, complete cds
          Length = 564

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 478 tgtcgacgaagatgcggacacggtt 454
to top
>gb|DQ147224.1| Zea mays subsp. parviglumis isolate 7a maize protease inhibitor
           (mpi) gene, complete cds
          Length = 574

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 488 tgtcgacgaagatgcggacacggtt 464
to top
>gb|DQ147223.1| Zea mays subsp. parviglumis isolate 6b maize protease inhibitor
           (mpi) gene, complete cds
          Length = 564

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 478 tgtcgacgaagatgcggacacggtt 454
to top
>gb|DQ147222.1| Zea mays subsp. parviglumis isolate 5a maize protease inhibitor
           (mpi) gene, complete cds
          Length = 558

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 472 tgtcgacgaagatgcggacacggtt 448
to top
>gb|DQ147221.1| Zea mays subsp. parviglumis isolate 5b maize protease inhibitor
           (mpi) gene, complete cds
          Length = 566

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 480 tgtcgacgaagatgcggacacggtt 456
to top
>gb|DQ147220.1| Zea mays subsp. parviglumis isolate 4b maize protease inhibitor
           (mpi) gene, complete cds
          Length = 566

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 480 tgtcgacgaagatgcggacacggtt 456
to top
>gb|DQ147219.1| Zea mays subsp. parviglumis isolate 4c maize protease inhibitor
           (mpi) gene, complete cds
          Length = 596

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 510 tgtcgacgaagatgcggacacggtt 486
to top
>gb|DQ147218.1| Zea mays subsp. parviglumis isolate 3c maize protease inhibitor
           (mpi) gene, complete cds
          Length = 580

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 494 tgtcgacgaagatgcggacacggtt 470
to top
>gb|DQ147217.1| Zea mays subsp. parviglumis isolate 3a maize protease inhibitor
           (mpi) gene, complete cds
          Length = 587

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 501 tgtcgacgaagatgcggacacggtt 477
to top
>gb|DQ147216.1| Zea mays subsp. parviglumis isolate 2a maize protease inhibitor
           (mpi) gene, complete cds
          Length = 580

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 494 tgtcgacgaagatgcggacacggtt 470
to top
>gb|DQ147215.1| Zea mays subsp. parviglumis isolate 1b maize protease inhibitor
           (mpi) gene, complete cds
          Length = 564

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||||||||||||
Sbjct: 478 tgtcgacgaagatgcggacacggtt 454
to top
>gb|AY549627.1| Tripsacum dactyloides MPI (mpi) gene, complete cds
          Length = 379

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 184 tgtcgacgaagatgcggacacggt 207
           ||||||||||||||||||||||||
Sbjct: 350 tgtcgacgaagatgcggacacggt 327
to top
>gb|AY424272.1| Brachypodium distachyon ecotype ABR5 serine proteinase inhibitor
           (PIN1) mRNA, complete cds
          Length = 440

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 183 gtgtcgacgaagatgcggacacggttgg 210
           |||||||||||||| |||||||||||||
Sbjct: 264 gtgtcgacgaagattcggacacggttgg 237



 Score = 46.1 bits (23), Expect = 0.091
 Identities = 65/79 (82%)
 Strand = Plus / Minus

                                                                       
Query: 250 cgacgatgtccgcttcaggcatgtccttaaggatgatctccttggcctcctcgatggact 309
           |||||||||| || |||||| ||||||| ||||| | || ||| ||||||| ||||||| 
Sbjct: 197 cgacgatgtcggcgtcaggcttgtccttgaggatcaccttctttgcctccttgatggaca 138

                              
Query: 310 ttcccactacctccggcca 328
             || || |||||||||||
Sbjct: 137 gcccgaccacctccggcca 119
to top
>gb|AY112541.1| Zea mays CL44946_1 mRNA sequence
          Length = 509

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 267 ggcatgtccttaaggatgatctccttggcctcctcgatggactttcccactacctccggc 326
           ||||||||||| || ||  ||||| | ||||||| ||||||| | ||||| |||||||||
Sbjct: 291 ggcatgtccttgagaatagtctccgtcgcctccttgatggacatgcccaccacctccggc 350

                   
Query: 327 catgacgt 334
           || |||||
Sbjct: 351 cacgacgt 358
to top
>gb|AC108157.3| Homo sapiens BAC clone RP11-580P21 from 4, complete sequence
          Length = 167001

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 50     gtagcatgctggtggtcagcat 71
              ||||||||||||||||||||||
Sbjct: 149393 gtagcatgctggtggtcagcat 149372
to top
>gb|U51243.1|HSU51243 Human alpha-albumin gene, complete cds
          Length = 24454

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 50   gtagcatgctggtggtcagcat 71
            ||||||||||||||||||||||
Sbjct: 2688 gtagcatgctggtggtcagcat 2667
to top
>gb|M21400.1|BLYCI1A Barley chymotrypsin inhibitor (CI-1A) mRNA, complete cds
          Length = 446

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 278 aaggatgatctccttggcctcctcgatggactttcccactacctccggccatga 331
           |||||||||||| ||||||| ||||  |||| | || || ||||||||||||||
Sbjct: 193 aaggatgatctctttggccttctcggcggacatcccgaccacctccggccatga 140
to top
>gb|AY549620.1| Zea perennis MPI (mpi) gene, complete cds
          Length = 591

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||| ||||||||
Sbjct: 503 tgtcgacgaagatgcgaacacggtt 479
to top
>gb|AY549615.1| Zea perennis isolate per2b MPI (mpi) gene, complete cds
          Length = 591

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||| ||||||||
Sbjct: 503 tgtcgacgaagatgcgaacacggtt 479
to top
>gb|AY549613.1| Zea perennis isolate per1c MPI (mpi) gene, complete cds
          Length = 591

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||| ||||||||
Sbjct: 503 tgtcgacgaagatgcgaacacggtt 479
to top
>gb|AY549610.1| Zea diploperennis isolate d8b MPI (mpi) gene, complete cds
          Length = 591

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||| ||||||||
Sbjct: 503 tgtcgacgaagatgcgaacacggtt 479
to top
>gb|AY549609.1| Zea diploperennis isolate d8a MPI (mpi) gene, complete cds
          Length = 586

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||| ||||||||
Sbjct: 502 tgtcgacgaagatgcgaacacggtt 478
to top
>gb|AY549608.1| Zea diploperennis isolate d7b MPI (mpi) gene, complete cds
          Length = 591

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||| ||||||||
Sbjct: 503 tgtcgacgaagatgcgaacacggtt 479
to top
>gb|AY549607.1| Zea diploperennis isolate d7a MPI (mpi) gene, complete cds
          Length = 588

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||| ||||||||
Sbjct: 500 tgtcgacgaagatgcgaacacggtt 476
to top
>gb|AY549606.1| Zea diploperennis isolate d6b MPI (mpi) gene, complete cds
          Length = 587

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||| ||||||||
Sbjct: 503 tgtcgacgaagatgcgaacacggtt 479
to top
>gb|AY549605.1| Zea diploperennis isolate d6a MPI (mpi) gene, complete cds
          Length = 591

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||| ||||||||
Sbjct: 503 tgtcgacgaagatgcgaacacggtt 479
to top
>gb|AY549604.1| Zea diploperennis isolate d5b MPI (mpi) gene, complete cds
          Length = 562

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||| ||||||||
Sbjct: 474 tgtcgacgaagatgcgaacacggtt 450
to top
>gb|AY549603.1| Zea diploperennis isolate d5a MPI (mpi) gene, complete cds
          Length = 562

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||| ||||||||
Sbjct: 474 tgtcgacgaagatgcgaacacggtt 450
to top
>gb|AY549602.1| Zea diploperennis isolate d4a MPI (mpi) gene, complete cds
          Length = 591

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||| ||||||||
Sbjct: 503 tgtcgacgaagatgcgaacacggtt 479
to top
>gb|AY549601.1| Zea diploperennis isolate d3a MPI (mpi) gene, complete cds
          Length = 562

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||| ||||||||
Sbjct: 474 tgtcgacgaagatgcgaacacggtt 450
to top
>gb|AY549600.1| Zea diploperennis isolate d2a MPI (mpi) gene, complete cds
          Length = 569

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||| ||||||||
Sbjct: 503 tgtcgacgaagatgcgaacacggtt 479
to top
>gb|AY549598.1| Zea diploperennis isolate d1a MPI (mpi) gene, complete cds
          Length = 591

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 184 tgtcgacgaagatgcggacacggtt 208
           |||||||||||||||| ||||||||
Sbjct: 503 tgtcgacgaagatgcgaacacggtt 479
to top
>ref|XM_369944.1| Magnaporthe grisea 70-15 hypothetical protein (MG06459.4) partial
           mRNA
          Length = 2781

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 285 atctccttggcctcctcgat 304
           ||||||||||||||||||||
Sbjct: 869 atctccttggcctcctcgat 850
to top
>emb|CT009509.7| Mouse DNA sequence from clone RP23-140C10 on chromosome 13, complete
              sequence
          Length = 218144

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 147    aaagctagctagccaatgtg 166
              ||||||||||||||||||||
Sbjct: 209034 aaagctagctagccaatgtg 209015
to top
>ref|XM_537053.2| PREDICTED: Canis familiaris similar to Cofilin-1 (Cofilin,
           non-muscle isoform) (18 kDa phosphoprotein) (p18)
           (LOC479927), mRNA
          Length = 1046

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 gatctccttggcctcctcga 303
           ||||||||||||||||||||
Sbjct: 246 gatctccttggcctcctcga 227
to top
>gb|AC129092.13| Medicago truncatula clone mth2-17n16, complete sequence
          Length = 104281

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 77    tattgatccatgcttattgg 96
             ||||||||||||||||||||
Sbjct: 33323 tattgatccatgcttattgg 33304
to top
>emb|AL939122.1|SCO939122 Streptomyces coelicolor A3(2) complete genome; segment 19/29
          Length = 311000

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 284    gatctccttggcctcctcga 303
              ||||||||||||||||||||
Sbjct: 131103 gatctccttggcctcctcga 131084
to top
>ref|XM_682322.1| PREDICTED: Danio rerio similar to papilin (LOC559025), mRNA
          Length = 3387

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 281 gatgatctccttggcctcct 300
           ||||||||||||||||||||
Sbjct: 198 gatgatctccttggcctcct 179
to top
>gb|AC147918.2| Xenopus tropicalis clone CH216-8N16, complete sequence
          Length = 210128

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 13     aaattataaataactggtca 32
              ||||||||||||||||||||
Sbjct: 172778 aaattataaataactggtca 172759
to top
>gb|AF152393.1|MMTSP4S2 Mus musculus thrombospondin 4 gene, partial cds
          Length = 18901

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 147   aaagctagctagccaatgtg 166
             ||||||||||||||||||||
Sbjct: 15524 aaagctagctagccaatgtg 15543
to top
>gb|AF333038.2| Streptomyces viridochromogenes Avilamycin A biosynthetic gene
            cluster, complete sequence
          Length = 59816

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 284  gatctccttggcctcctcga 303
            ||||||||||||||||||||
Sbjct: 2099 gatctccttggcctcctcga 2080
to top
>gb|AC166113.3| Mus musculus BAC clone RP23-23E6 from chromosome 14, complete sequence
          Length = 252394

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 271   tgtccttaaggatgatctccttggcctc 298
             |||||||||||||| ||| |||||||||
Sbjct: 98490 tgtccttaaggatgttctgcttggcctc 98517


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,817,970
Number of Sequences: 3902068
Number of extensions: 3817970
Number of successful extensions: 75022
Number of sequences better than 10.0: 77
Number of HSP's better than 10.0 without gapping: 79
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 74708
Number of HSP's gapped (non-prelim): 312
length of query: 420
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 398
effective length of database: 17,147,199,772
effective search space: 6824585509256
effective search space used: 6824585509256
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top