>emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome D of strain NRRL Y-1140
               of Kluyveromyces lactis
          Length = 1715506

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 43      ttttaacaatgccatgataaa 63
               |||||||||||||||||||||
Sbjct: 1650435 ttttaacaatgccatgataaa 1650455

>ref|XM_534679.2| PREDICTED: Canis familiaris similar to a disintegrin and
            metalloproteinase domain 1a (LOC477481), mRNA
          Length = 3312

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 91   aatggcagtgctttaaattg 110
            ||||||||||||||||||||
Sbjct: 2430 aatggcagtgctttaaattg 2411

>gb|AC122035.2| Mus musculus BAC clone RP24-414B1 from 15, complete sequence
          Length = 179617

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 74    tgggaaattgatttgtaaat 93
             ||||||||||||||||||||
Sbjct: 83146 tgggaaattgatttgtaaat 83127

>emb|AL034375.23|HS523G1 Human DNA sequence from clone RP3-523G1 on chromosome 6p22.3-24.1
             Contains part of the SCA1 gene for spinocerebellar ataxia
             1 (olivopontocerebellar ataxia 1, autosomal dominant,
             ataxin 1), complete sequence
          Length = 109885

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 134   ggccagggtagcttacaagcagct 157
             |||||||||||||||| |||||||
Sbjct: 26624 ggccagggtagcttaccagcagct 26601

>gb|AC151467.2| Xenopus tropicalis BAC clone ISB1-324H4 containing mix-like gene, mix
             gene, complete cds; and mix, bix-like, and bix genes,
             complete cds, complete sequence
          Length = 77269

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 56    atgataaatatatgctgctg 75
             ||||||||||||||||||||
Sbjct: 42882 atgataaatatatgctgctg 42901

>gb|AC006122.24| Homo sapiens 12 BAC RP11-264F23 (Roswell Park Cancer Institute Human
             Bac Library) complete sequence
          Length = 127957

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 116   aagtaatctacaaataccgg 135
             ||||||||||||||||||||
Sbjct: 12538 aagtaatctacaaataccgg 12557

>gb|AF129168.1|AF129168 Lactobacillus casei sorbose operon, partial sequence
          Length = 7135

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 40   aagttttaacaatgccatgataaa 63
            |||||||| |||||||||||||||
Sbjct: 7040 aagttttagcaatgccatgataaa 7017

>gb|AC150475.2| Dasypus novemcinctus clone VMRC5-254H15, complete sequence
          Length = 114142

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 163   aagaatagattataacccca 182
             ||||||||||||||||||||
Sbjct: 37324 aagaatagattataacccca 37305

>gb|AC119967.11| Mus musculus chromosome 10, clone RP24-473K14, complete sequence
          Length = 196661

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 92     atggcagtgctttaaattga 111
              ||||||||||||||||||||
Sbjct: 158010 atggcagtgctttaaattga 158029

>gb|AC146366.3| Dasypus novemcinctus clone VMRC5-468M8, complete sequence
          Length = 112552

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 163    aagaatagattataacccca 182
              ||||||||||||||||||||
Sbjct: 101739 aagaatagattataacccca 101720


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,158,314
Number of Sequences: 3902068
Number of extensions: 2158314
Number of successful extensions: 37595
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 37578
Number of HSP's gapped (non-prelim): 17
length of query: 242
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 220
effective length of database: 17,147,199,772
effective search space: 3772383949840
effective search space used: 3772383949840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)