ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart07d09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|U80037.1|TAU80037 Triticum aestivum ABA induced plasma membra... 82 2e-12
2gb|AF218627.1|AF218627 Hordeum vulgare plasma membrane associate... 62 2e-06
3emb|AL844605.5| Mouse DNA sequence from clone RP24-115D19 on chr... 42 1.6
4dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 42 1.6
5gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 42 1.6
6gb|AC167012.3| Mus musculus BAC clone RP23-416A5 from chromosome... 40 6.4
7gb|AC126799.3| Mus musculus BAC clone RP24-388B22 from chromosom... 40 6.4
8emb|AL603910.6| Human DNA sequence from clone RP11-505P4 on chro... 40 6.4
9emb|AL031003.1|HS422G23 Human DNA sequence from clone RP3-422G23... 40 6.4
10emb|BX545915.7| Zebrafish DNA sequence from clone DKEY-41B16 in ... 40 6.4
11gb|AF442963.1| Homo sapiens MTO1-like protein gene, complete cds... 40 6.4
12ref|NM_137194.1| Drosophila melanogaster CG8179-RA (CG8179), mRNA 40 6.4
13gb|AY095177.1| Drosophila melanogaster GH12942 full insert cDNA 40 6.4
14gb|AC025755.5| Homo sapiens chromosome 5 clone CTD-2045M21, comp... 40 6.4
15gb|AC008343.4|AC008343 Drosophila melanogaster, chromosome 2R, r... 40 6.4
16gb|AE003810.3| Drosophila melanogaster chromosome 2R, section 40... 40 6.4
17gb|AC159261.4| Mus musculus BAC clone RP24-80C13 from chromosome... 40 6.4

>gb|U80037.1|TAU80037 Triticum aestivum ABA induced plasma membrane protein PM-19
           (WTABAPM) mRNA, complete cds
          Length = 1094

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 80/92 (86%), Gaps = 2/92 (2%)
 Strand = Plus / Minus

                                                                       
Query: 361 gaccacgcccagatcgatcaccggcgccttaattagaccctggccacgccgccggtggcc 420
           ||||||||| |||||||||||||||   |   ||| ||||| || |||||||||||| ||
Sbjct: 718 gaccacgccgagatcgatcaccggct--tggcttacaccctcgcgacgccgccggtgccc 661

                                           
Query: 421 atgcccttgttatgcgggtcgccggcgccata 452
           ||||||||||| ||||||||||||||||||||
Sbjct: 660 atgcccttgttgtgcgggtcgccggcgccata 629



to top

>gb|AF218627.1|AF218627 Hordeum vulgare plasma membrane associated protein (pm19) mRNA,
           complete cds
          Length = 1000

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 393 ttagaccctggccacgccgccggtggccatgcccttgtt 431
           ||||||||| ||||||||||||||| |||||||||||||
Sbjct: 694 ttagacccttgccacgccgccggtgcccatgcccttgtt 656



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 458 cgtgctccgccggataccca 477
           ||||||||||||||||||||
Sbjct: 626 cgtgctccgccggataccca 607



to top

>emb|AL844605.5| Mouse DNA sequence from clone RP24-115D19 on chromosome 2, complete
             sequence
          Length = 188958

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 317   gacacacactaacaccacaca 337
             |||||||||||||||||||||
Sbjct: 12269 gacacacactaacaccacaca 12289



to top

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 365     acgcccagatcgatcaccggc 385
               |||||||||||||||||||||
Sbjct: 3025120 acgcccagatcgatcaccggc 3025100



to top

>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 365     acgcccagatcgatcaccggc 385
               |||||||||||||||||||||
Sbjct: 3032317 acgcccagatcgatcaccggc 3032297



to top

>gb|AC167012.3| Mus musculus BAC clone RP23-416A5 from chromosome 13, complete sequence
          Length = 193916

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 167   tgccaaaaaagaacacccac 186
             ||||||||||||||||||||
Sbjct: 38203 tgccaaaaaagaacacccac 38222



to top

>gb|AC126799.3| Mus musculus BAC clone RP24-388B22 from chromosome 13, complete
             sequence
          Length = 168873

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 206   tgtacatgtctacagccatg 225
             ||||||||||||||||||||
Sbjct: 65357 tgtacatgtctacagccatg 65338



to top

>emb|AL603910.6| Human DNA sequence from clone RP11-505P4 on chromosome 6 Contains the
             5' end of the C6orf150 gene for chromosome 6 open reading
             frame 150 , the MTO1 gene for mitochondrial translation
             optimization 1 homolog (S. cerevisiae), the EEF1A1 gene
             for eukaryotic translation elongation factor 1 alpha 1, a
             thymosin beta (TMSNB) pseudogene and 3 CpG islands,
             complete sequence
          Length = 134105

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 197   ctaggcatatgtacatgtct 216
             ||||||||||||||||||||
Sbjct: 64574 ctaggcatatgtacatgtct 64593



to top

>emb|AL031003.1|HS422G23 Human DNA sequence from clone RP3-422G23 on chromosome 6q24 Contains
             the gene for KIAA1244 protein, a macrophage myristoylated
             alanine-rich C kinase substrate (MACMARCKS) pseudogene, a
             pseudogene similar to Mus musculus upregulated during
             skeletal muscle growth 5 (Usmg5), the gene for chromosome
             6 open reading frame 34 (C6orf34) (SOUL) and a CpG island,
             complete sequence
          Length = 159344

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 164   ccctgccaaaaaagaacacc 183
             ||||||||||||||||||||
Sbjct: 92630 ccctgccaaaaaagaacacc 92611



to top

>emb|BX545915.7| Zebrafish DNA sequence from clone DKEY-41B16 in linkage group 3,
             complete sequence
          Length = 192468

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 201   gcatatgtacatgtctacag 220
             ||||||||||||||||||||
Sbjct: 39242 gcatatgtacatgtctacag 39223



to top

>gb|AF442963.1| Homo sapiens MTO1-like protein gene, complete cds; nuclear gene for
             mitochondrial product
          Length = 40439

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 197   ctaggcatatgtacatgtct 216
             ||||||||||||||||||||
Sbjct: 10131 ctaggcatatgtacatgtct 10150



to top

>ref|NM_137194.1| Drosophila melanogaster CG8179-RA (CG8179), mRNA
          Length = 5005

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 407 cgccgccggtggccatgccc 426
           ||||||||||||||||||||
Sbjct: 230 cgccgccggtggccatgccc 249



to top

>gb|AY095177.1| Drosophila melanogaster GH12942 full insert cDNA
          Length = 4808

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 407 cgccgccggtggccatgccc 426
           ||||||||||||||||||||
Sbjct: 17  cgccgccggtggccatgccc 36



to top

>gb|AC025755.5| Homo sapiens chromosome 5 clone CTD-2045M21, complete sequence
          Length = 111634

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 173   aaaagaacacccacacccac 192
             ||||||||||||||||||||
Sbjct: 75227 aaaagaacacccacacccac 75208



to top

>gb|AC008343.4|AC008343 Drosophila melanogaster, chromosome 2R, region 51F-52A, BAC clone
              BACR03D24, complete sequence
          Length = 158402

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 407    cgccgccggtggccatgccc 426
              ||||||||||||||||||||
Sbjct: 109761 cgccgccggtggccatgccc 109780



to top

>gb|AE003810.3| Drosophila melanogaster chromosome 2R, section 40 of 73 of the complete
             sequence
          Length = 271178

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 407   cgccgccggtggccatgccc 426
             ||||||||||||||||||||
Sbjct: 50013 cgccgccggtggccatgccc 50032



to top

>gb|AC159261.4| Mus musculus BAC clone RP24-80C13 from chromosome 13, complete
            sequence
          Length = 230437

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 167  tgccaaaaaagaacacccac 186
            ||||||||||||||||||||
Sbjct: 9909 tgccaaaaaagaacacccac 9928


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,116,510
Number of Sequences: 3902068
Number of extensions: 3116510
Number of successful extensions: 118256
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 118139
Number of HSP's gapped (non-prelim): 117
length of query: 477
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 455
effective length of database: 17,147,199,772
effective search space: 7801975896260
effective search space used: 7801975896260
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top