ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart07d06
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_512960.1| PREDICTED: Pan troglodytes similar to DNA-direc... 52 0.001
2gb|BC034144.1| Homo sapiens polymerase (RNA) II (DNA directed) p... 52 0.001
3gb|BC004441.1| Homo sapiens polymerase (RNA) II (DNA directed) p... 52 0.001
4dbj|AK122813.1| Homo sapiens cDNA FLJ16409 fis, clone BLADE20029... 52 0.001
5gb|S42643.1| RNA polymerase II [human, mRNA, 144 nt] 52 0.001
6ref|NM_002695.2| Homo sapiens polymerase (RNA) II (DNA directed)... 52 0.001
7gb|J04965.1|HUMRNAPII Human RNA polymerase II 23kD subunit (POLR... 52 0.001
8emb|CR860977.1| Pongo pygmaeus mRNA; cDNA DKFZp459G0627 (from cl... 50 0.005
9gb|AY106355.1| Zea mays PCO138189 mRNA sequence 50 0.005
10dbj|D38251.1|HUMRPB5 Homo sapiens mRNA for RPB5 (XAP4), complete... 48 0.021
11ref|XM_472957.1| Oryza sativa (japonica cultivar-group), predic... 46 0.083
12emb|AL662946.2|OSJN00139 Oryza sativa genomic DNA, chromosome 4,... 46 0.083
13dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.083
14dbj|AK100492.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.083
15gb|AC150387.2| Branchiostoma floridae clone CH302-103N24, comple... 42 1.3
16gb|AC109239.8| Mus musculus chromosome 3, clone RP23-191N23, com... 42 1.3
17gb|AC159255.3| Mus musculus BAC clone RP24-89C11 from chromosome... 42 1.3
18gb|AC018737.9| Homo sapiens BAC clone RP11-416H1 from 2, complet... 42 1.3
19gb|AC131154.2| Homo sapiens 3 BAC RP13-489G4 (Roswell Park Cance... 40 5.1
20dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 40 5.1 
>ref|XM_512960.1| PREDICTED: Pan troglodytes similar to DNA-directed RNA polymerase
           II 23 kDa polypeptide (RPB25) (RPB5) (RPABC1) (XAP4)
           (LOC456359), mRNA
          Length = 686

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 343 ccgggtgatcttcaccacctgcccacgctt 372
           |||| |||||||||||||||||||||||||
Sbjct: 618 ccggatgatcttcaccacctgcccacgctt 589
to top
>gb|BC034144.1| Homo sapiens polymerase (RNA) II (DNA directed) polypeptide E,
           25kDa, mRNA (cDNA clone MGC:32760 IMAGE:4617000),
           complete cds
          Length = 1284

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 343 ccgggtgatcttcaccacctgcccacgctt 372
           |||| |||||||||||||||||||||||||
Sbjct: 627 ccggatgatcttcaccacctgcccacgctt 598
to top
>gb|BC004441.1| Homo sapiens polymerase (RNA) II (DNA directed) polypeptide E,
           25kDa, mRNA (cDNA clone MGC:4035 IMAGE:2820565),
           complete cds
          Length = 1248

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 343 ccgggtgatcttcaccacctgcccacgctt 372
           |||| |||||||||||||||||||||||||
Sbjct: 607 ccggatgatcttcaccacctgcccacgctt 578
to top
>dbj|AK122813.1| Homo sapiens cDNA FLJ16409 fis, clone BLADE2002972, highly  similar
            to DNA-DIRECTED RNA POLYMERASE II 23 KDA POLYPEPTIDE (EC
            2.7.7.6)
          Length = 2440

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                          
Query: 343  ccgggtgatcttcaccacctgcccacgctt 372
            |||| |||||||||||||||||||||||||
Sbjct: 1824 ccggatgatcttcaccacctgcccacgctt 1795
to top
>gb|S42643.1| RNA polymerase II [human, mRNA, 144 nt]
          Length = 144

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 343 ccgggtgatcttcaccacctgcccacgctt 372
           |||| |||||||||||||||||||||||||
Sbjct: 99  ccggatgatcttcaccacctgcccacgctt 70
to top
>ref|NM_002695.2| Homo sapiens polymerase (RNA) II (DNA directed) polypeptide E,
           25kDa (POLR2E), mRNA
          Length = 1238

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 343 ccgggtgatcttcaccacctgcccacgctt 372
           |||| |||||||||||||||||||||||||
Sbjct: 607 ccggatgatcttcaccacctgcccacgctt 578
to top
>gb|J04965.1|HUMRNAPII Human RNA polymerase II 23kD subunit (POLR2) mRNA, complete cds
          Length = 1212

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 343 ccgggtgatcttcaccacctgcccacgctt 372
           |||| |||||||||||||||||||||||||
Sbjct: 609 ccggatgatcttcaccacctgcccacgctt 580
to top
>emb|CR860977.1| Pongo pygmaeus mRNA; cDNA DKFZp459G0627 (from clone DKFZp459G0627)
          Length = 1312

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 348 tgatcttcaccacctgcccacgctt 372
           |||||||||||||||||||||||||
Sbjct: 626 tgatcttcaccacctgcccacgctt 602
to top
>gb|AY106355.1| Zea mays PCO138189 mRNA sequence
          Length = 1078

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 347 gtgatcttcaccacctgcccacgcttcat 375
           ||||||||||| |||||||||||||||||
Sbjct: 706 gtgatcttcacgacctgcccacgcttcat 678
to top
>dbj|D38251.1|HUMRPB5 Homo sapiens mRNA for RPB5 (XAP4), complete cds
          Length = 1254

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 343 ccgggtgatcttcaccacctgcccacgc 370
           |||| |||||||||||||||||||||||
Sbjct: 615 ccggatgatcttcaccacctgcccacgc 588
to top
>ref|XM_472957.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 618

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 348 tgatcttcaccacctgcccacgcttcatgccgtaa 382
           ||||||| || || |||||||||||||||||||||
Sbjct: 565 tgatctttacaacttgcccacgcttcatgccgtaa 531
to top
>emb|AL662946.2|OSJN00139 Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ991113_30,
             complete sequence
          Length = 141128

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 348   tgatcttcaccacctgcccacgcttcatgccgtaa 382
             ||||||| || || |||||||||||||||||||||
Sbjct: 44483 tgatctttacaacttgcccacgcttcatgccgtaa 44517
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                   
Query: 348      tgatcttcaccacctgcccacgcttcatgccgtaa 382
                ||||||| || || |||||||||||||||||||||
Sbjct: 24328072 tgatctttacaacttgcccacgcttcatgccgtaa 24328106
to top
>dbj|AK100492.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023098I05, full
            insert sequence
          Length = 2658

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 348  tgatcttcaccacctgcccacgcttcatgccgtaa 382
            ||||||| || || |||||||||||||||||||||
Sbjct: 2284 tgatctttacaacttgcccacgcttcatgccgtaa 2250
to top
>gb|AC150387.2| Branchiostoma floridae clone CH302-103N24, complete sequence
          Length = 193376

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 350  atcttcaccacctgcccacgcttca 374
            ||||||||||||||||| |||||||
Sbjct: 6034 atcttcaccacctgcccgcgcttca 6010
to top
>gb|AC109239.8| Mus musculus chromosome 3, clone RP23-191N23, complete sequence
          Length = 187162

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 214    ttcaaactgagaggaattagc 234
              |||||||||||||||||||||
Sbjct: 154250 ttcaaactgagaggaattagc 154270
to top
>gb|AC159255.3| Mus musculus BAC clone RP24-89C11 from chromosome 3, complete sequence
          Length = 216011

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 214    ttcaaactgagaggaattagc 234
              |||||||||||||||||||||
Sbjct: 196739 ttcaaactgagaggaattagc 196719
to top
>gb|AC018737.9| Homo sapiens BAC clone RP11-416H1 from 2, complete sequence
          Length = 206454

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 280    ggaatgttgtgaggctcaaat 300
              |||||||||||||||||||||
Sbjct: 199313 ggaatgttgtgaggctcaaat 199293
to top
>gb|AC131154.2| Homo sapiens 3 BAC RP13-489G4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 189348

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 280   ggaatgttgtgaggctcaaa 299
             ||||||||||||||||||||
Sbjct: 62218 ggaatgttgtgaggctcaaa 62237
to top
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 339    tcttccgggtgatcttcacc 358
              ||||||||||||||||||||
Sbjct: 648699 tcttccgggtgatcttcacc 648718


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,464,116
Number of Sequences: 3902068
Number of extensions: 2464116
Number of successful extensions: 42022
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41975
Number of HSP's gapped (non-prelim): 47
length of query: 382
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 360
effective length of database: 17,147,199,772
effective search space: 6172991917920
effective search space used: 6172991917920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top