>gb|BT009556.1| Triticum aestivum clone wre1.pk0004.c7:fis, full insert mRNA sequence
          Length = 1972

 Score = 65.9 bits (33), Expect = 9e-09
 Identities = 49/53 (92%), Gaps = 1/53 (1%)
 Strand = Plus / Minus

                                                                 
Query: 6    aaatggctaaacgtttattattggaatcgtcatgtttcccaaaacgcaattca 58
            ||||| |||||||||||||||||||||||||||| ||||||||| ||| ||||
Sbjct: 1951 aaatgtctaaacgtttattattggaatcgtcatg-ttcccaaaatgcagttca 1900

>gb|AY848735.1| Paititia neglecta isolate 02-1244 tektin gene, partial cds
          Length = 729

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 18  gtttattattggaatcgtc 36
           |||||||||||||||||||
Sbjct: 254 gtttattattggaatcgtc 236

>emb|BX908798.1| Parachlamydia-related symbiont UWE25, complete genome
          Length = 2414465

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                      
Query: 7       aatggctaaacgtttattattgg 29
               ||||||||||||||||| |||||
Sbjct: 2189455 aatggctaaacgtttatcattgg 2189433

>gb|AE002132.1| Ureaplasma parvum serovar 3 str. ATCC 700970 section 33 of 59 of the
            complete genome
          Length = 12654

 Score = 36.2 bits (18), Expect = 8.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 5    caaatggctaaacgttta 22
            ||||||||||||||||||
Sbjct: 4889 caaatggctaaacgttta 4906

>gb|AC120181.10| Mus musculus chromosome 12, clone RP24-500I11, complete sequence
          Length = 212015

 Score = 36.2 bits (18), Expect = 8.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 27     tggaatcgtcatgtttcccaaa 48
              |||||| |||||||||||||||
Sbjct: 105528 tggaattgtcatgtttcccaaa 105507

>ref|XM_759174.1| Theileria parva strain Muguga chromosome 4 replication factor C
            (TP04_0632) partial mRNA
          Length = 3582

 Score = 36.2 bits (18), Expect = 8.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 17   cgtttattattggaatcg 34
            ||||||||||||||||||
Sbjct: 1990 cgtttattattggaatcg 1973

>emb|CR626927.1| Bacteroides fragilis NCTC 9343, complete genome
          Length = 5205140

 Score = 36.2 bits (18), Expect = 8.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 14      aaacgtttattattggaa 31
               ||||||||||||||||||
Sbjct: 1214998 aaacgtttattattggaa 1215015

>gb|AC022422.5| Homo sapiens chromosome 5 clone CTD-2199L4, complete sequence
          Length = 245697

 Score = 36.2 bits (18), Expect = 8.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 6      aaatggctaaacgtttattatt 27
              ||||||||| ||||||||||||
Sbjct: 189552 aaatggctacacgtttattatt 189531

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 36.2 bits (18), Expect = 8.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                  
Query: 6        aaatggctaaacgtttat 23
                ||||||||||||||||||
Sbjct: 20023712 aaatggctaaacgtttat 20023729

>gb|AC010234.5|AC010234 Homo sapiens chromosome 5 clone CTC-337B15, complete sequence
          Length = 143553

 Score = 36.2 bits (18), Expect = 8.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 6      aaatggctaaacgtttattatt 27
              ||||||||| ||||||||||||
Sbjct: 114333 aaatggctacacgtttattatt 114354

>dbj|AP006841.1| Bacteroides fragilis YCH46 DNA, complete genome
          Length = 5277274

 Score = 36.2 bits (18), Expect = 8.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 14      aaacgtttattattggaa 31
               ||||||||||||||||||
Sbjct: 1269563 aaacgtttattattggaa 1269580

>dbj|AP004810.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:B1068H08
          Length = 152794

 Score = 36.2 bits (18), Expect = 8.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 6     aaatggctaaacgtttat 23
             ||||||||||||||||||
Sbjct: 11986 aaatggctaaacgtttat 12003

>dbj|AP004809.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:B1018E06
          Length = 178499

 Score = 36.2 bits (18), Expect = 8.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 6      aaatggctaaacgtttat 23
              ||||||||||||||||||
Sbjct: 162052 aaatggctaaacgtttat 162069


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 380,734
Number of Sequences: 3902068
Number of extensions: 380734
Number of successful extensions: 24886
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 24844
Number of HSP's gapped (non-prelim): 42
length of query: 58
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 37
effective length of database: 17,151,101,840
effective search space: 634590768080
effective search space used: 634590768080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)